Background
Maintaining bone health is a major clinical challenge in patients with breast cancer. Both the disease itself and most forms of treatment exert negative effects on bone metabolism [
1,
2]. In particular, hormone-ablative treatment approaches in women with hormone receptor-positive cancers result in a rapid increase in bone resorption [
3,
4]. In addition to the risk of osteoporosis, bone metastases are often seen as a late complication of apparently successfully treated patients with breast cancer [
5], and novel antitumor agents are warranted that maintain bone health [
6,
7].
The mammalian target of rapamycin (mTOR) signaling pathway is an important regulator of many cellular growth and disease processes [
8]. Notably, activation of mTOR signaling is closely related to endocrine resistance in breast cancer [
9‐
11]. The ability to overcome endocrine resistance was assessed in the pivotal phase III BOLERO-2 trial, where the mTOR inhibitor everolimus was assessed in postmenopausal women with estrogen receptor (ER)-positive breast cancer, whose disease progressed despite nonsteroidal aromatase inhibition using exemestane [
12]. Exploratory analyses of bone turnover markers at 6 and 12 weeks revealed an expected increase in the exemestane cohort, but markers of bone turnover were significantly lower when combined with everolimus. In addition, the rate of metastatic bone disease was also lower in the combination group [
13].
Of interest, a role for mTOR signaling has previously been attributed to different aspects of bone biology [
14]. The activity of bone-resorbing osteoclasts depends on the mTOR pathway because the osteoclast differentiation factor receptor activator of nuclear factor κB ligand (RANKL) signals through the mTOR/p70 S6 kinase axis [
15]. In osteoblasts, an increase of bone-protective osteoprotegerin (OPG) has been observed following mTOR inhibition by rapamycin [
16], and in an ovariectomized (OVX) rat model, everolimus was shown to decrease osteoclast-mediated bone resorption and to inhibit the in vitro production of cathepsin K [
17]. In this study, we sought to delineate the effects seen in the BOLERO-2 trial of everolimus-mediated mTOR inhibition on the individual cell types of the bone microenvironment in vitro, as well as in the context of the hormone-deprived environment often associated with osteolytic malignant bone disease in vivo.
Methods
Reagents and antibodies
Everolimus (RAD001) (catalogue number S1120) was purchased from Selleck Chemicals (Munich, Germany) and dissolved in dimethyl sulfoxide (DMSO). The following primary antibodies were purchased from Cell Signaling Technology, Inc. (Beverly, MA, USA): mTOR (catalogue number 2983), Phospho-mTOR (p-mTOR; catalogue number 2974), p70 S6 kinase (p70; catalogue number 9202), and phospho-p70 S6 kinase (p-p70; catalogue number 9205). An antibody for the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4) was purchased from HyTest Oy (Turku, Finland). HRP-conjugated mouse immunoglobulin G (IgG; catalogue number HAF007) and rabbit IgG (catalogue number HAF008) secondary antibodies were purchased from R&D Systems (Wiesbaden-Nordenstadt, Germany). Recombinant murine RANKL (catalogue number 462-TEC-010) and recombinant murine macrophage colony-stimulating factor (M-CSF; catalogue number 416-ML-010/CF) were purchased from R&D Systems (Minneapolis, MN, USA). Factors used to induce osteoblastic differentiation included dexamethasone (Sigma-Aldrich, Darmstadt, Germany), β-glycerol phosphate (Sigma-Aldrich), and ascorbate phosphate (Sigma-Aldrich). Recombinant human bone morphogenetic protein 2 (BMP-2; catalogue number 120-02) and BMP-4 (catalogue number 314-BP) used for murine osteoblast differentiation were purchased from PeproTech (Rocky Hill, NJ, USA). Calcein for labeling bone turnover was also purchased from Sigma-Aldrich.
Cells and culture
Breast cancer cell lines MDA-MB-231 and MCF-7 and the murine melanoma cell line B16-F10 were purchased from the American Type Culture Collection (ATCC; Manassas, VA, USA). MDA-MD-231 cells transduced with the firefly luciferase gene (MDA-MB-231-LucA12) were a kind gift from Dr. Sanjay Tiwari (University of Kiel, Kiel, Germany). Breast cancer cells were cultured in Gibco DMEM/F-12 medium (Life Technologies GmbH, Darmstadt, Germany), and B16-F10 cells were cultured in 1× Gibco DMEM (Life Technologies GmbH).
RAW 264.7 cells (ATCC) and bone marrow-derived mononuclear cells derived from C57BL/6 mice were cultured in α-minimal essential medium (Biochrom, Berlin, Germany) supplemented with 2 mM glutamine (Biochrom). Cell cultures were maintained in a humidified atmosphere at 37 °C in 5% CO2/95% air atmosphere, and all culture medium conditions were supplemented with 10% fetal calf serum supreme (FCS; Biochrom) and Gibco 1% penicillin/streptomycin (P/S; Life Technologies GmbH). RAW 264.7 cells were seeded at a density of 1.25 × 104 cells/cm2 and bone marrow-derived mononuclear cells at a density of 1 × 106/cm2 when commencing osteoclast differentiation.
Mononuclear cells were isolated from donor bone marrow samples via density centrifugation before seeding in 1× DMEM supplemented with 10% FCS and 1% P/S. Nonadherent cells were removed 24 h later by washing with PBS. The resulting adherent human mesenchymal stem cells (hMSC) were cultured until confluency before seeding and again allowed to reach confluency before treatment. This study was approved by the local institutional review board ethics committee (EK245082010), and informed consent was obtained from healthy donors before bone marrow samples were collected at the Bone Marrow Transplantation Center of the University Hospital Carl Gustav Carus. Murine mesenchymal stem cells (mMSC) were isolated by flushing the bone marrow cells from the long bones of C57BL/6 mice into a culture of 1× DMEM. A medium change was performed 48 h later to remove nonadherent cells in a similar manner to the selection of hMSC. All adherent cell cultures were recovered using Gibco 0.25% trypsin-ethylenediaminetetraacetic acid (Life Technologies GmbH) before seeding and waiting until cells reached confluency before commencement of treatments.
Osteoclast differentiation and tartrate-resistant acid phosphatase staining
Osteoclasts were differentiated from RAW 264.7 cells in the presence of 50 ng/ml murine RANKL and increasing concentrations of everolimus for 5 days with replacement of culture medium, murine RANKL, and everolimus taking place every 48 h. On day 5, cells were washed and fixed in acetone/citrate buffer. The Leukocyte Acid Phosphatase TRAP Kit (Sigma-Aldrich, Vienna, Austria) was used to stain cells for tartrate-resistant acid phosphatase (TRAP) according to the instructions of the manufacturer. Cells that were positive for TRAP staining and showing three or more nuclei were counted as osteoclasts, and representative photographs were captured for each treatment condition. Murine bone marrow-derived mononuclear cells sourced by bone marrow aspiration from the long bones of C57BL/6 mice were differentiated in 25 ng/ml murine M-CSF for 2 days before continuing with 25 ng/ml murine M-CSF and commencing 50 ng/ml murine RANKL and everolimus treatment for 5 days and performing TRAP staining as described for RAW 264.7 cells.
In vitro bone resorption assay
Murine bone marrow-derived mononuclear cells were seeded onto bone slices (Immunodiagnostic Systems, Tyne & Wear, UK) with 25 ng/ml murine M-CSF and cultured for 2 days before medium was replaced with 25 ng/ml murine M-CSF and 50 ng/ml murine RANKL. Three days later, medium containing M-CSF and RANKL was replaced with the addition of everolimus. Everolimus-containing medium was changed 2 days later, and after a further 3 days of culture, supernatants were collected and analyzed for levels of collagen type I cross-linked C-telopeptide (CTx) using CrossLaps® for Culture (CTX-I) enzyme-linked immunosorbent assay (Immunodiagnostic Systems).
Osteoblast differentiation and alizarin staining
hMSC or mMSC were seeded into a 24-well culture plate, and upon reaching confluency (on day 1), cells were treated with osteogenic differentiation medium (DMEM containing 10% FCS, and 1% P/S supplemented with 100 μM dexamethasone, 10 mM β-glycerol phosphate, and 100 μM ascorbate phosphate) with increasing concentrations of everolimus. On day 21, cells were washed twice with PBS and fixed with 10% paraformaldehyde (PFA) for 15 minutes at room temperature. Following fixation, cells were washed twice with distilled water and incubated in a 40 mM alizarin red S solution, pH 4.2 (Sigma-Aldrich, Munich, Germany) for 20 minutes at room temperature. Stained cells were subsequently washed with distilled water until the excess dye was completely removed. Plates were dried at room temperature overnight before imaging. To quantify mineralization, the alizarin red S bound to the mineralized calcium was eluted in 0.1 M HCl/0.5% sodium dodecyl sulfate (SDS) solution for 30 minutes at room temperature. The resulting eluent was measured with a spectrophotometer at 540 nm. Each treatment was performed in triplicate for three different donors. In the murine osteoblast experiments, 100 ng/ml of BMP-2 and BMP-4 was added to the culture conditions.
Cell viability assay
Cancer cell lines and bone cells (differentiated RAW 264.7 cells and hMSC) were seeded onto 96-well and 24-well plates, respectively. The CellTiter-Blue® assay (Promega, Mannheim, Germany) was used according to the manufacturer’s instructions to evaluate cell viability at different time points following everolimus treatments at different concentrations (0, 1, 10, and 100 nM). Cancer cells were seeded at a density of 3000 cells per 96-well plate. hMSC were seeded at a density of 60,000 cells per 24-well plate and allowed to reach confluency before differentiation for 8 days and assessment of the effects of everolimus concentrations only after a treatment duration of 48 h. RAW 264.7 cells were seeded at a density of 25,000 cells per 24-well plate and differentiated with 20 ng/ml murine RANKL before being treated with everolimus for 48 h.
RNA isolation, reverse transcription, and real-time polymerase chain reaction
Polymerase chain reactions (PCRs) were performed as previously described [
18]. Briefly, the High Pure RNA Extraction Kit (Roche Applied Science, Mannheim, Germany) was used to isolate RNA following the manufacturer’s protocol. Purified RNA (500 ng) was reverse-transcribed using SuperScript II (Life Technologies GmbH) and underwent SYBR Green-based real-time polymerase chain reaction (RT-PCR) using a standard protocol (Applied Biosystems, Foster City, CA, USA). Primer sequences are listed in Table
1. The PCR cycling program ran at 50 °C for 2 minutes and at 95 °C for 10 minutes, followed by 40 cycles at 95 °C for 15 seconds and 60 °C for 1 minute. The melting curve was assessed at 95 °C for 15 seconds, 60 °C for 1 minute, and 95 °C for 30 seconds. The comparative cycle threshold method was used to calculate the results, which are presented as the
x-fold increase relative to the housekeeping gene (human β-actin or murine β-actin) or as a percentage of the control.
Table 1
Primers used for real-time quantitative reverse transcription-polymerase chain reaction
ACTB
| CCAACCGCGAGAAGATGA |
CCAGAGGCGTACAGGGATAG |
ALP
| CAACCCTGGGGAGGAGAC |
GCATTGGTGTTGTACGTCTTG |
OPG
| GAACCCCAGAGCGAAATACAG |
TAGCAGGAGACCAAAGACACTG |
RUNX2
| CAGATGGGACTGTGGTTACTG |
TGGGGAGGATTTGTGAAGAC |
OCN
| TGAGAGCCCTCACACTCCTC |
ACCTTTGCTGGACTCTGCAC |
Actb
| GATCTGGCACCACACCTTCT |
GGGGTGTTGAAGGTCTCAAA |
Alp
| CTACTTGTGTGGCGTGAAGG |
CTGGTGGCATCTCGTTATCC |
Opg
| CCTTGCCCTGACCACTCTTA |
ACACTGGGCTGCAATACACA |
Runx2
| CCCAGCCACCTTTACCTACA |
TATGGAGTGCTGCTGGTCTG |
Ocn
| GCGCTCTGTCTCTCTGACCT |
ACCTTATTGCCCTCCTGCTT |
Rankl
| CACTGAGGAGACCACCCAAG |
GAGATGAAGAGGAGCAGAACG |
Oscar
| TCTGCCCCCTATGTGCTATC |
CTCCTGCTGTGCCAATCAC |
Trap
| ACTTGCGACCATTGTTAGCC |
AGAGGGATCCATGAAGTTGC |
Ctsk
| AAGTGGTTCAGAAGATGACGGGAC |
TCTTCAGAGTCAATGCCTCCGTTC |
Immunoblotting
The analysis of protein expression by Western blotting was performed as described previously [
19]. In short, following treatment with everolimus, cancer cells were lysed and protein levels quantified. Protein samples of 20 μg were loaded onto a 6% SDS-PAGE gel and separated by electrophoresis. The separated proteins were then transferred onto a 0.2-μm nitrocellulose membrane. Blocking was performed in 5% nonfat dry milk in Tris-buffered saline with 1% Tween 20 for 1 h. Membranes were then washed in Tris-buffered saline with 1% Tween 20 and incubated overnight in 5% bovine serum albumin in Tris-buffered saline with 1% Tween 20 containing the primary antibody (mTOR, phosphorylated mTOR, p70 S6 kinase, phosphorylated p70 S6 kinase, or GAPDH). Membranes were washed before incubation for 1.5 h with the HRP-conjugated secondary antibody in 1% nonfat dry milk in Tris-buffered saline with 1% Tween 20. After another washing step, the membranes were developed and the protein visualized using SuperSignal substrate (Pierce Biotechnology, Bonn, Germany) enhanced chemiluminescence. Phosphorylated protein signals were quantified and normalized to GAPDH signals using ImageJ version 1.44 software (imagej.nih.gov/ij/).
Animal experiments
Female immunocompromised NMRI nude and immunocompetent C57BL/6 mice were housed under institutional guidelines. The institutional animal care committees of the Technical University Dresden and the Landesdirektion Dresden approved all animal procedures (IRB TVV 61/2015). In subcutaneous tumor models, NMRI nude and C57BL/6 mice were inoculated subcutaneously at 6 weeks of age with 1 × 106 MDA-MB-231 and 1 × 104 B16-F10 cells, respectively, in 50 μl of a 1:1 Matrigel matrix dilution with PBS on day 1. The site of subcutaneous inoculation was dorsal, between the positions of the last rib and the hind limb, with two injection sites per mouse, left and right. Intraperitoneal injections (100 μl) of 1 mg/kg/day everolimus or control DMSO commenced on day 2 for 4 weeks in the case of the MDA-MB-231 model and for 2 weeks in the case of the B16-F10 model before mice were killed to assess tumor burden. Ten mice were allocated to each treatment group. To establish a model of bone loss similar to that of the human condition, an estrogen-deprived environment was induced in the C57BL/6 strain by performing OVX in 9-week-old mice. Four weeks postsurgery, OVX or sham (SHAM)-operated groups were treated intraperitoneally with 1 mg/kg/day everolimus or control for 4 weeks. Ten mice were allocated to each group initially. However, two mice did not survive the OVX procedure, resulting in both SHAM groups having only nine animals each at the time mice were killed. Calcein (15 mg/kg) labeling was performed 5 and 2 days before mice were killed. Killing was done after 8 weeks. In the bone metastasis model, 1 × 105 MDA-MB-231-LucA12 cells were injected into the left ventricle of the heart of 6-week-old NMRI nude mice under ultrasound guidance. Intraperitoneal injections of 100 μl, 1 mg/kg/day everolimus or control DMSO, commenced on the day of tumor cell inoculation. Ten mice per group were initially included. One mouse from each group died following anesthetic administration at the first imaging session and were therefore excluded from the experiment. No adverse effects were observed for treatment with everolimus in any of the experiments performed.
Bone assessment
Micro-computed tomography (μCT, vivaCT 75; SCANCO Medical, Brüttisellen, Switzerland) was performed on the excised femurs using X-ray energy of 70 keV, a resolution of 10.5 μm, and an integration time of 200 milliseconds. Calibration of the scanner took place weekly using hydroxyapatite (HA) phantoms. For the 3D visualization of bony tissue, we used the SCANCO evaluation software (SCANCO Medical). The threshold for bone absorption values was set to 285 mg HA/cm3, and 100 slices were measured commencing from 10 slices above the growth plate of the femur.
Bone histomorphometric analysis
The femur was fixed in 4% PFA/PBS for 24 h, dehydrated in an ascending ethanol series, and embedded in paraffin. The tibia was separately embedded in methyl methacrylate (Technovit 9100 NEW; Heraeus, Wehrheim, Germany). Sections (2 μm) were used to stain for TRAP in the femur, allowing for the assessment of the number of osteoclasts per unit of bone surface. Sections (7 μm) were cut from the tibia for the assessment of calcein labels to determine the bone formation rate per unit of bone surface (BFR/BS). Analysis and quantification of the bone histomorphometric parameters were performed using OsteoMeasure software (OsteoMetrics, Decatur, GA, USA). Relevant units for histomorphometric measurements were consistent with those advised by the nomenclature committee of the American Society for Bone and Mineral Research.
Bioluminescence imaging and quantification
Bioluminescence imaging was used to quantify tumor growth by correlating the tumor burden to the luminescence signal measured with a Xenogen IVIS 200 in vivo imaging system (PerkinElmer, Rodgau, Germany). Successful intracardiac injection was determined immediately after intracardiac inoculation. Imaging for the assessment of tumor growth commenced 2 weeks postinoculation, and continuous assessment was performed once weekly until mice were killed at the end of week 5. Living Image software (PerkinElmer) was used to obtain and quantify the bioluminescence data. Mice were anesthetized, and 5 minutes prior to imaging, each mouse was given an intraperitoneal injection with a dose of 10 mg/kg D-luciferin (PerkinElmer) in PBS. Mice were imaged individually for an exposure period of 2 minutes. The resulting bioluminescent images were analyzed by measuring individual, manually contoured signals with final measurement units in photons per second per centimeter squared per steradian.
Statistical analyses
Each in vitro experimental setup was repeated a minimum of three times, and using Prism 6 software (GraphPad Software, Inc., La Jolla, CA, USA), one-way analysis of variance (ANOVA) with the Bonferroni posttest or Student’s t test was performed to evaluate the equality of the mean. To analyze the effects of OVX and everolimus treatment, two-way ANOVA with Tukey’s posttest was performed. The results are presented as SD of the mean, and a p value <0.05 was considered statistically significant.
Discussion
Most hormone-ablative breast cancer therapies decrease patients’ bone density and integrity by increasing osteoclastogenesis and bone resorption [
2,
20]. This is especially the case for aromatase inhibitors, which are now standard of care for postmenopausal patients with ER-expressing breast cancer. In the BOLERO-2 trial, mTOR inhibition using everolimus exerted a clinical benefit to patients with ER-positive breast cancer progressing despite hormone therapy [
12], and exploratory assessment of markers of bone turnover from this trial revealed a lower increase in the group receiving everolimus in combination with aromatase inhibitors than aromatase inhibitor treatment alone. However, bone turnover reflects only one aspect of bone biology and does not necessarily correlate with bone density. Researchers in a number of preclinical studies have previously linked mTOR signaling to bone biology [
14]; however, assessment of mTOR inhibition in bone biology in the context of osteotropic breast cancer has not been performed in detail.
In this study, low concentrations of everolimus in vitro (1, 10, and 100 nM), when used as a single treatment agent, were sufficient to potently inhibit mTOR signaling and cancer cell viability in vitro (Fig.
1a and b). Continuing with the antitumor assessment of everolimus, we tested the everolimus dose of 1 mg/kg/day in mice subcutaneously inoculated with either osteotropic B16-F10 murine melanoma cells [
21] or MDA-MB-231 human breast cancer cells [
22]. These tumor-bearing mice demonstrated an effective therapeutic response to treatment with everolimus, with significant decreases in the final tumor burdens in both models. First, we used the B16-F10 model to confirm potential antitumor effects of everolimus because it is an aggressive osteotropic cell line with the propensity to form osteolytic bone metastases in vivo and can be inoculated into syngeneic hosts. Putting this into context, everolimus has previously been assessed in clinical trials of patients with metastatic melanoma, often combined with inhibitors of angiogenesis [
23,
24]. The therapeutic benefit of pairing everolimus in these combinations is unclear, however, with reports ranging from major responses and disease stabilization to no response at all. Obviously, there is room for improvement, and focusing on trial design and everolimus pharmacology in the future may help to elucidate the current controversies [
25]. Here, we observed a potent growth-inhibitory effect of everolimus on subcutaneous B16-F10 tumors. This may be linked to possible activating mutations in mTOR [
26], and these mutation-specific influences should also be considered in the context of improving the outcomes of patients with melanoma by using everolimus treatment.
With the focus returning to breast cancer, we could show that 1 mg/kg was effective at inhibiting subcutaneous tumor growth of ER-negative MDA-MB-231 cells. Of interest, this dose is tenfold lower than what is currently advised for ER-positive HER2-negative breast cancer in the clinic. However, this inconsistency could likely be explained by the administration route (intraperitoneal injection versus oral), the chosen animal model, and the cell line used. Previously, when already established subcutaneous MDA-MB-231 tumors were treated with everolimus as a monotherapy at a dose of 10 mg/kg three times weekly, the results were rather disappointing. In this case, only a modest antitumor response could be demonstrated, which was not significant [
27]. Observed differences in the potency of everolimus as an antitumor agent may result from differences in the protocol, most important being the time point when treatment was commenced. Despite this, the results presented here do support other studies in which everolimus was used as a sensitizing agent to radiotherapy or chemotherapeutics against the same cell line [
28‐
30]. Dose, route, and frequency of administration would all appear to define the potency of everolimus as an antitumor agent in breast cancer. In this context, further investigations should expand on the mechanism of how everolimus inhibits the growth and tumorigenesis of breast cancer cells. As one example, it has previously been shown that mTOR inhibition by everolimus in aromatase inhibitor-resistant breast cancer results in a concurrent induction of autophagy and a downregulation of the ER [
11]. Overall, our results confirm and endorse the potent antitumor effects of everolimus in melanoma and in ER-negative breast cancer, in immunocompetent and immunocompromised models, respectively.
Both bone loss observed in hormone ablation and in the progression of breast cancer bone metastases are mediated mainly by an enhanced osteoclast activity. Previously, mTOR signaling has been shown to regulate osteoclastogenesis and osteoclast function [
17,
31], and in the pathological setting, the activation of mTOR is responsible for joint destruction in arthritis [
32]. In this study, 1 nM of everolimus exerted highly antiosteoclastic effects. Although osteoclasts differentiated from murine bone marrow-derived mononuclear cells appeared slightly more resistant to everolimus, they demonstrated a potent decrease in all parameters investigated at 10 and 100 nM of everolimus treatment (Fig.
2c, d). Additionally, it could be shown that everolimus inhibits the ability of mature osteoclasts to resorb bone (Additional file
3: Figure S3). Interestingly, these results are in contrast to a previous study where rapamycin (an earlier-generation mTOR inhibitor) enhanced RANKL-induced osteoclastogenesis and functionality in RAW 264.7 cells [
33]. This may be explained by different proficiency and mechanisms of the mTOR inhibitors rapamycin and everolimus [
34,
35]. For example, different downstream signaling effects with regard to inhibited phosphorylation S6 and AKT have been described [
36]. Despite these considerations, a recent study supports our observations of everolimus as being an inhibitor of osteoclastogenesis. When investigating the effects of everolimus on the osteoclastogenesis of peripheral blood monocytes in a coculture model with the triple-negative breast cancer cell line SCP2, everolimus was effective at inhibiting osteoclastogenesis induced by SCP2-derived factors [
37].
Previous studies deleting key components of mTORC1 signaling in mice have shown pro-osteoblast effects of mTORC1 signaling [
38,
39], with mTOR activation promoting later stages of osteoblast differentiation in particular [
40]. In contrast, studies using the mTOR inhibitors rapamycin and BEZ235 demonstrated an augmented osteoblastogenesis in human embryonic stem cells and hMSC, respectively [
41,
42]. In the present study, the effects of everolimus on the differentiation of both mMSC and hMSC along the osteoblast lineage were assessed. In general, we have shown that osteoblasts were less sensitive to inhibitory effects by everolimus than osteoclasts, and some markers of osteoblastogenesis even increased when hMSC were differentiated at low doses of everolimus (Fig.
3).
When translating these in vitro osteoclast and osteoblast observations to an in vivo setting using an OVX model to mimic hormone ablation therapy and to induce bone loss, a low-dose treatment regime of everolimus (1 mg/kg/day) had potent bone-protective effects as assessed by μCT analysis. Further assessment by bone histomorphometry revealed that these positive effects were achieved primarily by an inhibition of the osteoclast-mediated bone resorption (Fig.
4b). Interestingly, whereas the numbers of osteoclasts were reduced in the bone, there was no evidence of increased anabolic activity. This is a common finding in classic antiresorptive drugs such as bisphosphonates [
43]. At the effective doses, these drugs exert highly antiresorptive effects but also impair osteoblast action. However, because bone loss mediated by hormone deficiency is mediated mainly by increased osteoclastic bone resorption, the antiresorptive effects are sufficient to protect bone. In line with this assumption, we did not observe an effect of everolimus on bone when used in a nonchallenged setting. In the context of breast cancer, the mTOR signaling pathway has been shown to be involved in crosstalk with ERα signaling under estrogen stimulation [
44]. With this in mind, in the absence of ER signaling, mTOR could hypothetically signal independently, promoting and enhancing the differentiation of osteoclasts.
Using the same dose that was required to suppress subcutaneous tumor growth and prevent bone loss in a hormone-deprived environment, everolimus was proven to be effective in preventing the establishment and progression of breast cancer bone metastases when mice were intracardially inoculated with the ER-negative, bone-seeking MDA-MB-231 cells (Fig.
5a–c). In line with this finding, the trabecular bone of the femur was protected against tumor-induced osteolysis and bone loss (Fig.
5e). Supporting this finding in another model of malignant bone disease prevention, treating MDA-MB-231 cells with everolimus before intratibial injection resulted in a reduction in the area of the subsequent osteolytic lesions [
45]. Furthermore, at the first time point measured in the context of bone metastases arising from lung cancer, the bisphosphonate zoledronic acid was shown to be less effective than everolimus in preventing bone metastases, with 27.8% more mice developing bone lesions than in the everolimus-treated group [
46]. In the intracardiac bone metastasis model, it was discovered that the number of osteoclasts in the femurs of everolimus-treated mice was significantly reduced (Additional file
5: Figure S5). This could support an additional antiosteoclastic role for mTOR in the context of cancer-induced osteolysis. However, it remains a challenge to separate the relative contributions to antitumor efficacy of everolimus as a bone-targeted agent that potentially simultaneously promotes both direct antitumor and indirect anti-bone-resorptive actions. For example, this reduction in the number of osteoclasts could be a result of an inhibition in the expression of the pro-osteoclastic factor interleukin-6 by the MDA-MB-231 cells [
45]. Here, we postulate that the antibone metastatic effect of everolimus is a result of direct antitumor effects, supported by a decrease in the differentiation and activity of osteoclasts. However, further research is needed to dissect the molecular mechanisms of this intertwined effect.
Acknowledgements
The authors thank Josefa Hötzel, Bärbel Zeiler, Franziska Paul, and Ina Gloe for their excellent technical assistance. PH, LCH, and TDR have received unrestricted educational grants and research funding from the following companies and grant authorities: Amgen, AstraZeneca, Eli Lilly, Novartis Pharmaceutical Corp., Merck, Pfizer, Roche, and the German Research Foundation (DFG; SKELMET Forschergruppe-1586).