Study population
Adult patients (≥ 18 years), referred for colonoscopy, were invited to participate. Patients were pooled into the neoplasia group if they presented a history of CRN. Patients with no present endoscopic signs or history of CRN served as ctrls. Patients with hemorrhagic diathesis or inflammatory bowel disease were excluded from the study. For each patient, we noted medication, body mass index (BMI), previous illnesses, all signs of earlier colorectal disease and the findings during the colonoscopy.
Forty three patients were enrolled in the study (19 women). For Ussing chamber studies, biopsies from randomly selected 22 CRN-pts (10 women) and 21 ctrls (9 women) were examined. In the real time polymerase chain reaction study (RT-qPCR), biopsies from randomly selected 11 CRN-pts (6 women) and 7 ctrls (4 women) were included. For immunohistochemistry, biopsies from randomly selected 8 CRN-pts (3 women) and 7 ctrls (3 women) were assessed. Eleven patients, both CRN-pts (2 women, 3 men) and ctrls (3 women, 3 men), had comorbidity such as diabetes, hypertension, atrial fibrillation, prostatic cancer, chronic obstructive pulmonary disease and dyslipidemia.
The study protocol was approved by the scientific Ethical Committee of Copenhagen (H-3-2013-107) and the Danish Data Protection Agency approved the study protocol (BBH-2013-024, I-suite no: 02342). The study was conducted in accordance with the Helsinki declaration. Patient information and data were collected and stored in locked containers.
Chemicals
Theophylline, indomethacin, prostaglandin E2 (PGE2), SC-560 and celecoxib were purchased from Sigma-Aldrich (Seelze, Germany). Amiloride, bumetanide and ouabain were purchased from Sigma (Vallensbaek Strand, Denmark).
The antibody for COX-2 (cat. no.: SB-M3210) was obtained from Nordic BioSite ApS (Täby, Sweden) and antibodies for COX-1 from Santa Cruz Biotechnology (cat. no.: sc-1752, sc-7950, and sc-19998; Santa Cruz, CA, USA) and Abcam Cambridge (cat. no.: ab109025; Cambridge, UK). Fluorescence double labeling was conducted with antibodies for the following entities: serotonin (cat. no.: M075801-2) and chromogranin A (cat. no.: M086929-2) were purchased from Dako (Glostrup, Denmark); proprotein convertase-1 and -2 (PC1 and PC2; cat. no.: alx-210-518-R100 and alx-210-519-R100) from Enzo Life Sciences (Varazdin, Croatia); somatostatin (cat. no.: sc-13099) from Santa Cruz Biotechnology (Santa Cruz, CA, USA); gastric inhibitory polypeptide (GIP, cat. no.: ABS021-04-02) from Thermo Scientific (Rockford, USA) and glucagon-like peptide-1 (GLP-1; cat. no.: 87805-34) from Tocris Bioscience (Bristol, UK).
Primer sequences were synthesized by TAG Copenhagen (Copenhagen, Denmark). All other chemicals were of analytical grade.
Biopsy procedure
Six biopsies were obtained from each patient. Of the six biopsies, one was used for RT-qPCR, one for immunohistochemistry and four biopsies were mounted in modified air-suction Ussing chambers [
9]. During endoscopy, biopsies were pinched from normal appearing mucosa approximately 30 cm orally from the anal verge and at least 10 cm from abnormal tissue on retraction of the endoscope. Standard biopsy forceps (Boston Scientific, Radial Jaw 4, outside diameter of 2.2 mm) were used. Biopsies were placed in iced Ringer-solution and immediately transferred to the laboratory for mounting in Ussing chambers.
Three experimental techniques were employed:
Ussing chamber (A), RT-qPCR (B) and immunohistochemistry (C)
Biopsies were mounted within 30 min in Ussing chambers [
9]. Mounting was carried out at 10 times magnification by means of a stereomicroscope to secure correct mucosa-serosa orientation and proper fixation. Both sides of the tissue were bathed in bicarbonate-Ringer solution containing (in mM) 140 Na
+, 4 K
+, 121 Cl
−, 1 Ca
2+, 0.5 Mg
2+, 0.5 SO
42−, 25 HCO
3−, and 5.5 D-glucose. Solutions were oxygenated with 95% O
2/5% CO
2, i.e., buffered to pH 7.4, and circulated by gas-lifts. Temperature was maintained at 37 °C by water jackets. Short circuit current (SCC, μA·cm
− 2) and slope conductance (G, mS·cm
− 2) were recorded continuously using an automated voltage-clamp device. Correction for solution resistance was performed immediately before specimens were mounted. The slope conductance was only used as a control for acceptable slit fixation ranging between 60 and 120 mS per sq. cm.
Experiments were initiated following a minimum equilibration period of 10 min. Amiloride (20 μM, apical side) was added to inhibit sodium channels (ENaCs). Theophylline (400 μM, both sides) was then added to raise the level of cAMP due to inhibition of phosphodiesterase activity and thus optimizing the effect of COX subtype inhibitors. When the SCC was stable, a selective inhibitor of either COX-1 (SC-560, 500 nM, both sides) or COX-2 (celecoxib, 500 nM, both sides) was added. After 30 min or when the SCC reached a plateau, indomethacin was added (13 μM, both sides). Again, after 30 min or when SCC had stabilized, PGE
2 (100 nM, serosal side) was added. Finally, at the end of the experiment, bumetanide (25 μM, serosal side) was added as a measure for induced chloride secretion and followed by ouabain (200 μM, serosal side) as a control of biopsy viability. Selection of half-chamber concentrations for the various drugs was based on pharmacodynamic experience from previous studies.
From each patient included here, one biopsy was obtained and immediately transferred to RNAlater (Life Technologies, Naerum, Denmark). Biopsies were homogenized using a TissueLyser II (Qiagen, Copenhagen, Denmark), and subsequently RNA was extracted using NucleoSpin RNA® (Macherey-Nagel, Düren, Germany). Concentration and purity of RNA were determined using a NanoDrop® ND-1000 (NanoDrop Technologies, Wilmington, DE, USA), the latter by the A
260/A
280 and A
260/A
230 absorbance ratios. RNA was converted to cDNA using the iScript™ cDNA Synthesis Kit (BioRad, Copenhagen, Denmark) according to the manufacturer’s protocol. Primers against genes of interest and ß-actin were designed using Primer3 (
http://frodo.wi.mit.edu/primer3/input.htm) based on sequences obtained from Ensembl (
www.ensembl.org). The primer sequences were synthesized by TAG Copenhagen (Copenhagen, Denmark): COX-1 forward (5’-GAGCAGCTTTTCCAGACGA -3′); COX-1 reverse (5′- TCCTCGATGACAATCTTGATG -3′); COX-2 forward (5′- ACTAGAGCCCTTCCTCCTGTG -3′); COX-2 reverse (5′- GGGATCAGGGATGAACTTTCT -3′); ß-Actin forward (5’-ACCCAGCACAATGAAGATCA-3′); ß-Actin reverse (5’-CGTCATACTCCTGCTTGCTG-3′). Dilution series of cDNA from HEK293 cells were run to verify acceptable amplification efficiencies and specificities by standard and dissociation curves for all primer sets. cDNA was amplified on a 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) using Fast SYBR® Green Master Mix (Applied Biosystems) in accordance with the manufacturer’s manual. Samples were run in triplicates with ß-actin primers as reference gene on all plates. Results were analyzed using SDS 2.3 (Applied Biosystems), and expression was calculated by the 2
-ΔCT method.
C.
Localization and abundance studies
Immunohistochemical staining was performed to localize and quantify the two COX isoforms. One colonic biopsy from each patient, included for this part, was put aside in 4% neutral buffered formaldehyde right after the endoscopy procedure. Biopsies were subsequently embedded in paraffin and cut in 4 μm thin slices. The sections were deparaffinated and rehydrated, followed by heat treatment in a microwave oven in order to unmask epitopes. The sections were blocked with a 2% bovine serum albumin solution for 10 min to rule out unspecific antibody adhesion, followed by incubation with a primary antibody at 4 °C overnight. Images were recorded using a Zeiss Axioplan 2 plus microscope (Jena, Germany) fitted with a Photometrics CoolSNAP camera (Tucson, AZ, USA) and analysis was performed using Image-Pro Plus 7.0 software.
Immunohistochemical staining of COX-1 turned out insufficient for three of the antibodies and a fourth (sc-1752) stained single, open enteroendocrine-like cells in the epithelium, Fig.
3. To verify that the coloring was of non-enteroendocrine cells, double labeling immunofluorescence with sc-1752 and various markers for endocrine cells was performed. The following antibody concentrations were used: COX-1 (sc-1752) 1:800, COX-2 1:400, GLP-1 1:375, serotonin 1:100, somatostatin 1:2500, PC1 1:1250, PC2 1:1600, chromogranin A 1:10000 and GIP 1:1750.
For COX-2, all biopsies were quantified by a blinded investigator. Quantification images were recorded at 20× magnification and the area measured represented 186,000 μm2 of the tissue. The area of stained structures was quantified by selecting a colored region of interest. Automatically, areas with same color were measured. One image from each biopsy was measured. Blinded quantification of COX-2 was repeated 3 times. Data were calculated as mean area μm2 ± SEM for each group. Images for localization were recorded using a Zeiss Axio10 Imager A1 microscope (Jena, Germany) fitted with a Zeiss AxioCam ICc 3 camera (Jena, Germany) and analysis was performed using Image-Pro 9.1 software. Only mucosal layers were analyzed.