Background
Colon cancer is a common malignant tumor of the digestive tract, and its incidence is ranked third among gastrointestinal tumors [
1]. Over the past few decades, the rapid development of molecular biology has enriched the theory of colorectal cancer carcinogenesis [
1‐
4]. In addition, immense progress has been made in diagnostic and treatment strategies for colorectal cancer; the 5-year survival rate of patients with localized disease is 90.1% [
5]. However, following the metastasis of colorectal cancer to adjacent organs or lymph nodes, the 5-year survival rate of patients decreases to 69.2%. Of note, only 39% of patients with colorectal cancer are diagnosed at the localized stage of the disease, prior to metastasis [
6,
7]. Therefore, further in-depth investigations of the pathogenesis of colorectal cancer, as well as the identification of more effective early diagnosis and treatment strategies are essential for colorectal cancer.
MicroRNAs (miRNAs/miRs) are small endogenous single-stranded RNA molecules composed of ~ 20 nucleotides, which act mostly on the 3′UTR of target mRNAs and either degrade or inhibit multiple transcripts [
8,
9]. Previous studies have demonstrated that miRNAs play a critical regulatory role in the initiation and progression of human cancers [
10,
11].
Circular RNAs (circRNAs) are newly discovered non-coding RNAs with a covalently closed ring structure, which are widely found in a variety of cells [
12‐
15]. They are produced by the reverse splicing of precursor mRNAs and characterized by a stable structure, a conserved sequence and tissue specificity. Recent studies have indicated that circRNAs can act as miRNAs sponges to inhibit the activity of targeted miRNAs [
16,
17]. In addition, circRNAs can regulate gene transcription by binding with RNA binding proteins, or can be translated to produce proteins [
18]. Thus, circRNAs play a vital role during the progression of tumors, and may provide a novel direction for tumor diagnosis and therapy [
19,
20].
In the present study, the commonly differentially expressed circRNAs between colon cancer tissues and adjacent normal tissues in two public datasets were screened out to identify novel molecular targets for colon cancer treatment. It was found that circCSPP1 was significantly upregulated in cancer tissues. In addition, the role of circCSPP1 in colon cancer was examined in vitro and in vivo.
Materials and methods
Specimen collection
Cancer tissues and adjacent normal tissues were collected from 25 patients (14 male, 11 female), who diagnosed with colon cancer at the First Affiliated Hospital of Soochow University (Suzhou, China) (August, 2020 to July, 2021). These patients received no treatment before and age of them was range from 37 to 72-year-old. The tissues were stored in liquid nitrogen immediately after resection. The present study was approved by the Ethics Committee of the First Affiliated Hospital of Soochow University (No. FAHSU20200719) and written informed consent was obtained from each patient.
Gene expression omnibus (GEO) data analysis
The present study analyzed the GSE121895 and GSE126094 datasets from the GEO database. The expression levels in each group were normalized. The threshold value of differentially expressed genes was set at two of different multiples and p < 0.05.
Cell culture and transfection
The human colonic epithelial cell line (HFC) was purchased from ScienCell Research Laboratories, Inc. Colon cancer cell lines, including SW620, SW480, LOVO, HCT116 and DLD-1 cells were obtained from the American Type Culture Collection (ATCC). THP-1 cells were also obtained from ATCC. The cells were maintained in DMEM (Thermo Fisher Scientific, Inc.) containing 10% FBS supplemented with 100 U/ml penicillin and 100 g/ml streptomycin (Beyotime Institute of Biotechnology) at 37 °C. When the cell density (SW620, LOVO) reached 50–70%, the cells were transfected with miR-431 mimics (20 nM), mimics control, circCSPP1 pcDNA3.1 overexpression plasmid (1 μg/μl) or circCSPP1 pLVX-IRES-Puro silencing plasmid (shRNA1 and shRNA2; 1 μg/μl) for 24 h using Lipofectamine
® 3000 (Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions. The miR-431 mimics, miR-control, circCSPP1 pcDNA3.1 overexpression plasmid, circCSPP1 pLVX-IRES-Puro silencing plasmids; Rho associated coiled-coil containing protein kinase 1 (ROCK1) and ZEB1 pLVX-IRES-Puro silencing plasmids were obtained from Shanghai Genepharma Co., Ltd. Phorbol-12-myristate-13-acetate (PMA), IL-4 and IL-13 were purchased from Sigma-Aldrich; Merck KGaA. The information of oligonucleotide was provided in Table
1.
Table 1
The information of oligonucleotide sequences
ROCK1 shRNA | sense: CACCGCATTTGGAGAAGTTCAATTGCGAACAATTGAACTTCTCCAAATGC antisense: AAAAGCATTTGGAGAAGTTCAATTGTTCGCAATTGAACTTCTCCAAATG |
ZEB1 shRNA | sense: CACCGAGAGAGAGAGTTTGACAAGGCGAACCTTGTCAAACTCTCTCTCTC |
antisense: AAAAGAGAGAGAGAGTTTGACAAGGTTCGCCTTGTCAAACTCTCTCTCTC |
circCSPP1 shRNA1 | sense: CACCGCTCCAGACAATGAAACATCCCGAAGGATGTTTCATTGTCTGGAGC antisense: AAAAGCTCCAGACAATGAAACATCCTTCGGGATGTTTCATTGTCTGGAGC |
circCSPP1 shRNA2 | sense: CACCGCTAATCAAGATACCTGTAGTCGAAACTACAGGTATCTTGATTAGC antisense: AAAAGCTAATCAAGATACCTGTAGTTTCGACTACAGGTATCTTGATTAGC |
shRNA control | sense: GATCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAACTTTTTTG antisense: AATTCAAAAAAGTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAACG |
miR-431 mimic | UGUCUUGCAGGCCGUCAUGCA |
mimic control | UUCUCCGAACGUGUCACGUTT |
miR-431 inhibitor | UGCAUGACGGCCUGCAAGACA |
inhibitor control | UUCUCCGAACGUGUCACGUTT |
miR-324-5p mimic | CGCAUCCCCUAGGGCAUUGGUG |
miR-375 mimic | UUUGUUCGUUCGGCUCGCGUGA |
miR-486-3p mimic | CGGGGCAGCUCAGUACAGGAU |
Reverse transcription-quantitative PCR (RT-qPCR)
TRIzol® reagent (Thermo Fisher Scientific, Inc.) was used to extract the RNA according to the manufacturer’s protocol. The RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara Bio, Inc.). The expression levels of miR-431, ROCK1 and zinc finger E-box binding homeobox 1 (ZEB1) were detected using a fluorescence quantitative PCR kit (Nanjing Jiancheng Bioengineering Inc.) in a BD FACSVerse™ (BD Biosciences). U6 and GAPDH were used as internal controls for miR-431 and mRNAs, respectively. Real-Time qPCRs were used three times: 2 min at 94 °C, followed by 35 cycles (94 °C for 30 s and 55 °C for 45 s). The primers used were as follows: RT primer for miR-431, 5′-GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACACGUACU-3′; miR-431 forward, 5′-TGCGGUGUCUUGCAGGCCGUCAG-3′ and reverse, 5′-CCAGTGCAGGGTCCGAGGT-3′; U6 forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′; ROCK1 forward, 5′-AACATGCTGCTGGATAAATCTGG-3′ and reverse, 5′-TGTATCACATCGTACCATGCCT-3′; ZEB1 forward, 5′-TTCTCACACTCTGGGTCTTATTCTC-3′ and reverse, 5′-CTTTTTCACTGTCTTCATCCTCTTC-3′; arginase-1 forward, 5′-AGACCACAGTTTGGCAATTGG-3′ and reverse, 5′-AGGAGAATCCTGGCACATCG-3′; IL-10 forward, 5′-AACCTGCCTAACATGCTTCG-3′ and reverse, 5′-GAGTTCACATGCGCCTTGAT-3′; circCSPP1 forward, 5′-CCATCCCATCAGTTCATCCT-3′ and reverse, 5′-CCCTGCAAAAGGACTACAGG-3′; SMAD4 forward, 5′-GCTGCTGGAATTGGTGTTGA-3′ and reverse, 5′-CTTCGTCTAGGAGCTGGAGG-3′; DAAM1 forward, 5′-TTCATTCATCTTTTGCTGTTTCCGA-3′ and reverse, 5′-TTTTCTTCCTGGTCCTTTTTCTTGC-3′; CDK14 forward, 5′-GCACAGAGACCTGAAACCACAG-3′ and reverse, 5′-AAAGATGCAACCTACTCCCCAC-3′; GAPDH forward, 5′-TCAAGAAGGTGGTGAAGCAGG-3′ and reverse, 5′-TCAAAGGTGGAGGAGTGGGT-3′. The data were quantified by using 2
−ΔΔt method [
21]. All these experiments were performed in triplicate.
Cell counting kit-8 (CCK-8) assay
The SW620 or LOVO cells (3 × 10
5) were seeded in 96-well plates and cultured for 0, 24, 48 and 72 h. At each time point, the cells were incubated with 10 μl CCK-8 solution (Beyotime) at 37 °C for 4 h. The optical density was then measured at 450 nm as previously described [
22]. All these experiments were performed in triplicate.
The cells (5 × 103) were suspended in DMEM containing 10% FBS, and then seeded into the plate. After 2 weeks of incubation at 37 °C, the cells were fixed with 5 ml 4% paraformaldehyde for 15 min. The cells were then stained with Giemsa (Beyotime) for 30 min. The number of colonies was counted using a light microscope (200×; Nikon Corporation). All these experiments were performed in triplicate.
Transwell assay
The cells (2 × 10
4) were digested and cultured in a serum-free medium in the Transwell (BD) upper chamber with or without Matrigel (BD Biosciences). Subsequently, 600 μl complete medium (10% serum) were added to the lower chamber. After 24 h of incubation at 37 °C, the cells in the lower chamber were fixed with 4% formaldehyde for 10 min at room temperature and stained with 0.1% crystal violet solution at room temperature for 10 min (Sigma-Aldrich; Merck KGaA). Finally, the migrated or invaded cells were photographed using a light microscope (200×) [
23]. All these experiments were performed in triplicate.
Fluorescence in situ hybridization (FISH) assay
Cy3-labeled circCSPP1 and FITC-labeled miR-431 probes (Biosense Technologies) were used to observe the co-localization of circCSPP1 and miR-431 in the cells. Hybridizations were performed according to the manufacturer’s instructions provided with the fluorescence in situ hybridization kit. The cell nuclei were stained with DAPI at room temperature for 20 min. Subsequently, images were visualized using a fluorescence microscope (200×) as previously described [
24].
Luciferase assay
The luciferase assay was performed using the dual-luciferase reporting system psiCHECK (Thermo Fisher Scientific, Inc.). The wild-type (WT) or mutant-type (mut) sequences of circCSPP1, ROCK1 and ZEB1 were cloned into the psiCHECK2 plasmid. 293 T cells (ATCC, 2 × 104 cells/well) were cultured overnight in 24-well plates. The cells were transfected with the WT or mut reporter vector along with miR-431 mimics (10 nM) or mimics control (10 nM) using Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.). Finally, the luciferase activity of cells was detected with a Dual-Luciferase Detection kit (Promega Corporation) after 48 h of transfection. The data were quantified by normalizing to Renilla luciferase activity.
RNA pull-down assay
Biotin labeled miR-431 and the control probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Probe-coated beads were generated by co-incubation with streptavidin-coated beads (Thermo Fisher Scientific, Inc.) at 25 °C for 2 h. The SW620 and LOVO cells were collected, lysed and incubated with miR-431 probes overnight at 4 °C. Thereafter, the beads were eluted, and the complex was purified using TRIzol® reagent (Takara Biotechnology Co., Ltd.). The levels of circCSPP1, ROCK1 and ZEB1 were then analyzed using RT-qPCR.
RNA immunoprecipitation (RIP) assay
RIP assay was performed using the EZ-Magna RIP RNA-Binding Protein Immunoprecipitation kit (MilliporeSigma). Briefly, magnetic beads conjugated with negative control normal IgG (cat.no. AB21-KC, 1:5000) or anti-Ago2 (cat.no. 03-110, 1:5000) antibody (MilliporeSigma) were co-incubated with the cell lysates for 4 h at room temperature. To investigate the enrichment of the binding targets, the immunoprecipitated RNAs were extracted and subjected to RT-qPCR.
Western blot analysis
RIPA lysis buffer (Beyotime Institute of Biotechnology) was used to extract protein from the cells. The protein concentration was determined using the BCA kit (Nanjing Jiancheng Bioengineering Inc.) according to the manufacturer’s instructions. Protein (40 μg) was then separated by using 10% SDS-PAGE, and transferred onto PVDF membranes (MilliporeSigma). The membranes were blocked in 5% skimmed milk for 1 h at room temperature followed by incubation with the following primary antibodies: ROCK1 (cat. no. #4035, 1:1,000, Cell Signaling Technology, Inc.), ZEB1 (cat.no. ab181451, 1:1,000, Abcam), cyclin D1 (cat. no. ab16663, 1:1,000, Abcam), cyclin-dependent kinase (CDK)4 (cat.no. 11026-1-AP, 1:1,000, ProteinTech Group, Inc.), p-CDK4 (1:1,000, Abcam), retinoblastoma (Rb; cat. no. ab181616, 1:1,000, Abcam), p-Rb (cat.no. ab184796, 1:1,000, Abcam), Snail (cat.no. ab216347, 1:1,000, Abcam), E-cadherin (E-cad; cat. no. 20874-1-AP, 1:1,000, ProteinTech Group, Inc.) and GAPDH (1:1500, cat. no. HRP-60004, ProteinTech Group, Inc.) at 4 °C overnight. The membranes were then incubated with HRP-labeled goat anti-rabbit secondary antibody (Abcam, cat. no. ab7090; 1:5,000) at room temperature for 1 h. Thereafter, an enhanced chemiluminescence kit (Thermo Fisher Scientific, Inc.) was used to detect protein expression. All these experiments were performed in triplicate.
Xenograft tumor model
Nude mice (n = 24, 4–6 weeks old, 20–22 g) were obtained from the Animal center of Soochow University and randomly divided into four groups (shRNA2 ctrl, circCSPP1 shRNA2, pcDNA3.1 ctrl and pcDNA3.1-circCSPP1). All mice were housed in a SPF‑grade animal room (temperature 18–22 °C; humidity 40–60%; light/dark cycle 12/12 h each day) and had free access to food and water. The subcutaneous injection of colon cancer cells was performed after 3 days of adaptive breeding. Each mouse was subcutaneously injected with 3 × 106 colon cancer cells (100 μl in PBS). Tumor size was measured every 2 days, and the major axis (a) and minor axis (b) of the tumor were measured. The tumor volume was calculated using the following formula: ab2/2. At the end of the experiment, the mice were sacrificed using a 40% volume/min CO2 and the tumors were removed, photographed and weighed. The animal experiments were approved by the Ethics Committee of the First Affiliated Hospital of Soochow University (Approval No. 20200917). The National Institutes of Health guide for the care and use of laboratory animals was strictly followed.
Cell cycle distribution analysis
SW620 or LOVO cells (5 × 105) were fixed using with 75% ethanol for 20 min on ice. Then, cells were permeabilized with 0.25% Triton X-100 and stained with PI/RNase (Sigma Aldrich). After 15 min of incubation at 4 °C, cells were analyzed using a flow cytometer (BD FACSAria III; BD Biosciences) and ModFit (version 3.0; Verity Software House, Inc.). All these experiments were performed in triplicate.
Statistical analysis
Three independent experiments were performed in each group. Statistical analysis was performed using GraphPad Prism software (GraphPad Software, Inc.). The measurement data are expressed as the mean ± standard deviation. The unpaired Student’s t-test was used for comparisons between two groups, and One-way analysis of variance and Tukey’s post hoc tests were used for comparisons between multiple groups [
25]. p < 0.05 was considered to indicate a statistically significant difference.
Discussion
Increasing evidence has uncovered the critical role of circRNAs in the progression of human cancers, including colon cancer [
19,
20]. Various studies have reported that circRNAs including circCCDC66 [
27], circRNA_100859 [
28] and circPPP1R12A [
29] were upregulated in colon cancer and high expression was associated with a poor prognosis of the patients. In the present study, the dysregulated circRNAs were analyzed using the GEO database. A novel circRNA back-splicing 8–11 exons of the CSPP1 gene, termed circCSPP1, was found, which plays a tumor-promoting role in colon cancer.
Subsequently, the mechanisms of circCSPP1 regulating the progression of colon cancer were explored. The upregulated expression and the stability of circCSPP1 render it a potential biomarker and a diagnostic and therapeutic target in human cancers. CircCSPP1 was previous to be upregulated in liver cancer [
30], prostate cancer [
31], ovarian cancer [
32]and glioma cancer [
33]. In addition, circCSPP1 sponges different miRNAs including miR-520 h, miR-378 and miR-1182 to regulate tumor progression in these studies. The possible reason is that these miRNAs combine different specific 3ʹuntranslated regions of circCSPP1. These may indicate circCSPP1 is an active oncogenic factor. Similar to these reports, the present study found that circCSPP1 promoted the progression of colon cancer by sponging a new microRNA miR-431 and regulating the expression of ROCK1 and ZEB1.
ROCK1 and ROCK2 are Rho-GTPase effectors that control vital aspects of the actin cytoskeleton. The RhoA/ROCK pathway is activated in a variety of tumors and exerts a direct regulatory effect on the mobility of tumor cells [
34‐
36]. Previous research has indicated that G1/S progression requires ROCK [
37]. The role of ROCK1 in the regulation of the cell cycle may explain its effect on the proliferation of colon cancer cells. Our findings demonstrated that the knockdown of ROCK1 reversed the tumor-promoting effects of circCSPP1. The other function of ROCK1 is to induce the expression of cyclin-dependent kinase inhibitor (CDKI) p16, which prevents the CDK4/6-mediated phosphorylation of Rb proteins, thereby blocking E2F-dependent transcription [
38]. The present study found that circCSPP1 promoted the expression of cyclin D1, p-CDK4 and p-Rb through the regulation of ROCK1 and miR-431. In addition, ZEB1 is well-known to be involved in the regulation of EMT in cancer cells [
39]. In the present study, we found that circCSPP1 promoted EMT in colon cancer by modulating ZEB1.
In addition, recently, many studies have reported that circRNAs may encode proteins or peptides to participate in tumor progression [
40], such as cricAXIN1 [
41], circMAPK14 [
42] and circCUX1 [
43]. However, we did not study the encoding ability of circCSPP1. The issue is interesting, and it will be the focus of our further research.
In conclusion, the findings of the present study demonstrated that circCSPP1 was upregulated in colon cancer and functioned as an oncogene. In addition, circCSPP1 promoted the progression of colon cancer functions as a competing endogenous RNA by the regulating miR-431/ROCK1 and miR-431/ZEB1 pathways. The findings presented herein may provide novel insight into the pathogenesis of colon cancer. However, what factors regulate circCSPP1 to play a role in promoting cancer progression still need to be further studied. In addition, the potential translation function of circCSPP1 also needs further investigation.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.