Circ-ZEB1.33 promotes the proliferation of human HCC by sponging miR-200a-3p and upregulating CDK6

The hospital-based case–control study consists of 64 HCC patients and 30 cancer-free controls. All the subjects were recruited from the third People’s Hospital of Zhenjiang between January 2012 and September 2016. All patients were enduring surgery treatment for primary HCC, anyone with other hematological disorders, previous history of cancers, and chemotherapy were excluded. The cancer-free control subjects from the same geographic area showed no evidence of a genetic relationship with the cases. This study was approved by the Ethics Review Board of the Third People’s Hospital of Zhenjiang, and every patient had written informed consent. The clinical features of all the cases and controls were presented in Table 1.

The possible interaction between circ-ZEB1.33 and sponge miRNA was predicted by using online prediction tool, CircNet (http://​circnet.​mbc.​nctu.​edu.​tw/​).

Human HCC cell lines including 97H, Huh7, HepG2, SNU423, SNU475, and L02 were purchased from American Type Culture Collection (ATCC). All cells were cultured in Dulbecco modified Eagle medium (DMEM) purchased from Gibco (CA, USA) supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, USA) and maintained in humidified 5% CO₂ at 37 °C.

The total serum RNA was extracted from 3 ml HCC and normal control serum by using GenEluteTM Plasma/Serum RNA Purification Mini Kit (Cat. RNB500) (Sigma-Aldrich, MO). For the HCC and adjacent tissues, the total RNA was isolated with TRIzol reagent. And the expression of circ-ZEB1.33 was detected by using Sybergreen^® based real-time PCR. The primers for genes involved in the study were: forward primer: CAGACTCTCCTGAGAAGAA, reverse primer: AAAGCCTCACTGAAAGGAAACA, amplicon size 127 bp for circ-ZEB1.33, and forward Primer TGTGGGCATCAATGGATTTGG, reverse Primer ACACCATGTATTCCGGGTCAAT, amplicon size 110 bp for GAPDH. The transcription of miR-200a-3p was detected by using a commercial Taqman probe (Assay ID: Hs04231538_s1) (Thermofisher). The miR-200a-3p inhibitor was also purchased from Thermo Fischer (MH10991).

Cells were collected and lysed with cell lysis buffer (RIPA) for western blotting (Beyotime, Haimen, China) containing 150 mM NaCl, 1.0% IGEPAL^® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris, pH 8.0. The proteins (30 μg per lane) were separated on 12% SDS-polyacrylamide gels and transferred on a polyvinylidene fluoride membrane (Millipore, Billerica, MA, USA). Immunoblotting of the membrane was performed using the following primary antibodies: anti-CDK6 (ab124821), pRb (s795) (ab47474), Rb (ab24) β-actin (ab8227), all the antibodies were purchased from Abcam (Cambridge MA).

The RNA pull-down assay was performed with Pierce Magnetic RNA–Protein Pull-Down Kit (Thermofisher, CA) in accordance with the instructions from the manufacturer. Briefly, the total RNA was extracted from 97H and Huh7 cell, after the treatment of RNase in room temperature, magnetic beads were incubated with Probes for biotin-labeled circ-ZEB1.33 (Genescript Co., Nanjing, China) and U6 control. The relative expression levels of miR-200a-3p, circ-ZEB1.33 and U6 in the extract were detected by RT-PCR.

Tissue sections were deparaffinized and rehydrated with a graded ethanol series and distilled water, and then treated with 3% H₂O₂ in methanol for 30 min to block endogenous peroxidase activity. Tissue sections were then rinsed twice for 5 min in phosphate-buffered saline (PBS) and incubated with 10% normal goat serum for 30 min to block non-specific antibody binding. After washing, the samples were incubated with a primary anti-CDK6 (ab124821, Abcam, MA) at 4 °C overnight. Sections were then washed in PBS three times and incubated with secondary antibodies. The sections were then stained with DAB per the manufacturer’s protocol, mounted on slides, and photographed using a digital microscope camera (Nikon, Tokyo, Japan).

The cells were washed in phosphate-buffered saline (PBS) and fixed in 75% ice-cold ethanol at − 20  °C overnight. After rehydration with ice-cold PBS, cells were stained with PI/RNase Staining Buffer (BD Biosciences, San Jose, CA, USA) and analyzed using flow cytometry on a FACSCalibur Flow Cytometer (BD Biosciences) using the CellQuest Pro software (BD Biosciences).

The proliferation assay was performed in a Plate 96 by planting initial cell number of 2 × 10³ and detected by using a CCK8 (Dojindo Molecular Technologies, Inc, Japan) kit according to the manufacturer’s protocol.

The 3′UTR region of CDK6 containing the wild-type or mutant potential target site for miR-200a-3p was synthesized in Genescript Co. (Nanjing, China) and inserted into the pGL4.10[luc2] Vector (Promega, WI). For luciferase assay, Huh7 were co-transfected pGL4-CDK6-WT 3′UTR or pGL4-CDK6-MU 3′UTR, with miR-200a-3p mimics or control (GenePharma, China) using Lipofectamine 2000 (Thermofisher, CA). Cells were harvested 48 h after transfection for luciferase assay using a Dual-Luciferase^® Reporter Assay System (Promega, WI) according to the manufacturer’s protocol.

Data are presented as mean ± SD. χ² tests and the Student’s t-test analysis of variances were used to evaluate statistical differences in demographic and clinical characteristics. The two values correlations were evaluated by Linear correlation analysis and tested F test. The overall survival in different groups was analyzed by using Kaplan–Meier curve. All the expression experiments we conducted in vitro were repeated at least three times with samples in triplicates. Statistical analysis was performed using the GraphPad Prism software (CA, USA). In all cases, P < 0.05 was considered significant.

We queried the possible interaction between circ-ZEB1.33 and sponge miRNA by using online prediction tool, CircNet (http://​circnet.​mbc.​nctu.​edu.​tw/​), we found that circ-ZEB1.33 might promote CDK6 expression by sponge miR-140-3p and miR-200a-3p (Fig. 1a). We first verified this circRNA–miRNA-gene regulatory network in human hepatocellular carcinoma by using 64 paired HCC-adjacent tissues and normal control. We found that circ-ZEB1.33 overexpressed in tumor tissues compared to the adjacent tissues as well as normal liver tissues (Fig. 1b). We also found that it is miR-200a-3p but not miR-140-3p significantly decreased in tumor tissues compared to the adjacent tissues as well as the normal tissues (Fig. 1c). Furthermore, we performed a correlation study between the expression of circ-ZEB1.33 and miR-200a-3p in tumor tissues, significantly negative correlation was found (Fig. 1d). Furthermore, we also detected the existence of circ-ZEB1.33 in the serum of HCC patients and healthy control. The results indicated that the serum level of circ-ZEB1.33 was also significantly higher in HCC patients compared to the healthy control (Fig. 1e). A good correlation was found between the circ-ZEB1.33 value of serum and tumor tissue (Fig. 1f).

The circ-ZEB1.33 transcription in both tumor tissues and serum also compared based on different TMN stage, the results indicated that circ-ZEB1.33 was higher in the III–IV stage compared to the I–II stage (Fig. 2a and b). We further divided the HCC patients into two groups according to the expression of circ-ZEB1.33 in tumor tissues. The expression of miR-200a-3p, as well as its potentially targeting gene CDK6, were detected. Supporting the results obtained from Fig. 1, the transcription of miR-200a-3p significantly lower in circ-ZEB1.33^High group compared to circ-ZEB1.33^Low group (Fig. 2c). The transcription and protein expression of CDK6 also significantly higher in the circ-ZEB1.33^High group compared to circ-ZEB1.33^Low group (Fig. 2d and e). A negative correlation between miR-200a-3p and CDK6 transcription and a positive correlation between circ-ZEB1.33 and CDK6 transcription were found within HCC tumor tissues (Fig. 2e and f). Also, the 5-year survival rate was compared between the circ-ZEB1.33^High and the circ-ZEB1.33^Low groups based on tissue and serum circ-ZEB1.33 level respectively, the significantly lower survival rate was found in the circ-ZEB1.33^High compared to the circ-ZEB1.33^Low group (Fig. 2g and h).

To explore the mechanism of circ-ZEB1.33-miR-200a-3p-CDK6, we determined the expression of circ-ZEB-133 in various HCC cell lines (97H, Huh7, HepG2, SNU423, SNU475, and L02), we found that Huh7 and 97H were ranked first 2 high-expression cell lines of all seven (Fig. 3a). A RNA pull-down assay was performed by using a biotin-labeled probe of circ-ZEB1.33, a miR-200a-3p specific amplification fragment can be obtained after PCR the precipitated nuclear acid using miR-200a-3p specific primers (Fig. 3b). The possible binding site of miR-200a-3p to the 3′UTR of CDK6 was predicted by using Targetscan (http://​www.​targetscan.​org/​vert_​71/​), the binding site based CDK6 3′UTR mutation as well as a luciferase-based gene reporter assay were performed (Fig. 3c). The transfection of miR-200a-3p can significantly decrease the promoter activity but can be restored by using the 3′UTR mutation (Fig. 3d).

To investigate the effect of the circ-ZEB1.33-miR-200a-3p-CDK6 on the cell biology of HCC cell, we generated a serial of cell lines based on this regulatory axis including circ-ZEB1.33 overexpression (Huh7-circ-ZEB1.33), circ-ZEB1.33 knockdown (Huh7-shcirc-ZEB1.33), and circ-ZEB1.33 overexpression plus CDK6 knockdown (Huh7-circ-ZEB1.33+shCDK6). The proliferation was accessed by using CCK8 assay. On the one hand, overexpression circ-ZEB1.33 increased the cell proliferation significantly but can be decreased by knockdown CDK6 to significantly slower than the control group. On the other hand, the proliferation of Huh7-shcirc-ZEB1.33 was significantly decreased compared to the control group but can be restored by using the miR-200a-3p inhibitor (Fig. 4a). Also, the cell cycle of these cells was accessed, the percentage of S phase increased significantly in Huh7-circ-ZEB1.33 and decreased until significantly lower than the control group when CDK6 was knockdown in them. Also, the percentage of S phage decreased significantly in Huh7-shcirc-ZEB1.33 cells and further rescued by using an inhibitor to miR-200a-3p (Fig. 4b, Additional file 1: Figure S1). At last, the transcription of miR-200a-3p and CDK6, the protein expression of CDK6 were detected. The transcription of miR-200a-3p decreased with the overexpression of circ-ZEB1.33 and increased with circ-ZEB1.33 knockdown; there was no apparent effect on miR-200a-3p transcription when either its inhibitor or CDK6 was knockdown (Fig. 4c). Reversely to the transcription of miR-200a-3p transcription, CDK6 can be increased by overexpression of circ-ZEB1.33 while decreased by circ-ZEB1.33 knockdown, and this regulation was miR-200a-3p dependent (Fig. 4d and e). Moreover, the phosphorylated Rb in the residue of s795 also increased with the increased expression of CDK6 (Fig. 4e).