Introduction
Materials and methods
Rats
Induction of PIA and arthritis scoring
Isolation and culture of primary FLS
Flow-cytometric characterization of FLSs
FLS culture on Matrigel
RNA extraction and quality assessment
RNA preparation and microarray experiments
Data extraction and normalization
Statistics and analyses
Quantitative real-time PCR
Accession number | Gene symbol | Target exonb | Probe | Forward primer | Reverse primer |
---|---|---|---|---|---|
Up-regulated in DA
| |||||
NM_139089.1 | Cxcl10 | 4 | Exiqon Universal probe 67 | TTCGGACCAGCTCTTAGAGAA | GCCTGGTCCTGAGACAAAAG |
XM_220552.3 | Trim16 | 6 | Exiqon Universal probe 1 | GTGAACTCCTTCCCACTCCA | CAGCTGCATTTCTGGAAACA |
NM_017207.1 | Trpv2 | 15 | Exiqon Universal probe 6 | CTCTTCCCACCTTATCTGAGGA | GACCTGAAGGGGCAGATG |
NM_019357.1 | Vil2 | 13 | CCCCAAGACCCAGTGGAATCCTCCa | AGGTACCGGGCGATGTTCT | GGCCTGTTTGGCACTATGTGA |
LOC309362 | Dnmbp | 16 | Exiqon Universal probe 97 | TTGTCTCAGCATGGGTCCTA | ACCAGGATTTTAAGGCCACA |
NM_001107408 | Gins3 | 3–4 | Exiqon Universal probe 17 | GTCGTGGACCTCCACAAAAT | GAACCGTCCAATAAAAGTCTGC |
Down-regulated in DA
| |||||
XM_235434.4 | Gsdmdc1 | 13 | Exiqon Universal probe 68 | AGCACGTCTTGGAACAGAGC | TCCTCATCCCAGCTGTCC |
XM_222868.4 | Olfml2b | 8 | Exiqon Universal probe 106 | CTCCCTTCTTCCATGCTCTG | GCAAGCCCCAGAGGAATAA |
NM_001008321.1 | Gadd45b | 4 | Exiqon Universal probe 25 | ACAGGTGGTCGCCAAGAC | CCAGGCCTTGGCTCTAAAGT |
Estrogen receptors
| |||||
NM_012689.1 | Esr1 | - | Exiqon Universal probe 67 | GCAAGAATGTCGTGCCTCTC | TGAAGACGATGAGCATCCAG |
NM_012754 | Esr2 | - | Exiqon Universal probe 94 | CCTTGAAGGCTCTCGGTGTA | CAGAACCTTTCAGATGTTTCCA |
Results
Characterization of the FLS cell lines used
Genes expressed by FLSs and filtering criteria
Genes differentially expressed between DA and DA.F344(Cia5d) FLSs
Gene Symbold | Definitiona | Accession number | DA mean | Cia5d mean | Fold change | P valueb | Overall rankc |
---|---|---|---|---|---|---|---|
Cancer, Cell Cycle, DNA replication, recombination and repair
| |||||||
Trim16_predicted
e
|
Tripartite motif protein 16 (predicted)
| XM_220552.3 | 262.14 | 82.27 | -3.2 | 0.0033 | 23 |
Cxcl10
|
Chemokine (C-X-C motif) ligand 10
f
| NM_139089.1 | 1218.54 | 434.48 | -2.8 | 0.0001 | 2 |
Dnmbp
| Similar to Dynamin binding protein (Scaffold protein Tuba) | XM_219860.3 | 739.97 | 385.61 | -1.9 | 0.0088 | 62 |
Vil2
|
Villin 2 (Ezrin)
f
| NM_019357.1 | 1642.95 | 984.09 | -1.7 | 0.0023 | 15 |
Nras
| Neuroblastoma RAS viral (v-ras) oncogene homologf | XM_579607.1 | 910.25 | 601.06 | -1.5 | 0.0087 | 60 |
Brms1l_predicted
| Breast cancer metastasis-suppressor 1-like (predicted) | XM_216712.3 | 187.93 | 125.37 | -1.5 | 0.0094 | 64 |
Hnrpd
e
| Heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37 kDa) | NM_024404.1 | 2909.16 | 1959.49 | -1.5 | 0.0010 | 8 |
Rpa2
| Replication protein A2 | NM_021582.1 | 1583.81 | 1154.73 | -1.4 | 0.0074 | 48 |
Ube2d3
| Ubiquitin-conjugating enzyme E2D 3 | NM_031237.1 | 123.48 | 99.45 | -1.2 | 0.0017 | 10 |
Lsm8_predicted
e
| LSM8 homolog, U6 small nuclear RNA associated (S. cerevisiae) (predicted) | XM_216102.3 | 3766.75 | 3121.49 | -1.2 | 0.0024 | 16 |
Smc1l1
| Structural maintenance of chromosomes 1 like 1 (S. cerevisiae) | NM_031683.1 | 4648.45 | 3923.73 | -1.2 | 0.0044 | 30 |
Rpa3_predicted
| Replication protein A3 (predicted) | XM_216097.3 | 4013.83 | 3410.52 | -1.2 | 0.0022 | 14 |
Cell Signaling
| |||||||
Stip1
|
Stress-induced phosphoprotein 1 (Stip1)
| NM_138911.2 | 3478.09 | 2568.75 | -1.4 | 0.0028 | 18 |
Ubiquitination
| |||||||
Usp24_predicted | Ubiquitin specific protease 24 (predicted) | XM_233260.3 | 111.07 | 74.14 | -1.5 | 0.0037 | 25 |
Stub1_predicted
|
STIP1 homology and U-Box containing protein 1 (predicted)
| XM_213270.3 | 4967.20 | 4164.69 | -1.2 | 0.0034 | 24 |
Ribosomal Proteins
| |||||||
Rps6 | Ribosomal protein S6 (Rps6) | NM_017160.1 | 29305.46 | 24538.18 | -1.2 | 0.0085 | 57 |
LOC300278 | Similar to 40S ribosomal protein S9 | XM_213106.3 | 28115.69 | 26209.24 | -1.1 | 0.0086 | 59 |
LOC367102 | Similar to 40S ribosomal protein S9 | XM_345948.2 | 25678.47 | 23353.32 | -1.1 | 0.0043 | 28 |
Others
| |||||||
Trpv2 | Transient receptor potential cation channel, subfamily V, member 2 | NM_017207.1 | 177.90 | 92.25 | -1.9 | 0.0075 | 49 |
Gins3_predicted
e
|
GINS complex subunit 3 (Psf3 homolog)
| XM_226235.2 | 171.57 | 89.64 | -1.9 | 0.0010 | 6 |
LOC499310 | Similar to cell division cycle associated 5 | XM_574612.1 | 450.69 | 270.81 | -1.7 | 0.0061 | 44 |
LOC298186 | Similar to hypothetical protein FLJ33868 (predicted) | XM_238399.3 | 271.10 | 177.29 | -1.5 | 0.0070 | 46 |
Terf1_predicted | Telomeric repeat binding factor 1 (predicted) | XM_238387.3 | 98.95 | 66.02 | -1.5 | 0.0048 | 34 |
LOC308004 | Similar to hypothetical protein FLJ13188 (predicted) | XM_217663.3 | 573.01 | 383.19 | -1.5 | 0.0083 | 56 |
LOC310177 | Similar to RIKEN cDNA 0610040D20 | XM_226872.2 | 85.32 | 58.03 | -1.5 | 0.0044 | 29 |
LOC297821 | Similar to F23N19.9 (predicted) | XM_232684.3 | 1680.52 | 1185.76 | -1.4 | 0.0052 | 36 |
LOC308443 | Similar to CDNA sequence BC028440 | XM_218345.2 | 426.63 | 301.59 | -1.4 | 0.0059 | 41 |
Anp32b | Acidic nuclear phosphoprotein 32 family, member B | NM_131911.2 | 454.58 | 323.06 | -1.4 | 0.0082 | 55 |
Ranbp6_predicted | RAN binding protein 6 (predicted) | XM_219796.2 | 309.74 | 222.79 | -1.4 | 0.0031 | 22 |
LOC297903 | Similar to RIKEN cDNA 6720467C03 (predicted) | XM_216357.3 | 1493.92 | 1088.11 | -1.4 | 0.0075 | 50 |
Qdpr | Quinoid dihydropteridine reductase | NM_022390.1 | 983.32 | 728.72 | -1.3 | 0.0045 | 33 |
Rnf134_predicted | Ring finger protein 134 (predicted) | XM_219963.3 | 952.04 | 717.85 | -1.3 | 0.0059 | 42 |
LOC316731 | Similar to hypothetical protein FLJ23017 (predicted) | XM_237515.3 | 74.86 | 58.48 | -1.3 | 0.0094 | 65 |
LOC309197 | Similar to hypothetical protein | XM_219560.3 | 1413.35 | 1112.64 | -1.3 | 0.0050 | 35 |
LOC316732 | Similar to RIKEN cDNA 4931400A14 (predicted) | XM_244261.3 | 251.40 | 201.41 | -1.2 | 0.0062 | 45 |
Bin2_predicted | Bridging integrator 2 (predicted) | XM_578696.1 | 57.42 | 47.13 | -1.2 | 0.0076 | 51 |
Gene Symbold | Definitiona | Accession number | DA mean | Cia5d mean | Fold change | P valueb | Overall rankc |
---|---|---|---|---|---|---|---|
Cancer, Cell Cycle, DNA replication, recombination and repair
| |||||||
Gadd45b
|
Growth arrest and DNA-damage-inducible 45 beta
| NM_001008321.1 | 214.12 | 412.97 | 1.9 | 0.00572 | 39 |
Gmfg
|
Glia maturation factor, gamma (Gmfg)
| NM_181091.2 | 1359.39 | 2261.87 | 1.7 | 0.00817 | 54 |
Plekhg2_predicted
| Pleckstrin homology domain containing, family G (with RhoGef domain) member 2 (predicted) | XM_214862.3 | 91.97 | 147.62 | 1.6 | 0.00784 | 52 |
Lox
| Lysyl oxidase | XM_579391.1 | 15755.11 | 24559.79 | 1.6 | 0.00198 | 12 |
Brwd3_predicted
| Similar to bromo domain-containing protein disrupted in leukemia (LOC317213) | XM_228518.3 | 43.85 | 52.99 | 1.2 | 0.00596 | 43 |
Aph1a
| Similar to anterior pharynx defective 1 homolog A (C. elegans) | XM_345251.2 | 2820.66 | 3246.28 | 1.2 | 0.00046 | 4 |
Pex19_predicted
e
| Peroxisome biogenesis factor 19 (predicted) | XM_225711.3 | 119.41 | 135.98 | 1.1 | 0.00561 | 38 |
Cell Signaling
| |||||||
Fkbp7_predicted | FK506 binding protein 7 (predicted) | XM_215758.3 | 784.02 | 1450.53 | 1.9 | 0.00578 | 40 |
Ncor1
|
Nuclear receptor co-repressor 1
| XM_577103.1 | 420.35 | 679.65 | 1.6 | 0.00454 | 32 |
Tap1 | Transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) | NM_032055.1 | 190.32 | 288.49 | 1.5 | 0.00878 | 61 |
Prnp | Prion protein | XM_579340.1 | 17242.89 | 24050.29 | 1.4 | 0.00029 | 3 |
Fzd4 | Frizzled homolog 4 (Drosophila) | NM_022623.1 | 44.45 | 60.14 | 1.4 | 0.00406 | 26 |
Gene expression
| |||||||
H1f0 | H1 histone family, member 0 | NM_012578.2 | 150.12 | 229.40 | 1.5 | 0.00707 | 47 |
Cell-Cell Interaction
| |||||||
Fath | Hypothetical gene supported by NM_031819; Fath fat tumor suppressor homolog (Drosophila) | XM_579538.1 | 3803.04 | 5806.86 | 1.5 | 0.00206 | 13 |
Extracellular Matrix
| |||||||
Col5a1 | Collagen, type V, alpha 1 (Col5a1) | NM_134452.1 | 7240.26 | 9852.22 | 1.4 | 0.00807 | 53 |
Others
| |||||||
Gtlf3b_predicted | Gene trap locus F3b (predicted) | XM_343907.2 | 78.16 | 175.41 | 2.2 | 0.00003 | 1 |
Olfml2b_predicted | Olfactomedin-like 2B (predicted) | XM_222868.3 | 1336.30 | 2949.43 | 2.2 | 0.00241 | 17 |
Gsdmdc1_predicted | Gasdermin domain containing 1 (predicted) | XM_235434.3 | 458.74 | 831.39 | 1.8 | 0.00295 | 20 |
Trim41_predicted | Tripartite motif-containing 41 (predicted) | XM_220357.3 | 422.66 | 732.37 | 1.7 | 0.00100 | 7 |
LOC498815 | Hypothetical gene supported by AY771707 | XM_579873.1 | 243.56 | 366.68 | 1.5 | 0.00281 | 19 |
LOC304860 | Similar to N-acetylneuraminate pyruvate lyase | XM_222736.3 | 270.64 | 401.65 | 1.5 | 0.00176 | 11 |
Setdb2_predicted | SET domain, bifurcated 2 (predicted) | XM_224248.3 | 94.38 | 136.31 | 1.4 | 0.00945 | 66 |
LOC361448 | Similar to cDNA sequence BC013529 (predicted) | XM_341726.2 | 2852.12 | 4043.46 | 1.4 | 0.00071 | 5 |
LOC360899 | Similar to SERTA domain containing 4 | XM_341174.2 | 1771.29 | 2489.20 | 1.4 | 0.00886 | 63 |
Ormdl2_predicted | ORM1-like 2 (S. cerevisiae) (predicted) | XM_213832.3 | 1996.56 | 2773.15 | 1.4 | 0.00549 | 37 |
LOC498067 | Similar to RIKEN cDNA 2310003P10 (LOC498067), mRNA. | XM_573266.1 | 368.00 | 494.10 | 1.3 | 0.00860 | 58 |
Nit1 | Nitrilase 1 | NM_182668.1 | 3397.58 | 4472.84 | 1.3 | 0.00296 | 21 |
Fam18b_predicted | Family with sequence similarity 18, member B (predicted) | XM_219680.3 | 2915.92 | 3746.20 | 1.3 | 0.00447 | 31 |
Ubxd2_predicted | UBX domain containing 2 (predicted) | XM_573443.1 | 2018.75 | 2569.23 | 1.3 | 0.00411 | 27 |
Genes upregulated in the highly invasive DA FLSs and downregulated in DA.F344(Cia5d) include cancer-associated and invasion regulatory genes
Genes downregulated in the highly invasive DA FLSs and upregulated in DA.F344(Cia5d) include tumor suppressor and cell cycle check-point genes
Additional genes with reduced expression in DA FLSs
Increased number of estrogen-inducible and ER signaling regulatory genes among the differentially expressed genes
Five of the differentially expressed genes are located within the Cia5d interval
Symbol | Definition | Accession number | Position (Mb) | Cytogenetic | DA mean | Cia5d mean | Fold change | t test | Overall rank |
---|---|---|---|---|---|---|---|---|---|
Reduced levels in Cia5d
| |||||||||
Trim16 | Tripartite motif protein 16 (predicted) (Trim16_predicted) | XM_220552.3 | 48.95 | 10q23 | 262.14 | 82.27 | -3.19 | 0.00326 | 23 |
Trpv2 | Transient receptor potential cation channel, subfamily V, member 2 (Trpv2) | NM_017207.1 | 48.76 | 10q23 | 177.90 | 92.25 | -1.93 | 0.00745 | 49 |
Increased levels in Cia5d
| |||||||||
Ncor1 | Nuclear receptor co-repressor 1 (Ncor1) | XM_577103.1 | 48.62 | 10q23 | 420.35 | 679.65 | 1.62 | 0.00454 | 32 |
Gtlf3b | Gene trap locus F3b (predicted) (Gtlf3b_predicted) | XM_343907.2 | 47.05 | 10q22 | 78.16 | 175.41 | 2.24 | 0.00003 | 1 |
Trim41 | Tripartite motif-containing 41 (predicted) | XM_220357.3 | 34.08 | 10q21 | 422.65 | 732.37 | 1.73 | 0.00099 | 7 |
Differentially expressed | Not-differentially expressed | |
---|---|---|
Genes located within Cia5d | 5 (3.3%) | 146 |
Genes located outside Cia5d | 61 (0.8%) | 7453 |