Background
Bacterial DNA is a potent immunostimulant[
1] and research has found that the abundance of CpG dinucleotides (CpGs) in genomes of prokaryotes is a major factor contributing to its immunostimulatory properties[
2]. Toll-like receptor 9 (TLR9) has been identified as a major player in the innate immune response to bacterial DNA and synthetic oligodeoxynucleotides (ODNs) that contain unmethylated CpG motifs[
3].
The members of the TLR family are well-conserved type I transmembrane proteins characterized by a leucine-rich domain involved in ligand recognition and a toll/interleukin-1 receptor (TIR) intracellular signalling domain[
4]. Acting as innate immune receptors, members of this family have been found to mediate the response to different bacteria- and virus-derived molecules, including lipopolysaccharide, bacterial lipopeptides[
5], double-stranded RNA[
6] and CpGs[
3].
Due to the importance of foreign- and host-derived DNA for induction of protective reactions against pathogens and autoimmune disorders, respectively, a great deal of research has been devoted to studying the immunostimulatory properties of CpGs and the function of TLR9 (reviewed in[
7]). In mammals, the receptor is found in the endoplasmic reticulum in resting immune cells. Upon exposure of the cells to CpG DNA, TLR9 translocates to the endosomal compartments[
8], where it may interact with its ligand. The binding of the receptor to DNA seems to be sequence independent but it requires low pH conditions and proteolytical activation[
9]. Once activated, the receptor signals through Myeloid differentiation primary response gene 88 (MyD88) to activate transcription factors including nuclear factor kappa-B (NFkB) and interferon-regulatory factor 7 (IRF7) involved in the upregulation of proinflammatory genes and type I interferon (IFN), respectively[
7].
The function of TLR9 is relatively well-characterized in mammals; however, its function in lower vertebrates remains obscure. TLR9 has been identified in teleosts[
10‐
14], and the expression of the protein in Atlantic salmon (
Salmo salar) leukocytes is inducible by IFN-γ[
15]. It has been shown that the bacterial DNA and CpG ODNs are able to activate immune cells in fish[
16,
17]. In particular, research has found that the upregulation of proinflammatory cytokine in CpG-stimulated trout macrophages relies on efficient endosomal acidification[
18]. Like in mammals, salmon leukocytes are able to distinguish between different classes of CpG ODNs by upregulating type I IFN and stimulating lymphocyte proliferation[
19] and data suggests that in Japanese flounder (
Paralichthys olivaceus) TLR9 is involved in the up-regulation of a tumor necrosis factor-alpha (TNFα) promoter by CpGs[
11]. These data indicate that the TLR9 function is conserved throughout the vertebrate classes; however, direct interaction between stimulatory CpG ODN and TLR9 has not been demonstrated in non-mammalian vertebrates, so far.
The major goal of the current study has been to characterize the ability of a salmon TLR9 homolog (SsTLR9) to interact and mediate the response to immunostimulatory, phosphorothioate (PS)-modified CpG ODNs. The results demonstrate that the binding of SsTLR9 to PS-modified ODNs is not dependent on the presence of CpGs; however, the affinity of this interaction is pH-dependent. Transgenic SsTLR9 is able to spontaneously activate IFN-stimulated response element (ISRE)-containing promoter constructs. Nevertheless, unlike in primary leukocytes, it fails to colocalize with CpG ODNs when overexpressed in salmonid cell lines. The study further identifies proteins that contain RNA recognition motifs (RRM), including heterogeneous nuclear ribonucleoprotein A0 (hnRNPA0) and nuclear receptor coactivator 5 (NCOA5), as potential mediators of the effects of exogenous DNA in salmon immune cells.
Discussion
The major goal of the current study has been to investigate the potential of SsTLR9 to serve as an immune receptor for CpG ODNs and to identify additional proteins involved in the recognition of these molecules in salmon innate immune cells. The presented results show that SsTLR9 does have the capacity to participate in the recognition of CpGs in Atlantic salmon mononuclear phagocytes as specific binding has been demonstrated. Unlike another study in which ODNs were added to cell lysates prior to coprecipitation[
25], in the current research, the cells were first stimulated with the ligand, washed extensively and then lysed and processed for coprecipitation. This approach results in relatively poor protein recovery. However, it should be considered that, eukaryotic cells express large numbers of proteins with sequence-dependent and independent binding affinity to different types of nucleic acids. Therefore, the experimental approach where cell lysates are mixed with labelled nucleic acids could result in isolation of proteins that in live cells may not be able to interact with the immunostimulatory ligands due to spatial sequestration. Furthermore, the ligand-binding studies for TLRs can be additionally complicated by the specific conditions needed by some TLRs to assume efficient ligand-binding conformation. This is particularly important for endosomal TLRs, including TLR9, which has been shown to require proteolytic cleavage and low pH in order to be able to bind and activate immune response to foreign nucleic acids[
26]. In agreement with this, in the current study adjusting the pH of the lysis buffer resulted in more efficient SsTLR9 recovery. In this case, the low pH most likely prevented the dissociation of the CpG that had already been associated with the receptor in the endosomes. While it is still possible that some of the coprecipitated SsTLR9 might have interacted with the ODN after the lysis, the immunostaining confirmed that SsTLR9 colocalizes with CpG-B ODNs in intracellular vesicles. The fact that most of the CpG-positive vesicles were also LysoSensor-positive indicates that these are maturing endolysosomes (pH < 5.2). These results are in agreement with previous studies with primary trout macrophages that have shown that the immunostimulatory capacity of CpGs depends on processes in which endosomal acidification is required[
18].
Studies on mammalian TLR9 have indicated that binding to ODNs is not sequence-dependent, while the activation of the receptor relies on CpG-induced conformational changes[
27]. Furthermore, it has been demonstrated that in order to assume efficient ligand-binding conformation, TLR9 needs to be processed by endosomal proteases[
9,
28]. This is considered to be a mechanism through which the cells control the signalling of TLR9 and other nucleic acid-binding TLRs and prevent their activation by endogenous ligands. In the current study, no evidence for proteolytic processing of SsTLR9 could be detected as only the predicted full-length molecule (~120 kDa) was specifically detected on the WB. The pull-down study also demonstrated that it is the full-length SsTLR9, rather than any proteolytically processed forms, that binds the ODNs. It light of the studies mentioned above, it might be questioned whether the SsTLR9 detected in the current study represents the functional receptor. Although the processed form of murine TLR9 had a higher potential to interact with DNA and signal the presence of CpGs, the full-length receptor also had some functional capacity. Furthermore, in another study, the authors showed that a chimeric TLR9/TLR4 receptor, which translocated to the cell membrane instead to the endolysosomal compartments, was still able to recognize DNA although it had not been proteolytically processed[
29]. This study highlights the importance of the receptor localization for the control of the immune response to foreign and endogenous DNA molecules. Interestingly, the place of the proteolytic cleavage which is found between residues 441 and 470 of mouse TLR9[
9] lies within a phylogenetically poorly-conserved region. Sequence alignment of teleost and mammalian TLR9 sequences has shown that, in addition to the relatively low amino acid identity, in teleosts this region harbours a large insertion that is absent in the mammalian sequences[
15]. Therefore it is possible that the proteolytic processing of TLR9 might not be present in teleosts. Despite these differences, the current study has demonstrated that the ODN-binding capacity of SsTLR9 is pH dependent indicating that the DNA-binding properties of SsTLR9 in salmon leukocytes might still be restricted to the endolysosomes,.
The translocation of TLR9 from the endoplasmic reticulum relies on its association with other molecules such as the polytopic membrane protein UNC93B1[
30]. In the absence of functional UNC93B1, TLR9 cannot be translocated to the endolysosomal compartments. Therefore, the difference between the intracellular distribution of endogenously expressed SsTLR9 and its overexpression in cell lines may be explained by the absence of the appropriate molecular mechanisms for redistribution of SsTLR9 in the cell lines. It is possible that CHSE and TO cells lack the machinery required for targeting the receptor to the endosomes. This may also explain why transgenic SsTLR9 did not augment the response to CpGs in CHSE cells. Nevertheless, the SsTLR9 overexpression spontaneously activated the activity of promoters that contain ISRE elements. This indicates that the cloned molecule is functional and highlights the potential of the receptor to mediate IFN upregulation and induction of antiviral genes in response to pathogens.
As revealed by the current study, the CHSE cells do not express detectable levels of endogenous TLR9 protein and they are not able to relocate the transgenic SsTLR9 to compartments where it may be activated by CpG ODNs. However, these cells can efficiently endocytose and accumulate ODNs within late endosomes and they do respond to stimulation with different immunostimulatory nucleotides as demonstrated by the RGAs. This suggests that CHSE cells use alternative receptors that allow them to respond to ODNs by activating promoters of IFN-responsive genes.
As TLR9 is an intracellular receptor that is not involved in DNA uptake, it is obvious that the uptake and the distribution of exogenous DNA by cells rely on other molecules. The endocytosis of CpG ODNs by immune cells has been suggested to be dependent on receptor-mediated endocytosis, more specifically on the function of scavenger receptors[
31]. However, the exact mechanisms that regulate the distribution of different types of CpG ODNs within specific endosomal compartments are still obscure. Studies have also suggested that, in addition to TLR9, there are other molecules that mediate the signalling properties of immunomodulatory DNA sequences[
31,
32]. The isolation of proteins that specifically bind CpG ODNs and that could serve as mediators of the biological activity of CpG ODNs in primary cells, requires development of techniques for both efficient and specific protein purification. The results presented in the current paper suggest that hnRNPA0 and NCOA5 may, potentially, be involved in the CpG response. Unlike ACTB which probably copurifies with CpG ODNs through indirect binding, both hnRNPA0 and NCOA5 possess RRM domains which have binding affinity for both RNA and single-stranded DNA suggesting direct interaction with the ODNs. Of these molecules, hnRNPA0 is particularly interesting since it has been previously identified as a protein which specifically binds to CpG ODNs in rat gliobastoma cells[
25]. In this study the authors also identified a number of other ODN binding proteins; however, the experimental approach chosen by these researchers (i.e. adding the ODNs to the cell lysates rather than stimulating viable cells) allows for the isolation of proteins that in viable cells may not have access to the endocytosed CpGs.
The hnRNPA0 belongs to a protein family whose members have predominantly nuclear distribution and, therefore, it is questionable whether the observed interaction may be an artefact issuing from the binding of the protein to CpG ODNs released by endosomes after the cell lysis. However, the experiments with transgenic salmon hnRNPA0 presented here demonstrate that in dividing CHSE cells this molecule is found mostly in the cytoplasm. In the current paper, it is also shown that the hnRNPA0-GFP fusion protein colocalizes with CpG ODNs in granular structures within the cytoplasm of CHSE cells indicating that it is likely that the observed interaction has occurred in the live cells prior to, rather than after the cell lysis and that this binding might have biological significance..
The functions of mammalian hnRNPA0 are still poorly characterized. Since the general functions of the members of the hnRNP family are, posttranscriptional RNA processing and transport[
33], it is not very likely that hnRNPA0 may be directly involved in the intracellular signalling events triggered by CpGs. Interestingly, it has been suggested that, in mouse, this protein might be implicated in the regulation of the immune response to LPS stimulation[
34]. More specifically, upon LPS stimulation of mouse macrophages, this protein binds to AU-rich elements (AREs) of Cyclooxygenase-2 (COX-2), TNF-α and macrophage inflammatory protein-2 mRNAs suggesting a role in the regulation of their stability and the cytokine production. Currently, there is no functional data linking the capacity of hnRNPA0 to bind CpG ODNs with its potential to regulate cytokine stability. In this regard; further studies in this direction would be relevant.
Methods
Fish
Atlantic salmon (Salmo salar) strain Aquagen standard (Aquagen, Kyrksæterøra, Norway), of 500 g, were obtained from the Tromsø Aquaculture Research Station (Tromsø, Norway). The fish were kept at about 10°C in tanks supplied with running filtered water and were fed on commercial, dry food (Skretting, Stavanger, Norway). All experiments were performed according to the guidelines from the national committee for animal experimentation (Forsøksdyrutvalget, Norway).
Isolation and stimulation of primary leukocytes from Atlantic salmon
Head kidney (HK) leukocytes were isolated as described by Strandskog et al.[
19]. The cells were seeded in 60 mm cell culture dishes at a density of 2.1 × 10^7 cells per dish. After 24 h of incubation, the cells were washed with fresh L15 medium and incubated for another 24 h in L15 supplemented with 5% FBS and antibiotics prior to treatment. To up-regulate SsTLR9 protein, the cells were treated with 50 U/ml of recombinant rainbow trout IFN-γ[
20] for 48 hours prior to stimulation. The stimulations (2 hours) were performed with specified concentrations of CpG-B (2006T: TCGTCGTTTTGTCGTTTTGTCGTT) or inverted, non-stimulatory CpG-B ODN (2007T: TGCTGCTTTTGTGCTTTTGTGCTT) (Eurogentec). All of the phosphodiester links were substituted with PS bonds. The ODNs were biotinylated a using PHOTOPROBE® (Long Arm) Biotin kit (Vector labs) according to the manufacturer’s instructions. Briefly, 400 μM ODNs dissolved in TE buffer (pH 8) were mixed with an equal volume of PHOTOPROBE® (LA) Biotin, citrate salt (FW = 838.9) in a PCR tube. The mixture was subjected to thermal coupling by heating to 95°C for 30 min. The reactions were purified to remove unlabelled bioting with Zeba™ Spin Desalting Columns, 7 K MWCO (Pierce). The cells were stimulated with 2 μM biotinylated or unlabelled ODNs unless otherwise indicated in the figures.
All experiments were performed according to the guidelines from the national committee for animal experimentation (Forsøksdyrutvalget, Norway).
Pull-down procedures
Following the stimulations the cells were washed 3x with PBS, to remove non-incorporated ODNs, and lysed in 500 μl of lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 2 mM EDTA, 1 mM EGTA, 1% Triton X-100) supplemented with a protease inhibitor mixture (Complete EDTA-free; Roche Applied Science). To analyse the TLR9 binding efficiency under different pH conditions, the acidity of the lysis buffer (original pH 7.5) was adjusted using 3 M HCl. The cell lysates were cleared by centrifugation for 15 min at 15,000 × g. and 50 μl of Streptavidin-coupled Magnetic Beads (Dynabeads®, Dynal) were added to each sample. The Magnetic Beads were washed in lysis buffer prior to addition. The samples were rotated for 45 min at 4°C and washed 5x with lysis buffer using a microcentrifuge tube magnetic stand. For the Western blot analysis, the proteins were eluted by heating the beads (70°C for 10 min) in LDS sample buffer (Life Technologies). The samples used for mass spectrometry were eluted using milder elution conditions - the beads were incubated for 20 min in 50 μl of lysis buffer supplemented with 0.5 μg/ml of biotin and 2 μM ODNs or 2 μM ODNs only.
Western blot (WB)
The protein samples prepared in LDS buffer were analysed as previously described[
35] using NuPAGE Novex Bis-Tris 4–12% gels (Life Technologies). The SsTLR9 antibody has been previously characterized[
15] and was used at 1:1000-fold dilution. The anti-mouse hnRNP antibody[
34] was kindly provided by Dr Simon Rousseau, University of Dundee and was used at 1:500 dilution. The membranes probed with the SsTLR9 antibody were developed with the SuperSignal West Femto ultra-sensitive substrate whereas hnRNPA0 signal was developed with the less-sensitive SuperSignal West Pico substrate (Pierce). The membranes were exposed to Lumi Film Chemiluminescent Detection film (Roche).
Immunocytochemistry and confocal microscopy
Primary mononuclear phagocytes, Chinook salmon embryo CHSE-214 cells[
36] and salmon head kidney-derived TO cells[
37] were incubated on coverslips and processed as previously described[
38]. The SsTLR9 antibody was applied using a 1:1000-fold dilution. To visualise endolysosomes in live cells, CHSE cells grown in Lab-Tek™ Chambered Coverglass slides (Nunc) were incubated with 1 μM LysoSensor™ Green DND-189 (Life technologies) for 30 min, washed and subjected directly or following the indicated stimulations with CpG-B-Cy5 (Eurogenetech) to confocal microscopy. The transfections of CHSE and TO cells were performed using FuGeneHD (Roche) as previously described[
35], The expression constructs include pDEST12.2 (Invitrogen), pDESTEGFP C1[
35] and pDEST12.2-SsTLR9[
39]. SYTOX
® Green and 7-aminoactinomycin D (7-AAD), which were used to stain cell nuclei, were purchased from Life Technologies. The images were taken using an Axiovert 200 microscope equipped with an LSM510-META confocal module (Zeiss).
Reporter gene assays (RGA)
The RGAs were performed as previously described[
35]. The reporter that contains the promoter region I of the Atlantic salmon IFNa1[
21] was provided by Prof. Børre Robertsen (University of Tromsø, Norway). The rainbow trout Mx1 promoter construct was described earlier[
22]. The ISRE reporter was purchased from SABiosciences. The Poly(I:C) was purchased from Invivogen. PS-modified CpG-B and CpG-A (ODN 2216TGGGGGACGATCGTCGGGGGG) were obtained from Eurogenetech. The firefly luciferase values were normalized using the Renilla luciferase levels, and the values were presented as relative luciferase units (RLU).
Mass spectrometry (MS)
To analyse the efficiency of the pull-down and the purity of the coprecipitation, the samples were subjected to SDS-PAGE, as described above, and silver staining using the SilverQuest™ Silver Staining Kit (Life Technologies). Samples which had lowest background were further analysed with MS to identify potential CpG ODN-binding proteins. The MS analysis was performed at the Proteomic Unit at University of Bergen (PROBE). The protocol included:
1. Reduction and alkylation; Possible -S-S- bridges were reduced with DiThioTreitol from Amersham Biosciences, #171318-02) followed by alkylation with iodoacetamide (Sigma Aldrich, I-6125), to prevent oxidation and formation of new -S-S- bridges.
2. Digestion (peptide fingerprint); Porcine Trypsin from Promega (#V 511A) was used to digest the samples (16 hours at 37°C). The protease activity was stopped by acidification using 1% TFA (Trifluoroacetic acid).
3. Filtering/desalting of samples; An nC18 StageTip (Stop and go extraction Tip) column (Rappsilber, Ishihama et al. 2003) was used. The bound peptides were eluted by passing 10 μl 70% acetonirile/0.1% formic acid through the column.
4. Nano-LC was performed with Ultimate 3000 nano-LC (Dionex Corporation, USA) with a nC18 enrichment column (C18 Pepmap 100 from Dionex, 5 μm particle size, 100 Å pore size, 300 μm i.d. × 5 mm) and an nC18 analytical column (C18 Pepmap 100 from Dionex; 3 μm particle size, 100 Å pore size, 75 μm × 150 mm).
5. Mass spectrometry; The eluted peptides from the nano-LC were ionized (ESI, ElectroSpray Ionization) and analyzed with a QToF Global (Quadrupole Time of Flight from Waters, USA) using automatic MS to MSMS switching (DDA, Data Dependent Analysis).
6. MS/MS search; The mass spectra of fragmented peptides were smoothed (Savitzky Golay), centered, and combined in a merge file. This merge file was then used to search the NCBInr protein database. Mascot Daemon (
http://www.matrixscience.com/daemon.html) was used to search the obtained MSMS spectra in a subset of the NCBInr database consisting of protein sequences from Class Actinopterygii (ray-finned fishes).
Data analysis
The RGA data was analysed with two-way ANOVA, followed by Bonferroni post-tests. Statistical analyses were performed using the GraphPad Prism6 software. The value of p < 0.05 was considered to be significant.
Acknowledgments
This study was supported by Aquaculture program of The Research Council of Norway (Grant no 172253/S40 and 183196/S40 InNoVacc). We thank Dr Simon Rousseau, University of Dundee, for the anti-mouse hnRNP antibody, Prof. Børre Robertsen, University of Tromsø for the salmon IFNa1 reporter construct, Dr. Jun Zou, University of Aberdeen, for recombinant trout IFN-γ and Prof. Heidrun Wergeland, University of Bergen, for providing the TO cells. We also thank Olav Mjaavatten and Magnus Arntzen for the mass spectrometry analysis which was performed at “Proteomic Unit at University of Bergen” and Hanna Thim for excellent technical assistance.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
DBI carried out all the experiments for this study, participated in its design and data-analyses and drafted the manuscript. IS provided the SsTLR9 constructs and initiated some of the reporter gene assay studies. JBJ initiated and coordinated this study and edited the manuscript. All authors have read and approved the final manuscript.