Skip to main content
Erschienen in: Gut Pathogens 1/2017

Open Access 01.12.2017 | Research

CRISPR-like sequences in Helicobacter pylori and application in genotyping

verfasst von: Khotchawan Bangpanwimon, Jaksin Sottisuporn, Pimonsri Mittraparp-arthorn, Warattaya Ueaphatthanaphanich, Attapon Rattanasupar, Christine Pourcel, Varaporn Vuddhakul

Erschienen in: Gut Pathogens | Ausgabe 1/2017

Abstract

Background

Many bacteria and archaea possess a defense system called clustered regularly interspaced short palindromic repeats (CRISPR) associated proteins (CRISPR-Cas system) against invaders such as phages or plasmids. This system has not been demonstrated in Helicobacter pylori. The numbers of spacer in CRISPR array differ among bacterial strains and can be used as a genetic marker for bacterial typing.

Results

A total of 36 H. pylori isolates were collected from patients in three hospitals located in the central (PBH) and southern (SKH) regions of Thailand. It is of interest that CRISPR-like sequences of this bacterium were detected in vlpC encoded for VacA-like protein C. Virulence genes were investigated and the most pathogenic genotype (cagA vacA s1m1) was detected in 17 out of 29 (58.6%) isolates from PBH and 5 out of 7 (71.4%) from SKH. vapD gene was identified in each one isolate from PBH and SKH. CRISPR-like sequences and virulence genes of 20 isolates of H. pylori obtained in this study were analyzed and CRISPR-virulence typing was constructed and compared to profiles obtained by the random amplification of polymorphic DNA (RAPD) technique. The discriminatory power (DI) of CRISPR-virulence typing was not different from RAPD typing.

Conclusion

CRISPR-virulence typing in H. pylori is easy and reliable for epidemiology and can be used for inter-laboratory interpretation.
Hinweise

Electronic supplementary material

The online version of this article (https://​doi.​org/​10.​1186/​s13099-017-0215-8) contains supplementary material, which is available to authorized users.
The original publication of this article has been updated; Table 2 has been corrected. Full details are provided in the Correction.
A correction to this article is available online at https://​doi.​org/​10.​1186/​s13099-017-0221-x.

Background

Clustered regularly interspaced short palindromic repeats (CRISPR) are detected in around 40% of bacteria and many archaea [1, 2]. CRISPR together with the CRISPR-associated genes (cas) are a prokaryotic defense system against invasive bacteriophages or genetic elements. Cas proteins function to degrade foreign nucleic acids of bacteriophages or plasmids. The number of CRISPR loci detected vary between and within bacterial species and strains, 1–4 in Escherichia coli [3], 3 in Yersinia pestis [4], 2 in Salmonella Typhimurium [5], and 1–2 in Staphylococcus aureus [6]. CRISPR loci contain multiple direct repeat (DRs) sequences from 21 to 48 bp long separated by variable spacer sequences 21–72 bp in length [7]. DR sequences are commonly conserved whereas spacer sequences are diverse, and derived from bacteriophages or plasmids. The variable number of DRs and spacers have been used as a typing tool in epidemiologic and evolutionary analysis of bacterial strains [8].
Helicobacter pylori is a Gram negative bacterium that causes peptic ulcer, gastric cancer and mucosa associated lymphoid tissue lymphoma. The risk of disease is associated with H. pylori harboring the cytotoxin associated gene A and vacuolating cytotoxin A, encoded by cagA and vacA genes respectively. The cagA gene encodes the bacterial oncoprotein that causes abnormal cellular signals leading to deregulation of cell growth, cell turnover, cell to cell contact, and elongation of epithelial cells. The vacA gene encodes the pore-forming toxin that induces epithelial cell apoptosis, and inhibits leukocyte activation by massive vacuolization, and disruption of the endosome [9]. Allelic variation of vacA occurs in a signal region (s1/s2) and a middle region (m1/m2) resulting in different levels of vacuolating cytotoxicity. The vacuolating activity is high in the s1m1 genotype whereas the intermediate and absent activities are associated with s1m2 and s2m2 genotypes, respectively. H. pylori carrying the cagA and vacA s1m1 allele has been frequently isolated from patients with severe gastric diseases including peptic ulcers, atrophic gastritis, and gastric cancer [10]. The gene encoded for the virulence-associated protein D (vapD) is present in all virulent strains of ovine footrot bacteria, Dichelobacter nodosus, although the VapD protein function in this bacterium is unknown [11]. This gene has been reported in some H. pylori isolates with 64.9% nucleotide identity to the vapD gene of D. nodosus [12]. The vap region of D. nodosus has been demonstrated to harbor genetic element of bacteriophage suggesting the possibility that gene in this region may be transferred among bacteria [13].
In studies of H. pylori, biotyping, serotyping and hemagglutinin typing, have been reported to possess low discriminatory power index (DI) compared to genotyping such as RAPD [14], pulse field gel electrophoresis (PFGE) [15], restriction fragment length polymorphism-PCR (RFLP-PCR) [16], and repetitive extragenic palindromic PCR fingerprinting (REP-PCR) [17]. PFGE is not widely used for H. pylori because inter-patient variation is rare in the fingerprints obtained [18]. The DI of PFGE is between 0.24 and 0.88 whereas RAPD analysis reveals excellent DI (between 0.99 and 1). Thus, RAPD is recommended for H. pylori typing [19].
Analysis of the CRISPR-Cas systems in H. pylori has not been clearly demonstrated. The polymorphism detected in CRISPR loci has been applied as a genetic marker for typing many bacteria, such as Campylobacter fetus [20] and S. Typhimurium [5]. In the present study, the CRISPR sequences and virulence genes of this bacterium were investigated and CRISPR-virulence typing was compared to the RAPD.

Methods

Isolation and identification of H. pylori

Gastric biopsy samples were obtained from the antral area of patient stomachs in a private hospital in Bangkok (PBH), and two government hospitals in Songkhla (SKH), in the central and southern regions of Thailand, respectively. They were transported in 0.5 ml BHI broth with vancomycin 10 μg/ml, amphotericin B 10 μg/ml, trimethoprim 5 μg/ml and polymyxin B 2500 IU/l. The samples were cultured on Columbia sheep blood agar (CBA) and incubated at 37 °C for 3–7 days under microaerophilic conditions (Oxoid, CampyGen™ gas generator, United Kingdom). The identification of H. pylori was based on colony morphology and biochemical testing. Confirmation was performed by PCR targeted to the ureC (glmM) gene using forward primer (5′-AAGCTTTTAGGGGTGTTAGGGGTTT-3′) and reverse primer (5′-AAGCTTACTTTCTAACACTAACGC-3′) to detect a 294 bp gene fragment [21].

Investigation of CRISPR region in H. pylori

Five whole genomes of H. pylori strains (26695-1MET, XZ274, F57, India7, and SNT49) were analyzed for CRISPR loci using the CRISPRfinder server [22], and specific primers were designed (Table 1). PCR was carried out using PCR mixture containing 5× PrimeSTAR GXL buffer (Mg2+ plus), 2.5 U PrimeSTAR GXL DNA high-fidelity polymerase (Takara, Shiga, Japan), 0.3 mM dNTPs, 0.4 μM of forward and reverse CRISPR-HP primers, and 10 μl of template DNA in a total volume of 100 μl. The PCR process included initial denaturation at 95 °C for 5 min, followed by 35 cycles of denaturation at 95 °C for 1 min, annealing at 56 °C for 1 min, and extension at 68 °C for 1 min with a final extension at 68 °C for 10 min. The PCR products were purified and sequenced.
Table 1
Primers used for detection of virulence genes and CRISPR locus of H. pylori
DNA region(s) amplified
Primer name
Primer sequence
Amplicon sizes(s) (bp)
References or sources
vacA s1/s2
VAI-F
VAI-R
5′-ATGGAAATACAACAAACACAC-3′
5′-CTGCTTGAATGCGCCAAAC-3′
259/286
[24]
vacA m1/m2
VAG-F
VAG-R
5′-CAATCTGTCCAATCAAGCGAG-3′
5′-GCGTCAAAATAATTCCAAGG-3′
567/642
[24]
cagA
Cag5c-F
Cag5c-R
5′-GTTGATAACGCTGTCGCTTC-3′
5′-GGGTTGTATGATATTTTCCATAA-3′
350
[24]
vapD
D1-F
D2-R
5′-AGAGATGCGGTGAATGG-3′
5′-AAGCGTTATGAGTGGTGTG-3′
498
[25]
CRISPR locus
CRISPR-HP-F
CRISPR-HP-R
5′-ATGGGGGCTTTAGTTTCAG-3′
5′-TAGCAAAAGGCGAACTTGA-3′
Variable
This study
The direct repeats (DRs) and spacers of the CRISPR loci were analyzed using the CRISPRfinder server. DRs were grouped based on the similarity of consensus direct repeat sequences (CDRs) of each isolate. Clusters of DRs were assigned by multiple sequence alignment (MSA) using MEGA7 software [23]. The spacers of CRISPR were classified according to a phylogenetic tree inferred using MEGA7 software, and the spacer sequences were analyzed using the CRISPRTarget tool (http://​bioanalysis.​otago.​ac.​nz/​CRISPRTarget/​).

Virulence genes investigation

Multiplex PCR was performed to detect H. pylori toxin genes, the cagA gene, and the s and m regions of the vacA gene [24]. DNA template was prepared by boiling technique. The vapD gene was investigated by single PCR, as previously described [25].

RAPD genotyping

RAPD genotyping was carried out as described previously using primer 1281 (5′-AACGCGCAAC-3′). The RAPD profiles were analyzed with BioNumerics 7.6 (Applied Maths, Belgium), and a dendrogram was constructed by UPGMA method using the Dice similarity coefficient [26].

CRISPR-virulence typing

CRISPR-virulence typing was based on the CRISPR spacer sequences and the presence of cagA, and vacA s and m regions. A profile of each isolate was created using a binary matrix of presence or absence of spacer sequences and virulence genes. The dendrogram was constructed using BioNumerics 7.6 software with the UPGMA algorithm using the Dice similarity coefficient. The DI of putative CRISPR-virulence typing and RAPD typing were assessed by Simpson’s diversity index [27].

Results

Isolation of H. pylori and identification of CRISPR-like sequences

A total of 353 gastric biopsy samples were collected from PBH and 80 from SKH. Twenty-nine (8.2%) and seven (8.7%) isolates of H. pylori were identified from PBH and SKH, respectively. Twenty isolates of H. pylori (13 from PBH and 7 from SKH) were selected for CRISPR analysis and the CRISPR-like sequences were detected in all of the isolates by PCR with amplification products of 280–380 bp. Using the CRISPRfinder server, the numbers of DRs were between 2 and 4 with lengths of 23–31 bp (Table 2). They were divided into 13 DR groups and classified into four clusters (DR-A, B, C and D), each cluster shared specific sequences within the cluster (Additional file 1: Figure S1). The conserved sequences of DRs of all H. pylori isolates were TTCAATCAAGG(G/C)ACTTA (Table 2).
Table 2
Characteristics of CRISPR-like loci in 20 H. pylori isolates
Isolate
Consensus direct repeats (CDRs) sequences
No. of DRs
No. of spacers
CRISPR-like locus pattern (bp)
PBH01
AACAGCACTTTCAATCAAGGGACTTACAA
4
3
29-31-29-28-29-31-29
PBH02
TTCAATCAAGGGACTTATAAATT
3
2
23-37-23-31-23
PBH03
TTCAATCAAGGGACTTATAGCTT
3
2
23-37-23-37-23
PBH04
TTCAATCAAGGGACTTATAAATT
4
3
23-37-23-34-23-31-23
PBH05
TTCAATCAAGGGACTTATAATTTTA
4
3
25-35-25-32-25-29-25
PBH06
TTCAATCAAGGGACTTACAAATT
4
3
23-37-23-34-23-37-23
PBH07
CACTTTCAATCAAGGGACTTACAACTTTAAT
3
2
31-29-31-26-31
PBH08
TTCAATCAAGGGACTTACAAATT
4
3
23-37-23-34-23-37-23
PBH09
TTCAATCAAGGGACTTATAAATT
3
2
23-37-23-31-23
PBH10
TTCAATCAAGGGACTTATGACTTTAAT
2
1
27-26-27
PBH11
TTCAATCAAGGGACTTATAATTT
3
2
23-37-23-31-23
PBH12
TTCAATCAAGGGACTTATAATTTTA
3
2
25-35-25-29-25
PBH13
TAACTTCAATCAAGGCACTTATCACTTTA
4
3
29-31-29-28-29-25-29
SKH01
TTCAATCAAGGCACTTATAATTTTA
3
2
25-35-25-29-25
SKH02
TTCAATCAAGGCACTTATCACTTTA
3
2
25-35-25-32-25
SKH03
TTCAATCAAGGGACTTACAAATT
4
3
23-37-23-34-23-37-23
SKH04
TTCAATCAAGGGACTTACAAATT
4
3
23-37-23-34-23-37-23
SKH05
TTCAATCAAGGGACTTATCACTTTA
4
3
25-35-25-32-25-29-25
SKH06
TTTCAATCAAGGGACTTATAACTTTA
4
3
26-34-26-31-26-34-26
SKH07
TAACTTCAATCAAGGCACTTATCACTTTA
4
3
29-31-29-28-29-25-29
Underline indicates the Consensus sequence
Italic indicates the Direct repeat
Italicunderline indicates the Spacer length
In this work, a total of 50 spacers were detected. The numbers of spacers in each isolate were between 1 and 3 with lengths from 25 to 37 bp (Table 2). They were classified into 28 different spacer patterns and they were not geographical associated (Fig. 1). Using the CRISPRTarget tool and the NCBI database for evaluation, 18 spacers possessed 83–100% similarity to bacterial plasmid, virus or phage genomes at E value ≤ 0.18 (Additional file 2: Table S1).

Virulence genes investigation

A total of 36 H. pylori isolates was investigated for virulence genes. All of them were positive for cagA and vacA s1 (Table 3). The most pathogenic genotype (cagA vacA s1m1) was detected in 17 out of 29 (58.6%) isolates from PBH and 5 out of 7 (71.4%) from SKH. One isolate from each hospital (PBH 06 and SKH 02) was positive for the vapD gene.
Table 3
Virulence genes of H. pylori
Isolate
Virulence genotype
vapD gene
PBH01
cagAvacA s1m1
PBH02
cagAvacA s1m2
PBH03
cagAvacA s1m2
PBH04
cagAvacA s1m1
PBH05
cagAvacA s1m1
PBH06
cagAvacA s1m1
+
PBH07
cagAvacA s1m1
PBH08
cagAvacA s1m1
PBH09
cagAvacA s1m1
PBH10
cagAvacA s1m2
PBH11
cagAvacA s1m2
PBH12
cagAvacA s1m1
PBH13
cagAvacA s1m1
PBH14
cagAvacA s1m2
PBH15
cagAvacA s1m1
PBH16
cagAvacA s1m1
PBH17
cagAvacA s1m2
PBH18
cagAvacA s1m1
PBH19
cagAvacA s1m2
PBH20
cagAvacA s1m1
PBH21
cagAvacA s1m2
PBH22
cagAvacA s1m1
PBH23
cagAvacA s1m2
PBH24
cagAvacA s1m1
PBH25
cagAvacA s1m1
PBH26
cagAvacA s1m1
PBH27
cagAvacA s1m2
PBH28
cagAvacA s1m2
PBH29
cagAvacA s1m2
SKH01
cagAvacA s1m1
SKH02
cagAvacA s1m1
+
SKH03
cagAvacA s1m2
SKH04
cagAvacA s1m1
SKH05
cagAvacA s1m1
SKH06
cagAvacA s1m2
SKH07
cagAvacA s1m1

Genotyping of H. pylori

Twenty isolates of H. pylori were investigated for RAPD and CRISPR-virulence analysis. All of them exhibited different RAPD profiles with fragments between 0.20 and 4.37 kb and could be assigned into three clusters (RT-A, RT-B and RT-C) (Fig. 2). Twelve (60%), seven (35%) and one (5%) isolates were classified in the RT-A, RT-B and RT-C clusters, respectively. Isolates in the RT-A cluster were 73% dissimilar to the isolates in the RT-B cluster whereas the isolate in the RT-C cluster was 90% dissimilar to the isolates in the RT-A and RT-B clusters.
CRISPR-virulence analysis revealed 20 different profiles which could be classified into two clusters, CVT-A (9 isolates) and CVT-B (11 isolates). The isolates in the CVT-A cluster were 55.9% dissimilar to the isolates in the CT-B cluster (Fig. 3).

Discussion

Type II CRISPR-Cas systems are present in Helicobacter cinaedi (NC017761), Helicobacter mustelae (NC013949) and Wolinella succinogenes (NC005090) [28]. In Helicobacter cetorum (NC017737) a type III CRISPR-Cas system is detected. However, no cas gene could be identified in H. pylori, thus CRISPR-like sequences is assigned for the CRISPR loci detected in this work.
It has been reported that H. pylori and several Helicobacter spp. possess vacA-like genes. In H. pylori, these genes are designated as imaA (immunomodulatory autotransporter A), faaA (flagella-associated autotransporter A) and vlpC (VacA-like protein C-Vlp C) [29]. It is of interest that all the CRISPR-like sequences of H. pylori identified in this work are located in the vlpC gene (Fig. 4). Analysis of faaA and imaA of 5 H. pylori isolates (26695-1MET, XZ274, F57, India7, and SNT49) indicated the absence of any CRISPR-like sequences. Although the function of Vlp C has not been clearly illustrated, mutation of the vlpC gene is associated with the resistance of H. pylori to metronidazole [30]. Analysis of H. pylori 26695-1MET Vlp C using the PHYRE2 program (the protein homology/analogy recognition engine v 2.0) indicated that this protein was homologous to the viral A-type inclusion protein (E = 2 × 10−69) of the Trichomonas vaginalis virus (TVV). Interestingly, the presence of TVV in T. vaginalis causes resistance to metronidazole [31]. The NCBI database indicates that only H. pylori and H. cetorum harbor this gene. Analysis of vlpC of H. pylori F57 and H. cetorum MIT 99-5656 revealed the homology of nucleic sequences to be between 72 and 80% and this gene contained 2 regions, a high variable region and a low variable region (Fig. 4). The CRISPR-like sequences were identified only in H. pylori and were located in the high variable region (between 777 and 1030 nucleotide sequences) with AT-rich leader sequences and contained 2 regions (between 819–916 and 968–1030) homologous to H. cetorum sequences. AT-rich leader sequences assumed to be a transcriptional promoter are assigned as one of the CRISPR feature structures [22, 32]. Thus, it is possible that the CRISPR-like sequences were inserted into this part of the vlpC gene, which is not the conserved domain or functional region of the gene. Analysis of 4210 CRISPR arrays revealed 89% were cas-positive in which 33% CRISPR arrays were adjacent to a cas locus and 56% were located outside of cas loci, the rest 11% were orphans (no cas detected) [33]. It has been demonstrated that orphan CRISPR may involve in gene regulation. In Listeria monocytogenes, orphan CRISPR affects virulence through feoAB iron transport system [34]. In H. pylori the presence of CRISPR-like sequences in vlpC gene may influence its expression. In vivo investigation of H. pylori three vacA-like genes revealed that they were up regulated during colonization of mouse stomach; however, in vitro evaluation of VacA-like proteins in broth culture supernatant using Western blot analysis, ImaA and FaaA were detected but Vlp C was not detected which might be due to it was expressed in the low level [35]. The CRISPR-like sequences of H. pylori are detected in the coding region of a vlpC gene, it is uncommon that CRISPR locus of H. pylori located in the coding region, however, it has been reported that CRISPR loci I, III, IV and V of Thermotaga maritima were detected in the genes encoded for the hypothetical protein [36]. It is possible that H. pylori acquires those sequences after vlpC gene is already presented in its genome because no CRISPR-like sequences is detected in the vlpC gene of H. cetorum.
In this work, we detected 23–31 bp DRs in H. pylori and the number of spacers was between 1 and 3, with 25–37 bp. Twenty-eight spacer patterns were classified from H. pylori isolates. Interestingly, H. pylori designated as PBH03 and SKH03 possessed the same virulence gene pattern (Fig. 3) and s1 and s2 spacers of PBH03 were organized in the spacer pattern 28 and 16 respectively which were the same patterns of s1 and s3 of SKH03 respectively (Fig. 1). Thus, it is possible that those bacterial isolates might be invaded by the same kind of phage. In this work, some spacers were 83–100% similar to genetic elements encoding phage DNA polymerase (PBH03-s2, PBH06-s3, SKH03-s3 and SKH04-s3), phage tail protein (PBH13-s2, SKH02-s2 and SKH05-s2) or phage DNA packing protein (SKH04-s1) whereas some spacers were similar to hypothetical proteins derived from bacterial plasmid (PBH06-s1, SKH03-s1, SKH06-s1) (Additional file 2: Table S1). These genetic elements could be bacterial signatures for typing.
H. pylori cagA +, vacA s1m1strains have been associated in the development of peptic ulcer and gastric carcinoma more than H. pylori cagA , vacA s1m2 strains [10, 37]. In this work, all H. pylori isolates were cagA + strains and the occurrence rate of vacA s1m1 and vacA s1m2 strains was 61.1% (22/36) and 38.9% (14/36), respectively. All vacA m2 H. pylori isolates were organized in the CVT-A cluster of CRISPR-virulence typing (Fig. 3). The previous studies of H. pylori in Thailand demonstrated that 95% of isolates were cagA + whereas the vacA s1m1 and s1m2 genotypes were found in 65 and 35% of total isolates, respectively [38]. In this study, the prevalence rate of pathogenic H. pylori (cagA + vacA s1m1) in samples collected in the southern region was 71.4% which was significantly higher than the prevalence rate in the samples from the central region (58.6%).
H. pylori VapD protein possesses endoribonuclease activity and may be involved in cell maintenance or the protection of foreign genetic elements [39, 40]. It is of interest that only 5.5% (2/36) of H. pylori obtained in this work were positive for the vapD gene whereas it was present in 38.0% of H. pylori isolates from Mexico and 61.3% from the USA [12, 25]. Using hybridization and confirmation by sequencing, it has been demonstrated that vapD-negative H. pylori isolates possessed high-level genetic diversity in the vapD region [12]. Differences in the detection of this gene in Asian (Thailand) and Western (Mexico and USA) H. pylori isolates should be explored.
Various patterns of spacers in the CRISPR-Cas system have been reported for subtyping C. jejuni, Mycobacterium tuberculosis, Erwinia amylovora, V. parahaemolyticus and S. enterica [8, 20, 41]. Analysis of orphan CRISPR spacers derived from 14 clinical Enterococcus faecalis isolates indicates two groups of clonal strains which correlates to the Multilocus sequence typing (MLST) [42]. Better bacterial discrimination through a combination of CRISPR pattern and virulence gene typing has been demonstrated [43, 44]. In the present study, the DI of CRISPR-virulence typing was higher than that of CRISPR typing alone (Additional file 3: Table S2). Analysis of 20 profiles derived from CRISPR-virulence typing and RAPD revealed that DIs of both techniques were 1. However, RAPD seems to be better than CRISPR-virulence typing because it could differentiate H. pylori PBH12 from the other strains (Fig. 2) whereas only two clusters were obtained from CRISPR-virulence typing (Fig. 3). This might be due to the low number of spacers detected in the tested isolates in this work. However, the reproducibility of RAPD is poor and the method lacks validated interpretation criteria for inter-laboratory comparison [18, 45]. CRISPR-virulence typing is more reliable for long-term global epidemiology and evolutionary studies and the CRISPR locus databank is excellent for inter-laboratory interpretation and inter-laboratory reproducibility. The information of the CRISPR-like sequences in H. pylori acquired in this work expands the basic knowledge for typing of bacteria.

Conclusions

This is the first report of CRISPR-like sequences in H. pylori which was detected in the vlpC gene. Twenty-eight different spacers with the numbers between 1 and 3 were identified and can be used as bacterial signature for genotyping. In this work, CRISPR-virulence typing of H. pylori was performed and compared with the RAPD. Their DIs were not different. However, RAPD is poor reproducible and lacks validated interpretation criteria for inter-laboratory comparison. Therefore, CRISPR-virulence typing is a novel epidemiological tracking tool for H. pylori management.

Authors’ contributions

Conceptualization: VV. Formal analysis: CP, PM, JS. Investigation: KB, JS, PM, WU, AR. Methodology: KB, PM. Supervision: VV. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Availability of data and materials

All data generated or analyzed during this study are included in the published article.
Not applicable.
This work has been approved by the Office of Human Research Ethics Committee (HREC), Prince of Songkla University, Thailand (EC: 58-241-19-2).

Funding

This work was financially supported by the Thailand Research Fund (TRF) through the Royal Golden Jubilee Ph.D. Program (Grant No. PHD/0224/2558) and the Prince of Songkla University through the Scholarship for Outstanding GPA.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
1.
2.
3.
Zurück zum Zitat Rahmatabadi SS, Nezafat N, Negahdaripour M, Hajighahramani N, Morowvat MH, Ghasemi Y. Studying the features of 57 confirmed CRISPR loci in 29 strains of Escherichia coli. J Basic Microbiol. 2016;56:645–53.CrossRefPubMed Rahmatabadi SS, Nezafat N, Negahdaripour M, Hajighahramani N, Morowvat MH, Ghasemi Y. Studying the features of 57 confirmed CRISPR loci in 29 strains of Escherichia coli. J Basic Microbiol. 2016;56:645–53.CrossRefPubMed
4.
Zurück zum Zitat Pourcel C, Salvignol G, Vergnaud G. CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies. Microbiology. 2005;151:653–63.CrossRefPubMed Pourcel C, Salvignol G, Vergnaud G. CRISPR elements in Yersinia pestis acquire new repeats by preferential uptake of bacteriophage DNA, and provide additional tools for evolutionary studies. Microbiology. 2005;151:653–63.CrossRefPubMed
5.
Zurück zum Zitat Almeida F, Medeiros MIC, dos Prazeres Rodrigues D, Allard MW, Falcão JP. Molecular characterization of Salmonella Typhimurium isolated in Brazil by CRISPR-MVLST. J Microbiol Methods. 2017;133:55–61.CrossRefPubMed Almeida F, Medeiros MIC, dos Prazeres Rodrigues D, Allard MW, Falcão JP. Molecular characterization of Salmonella Typhimurium isolated in Brazil by CRISPR-MVLST. J Microbiol Methods. 2017;133:55–61.CrossRefPubMed
6.
Zurück zum Zitat Yang S, Liu J, Shao F, Wang P, Duan G, Yang H. Analysis of the features of 45 identified CRISPR loci in 32 Staphylococcus aureus. Biochem Biophys Res Commun. 2015;464:894–900.CrossRefPubMed Yang S, Liu J, Shao F, Wang P, Duan G, Yang H. Analysis of the features of 45 identified CRISPR loci in 32 Staphylococcus aureus. Biochem Biophys Res Commun. 2015;464:894–900.CrossRefPubMed
7.
Zurück zum Zitat Barrangou R, Horvath P. CRISPR: new horizons in phage resistance and strain identification. Annu Rev Food Sci Technol. 2012;3:143–62.CrossRefPubMed Barrangou R, Horvath P. CRISPR: new horizons in phage resistance and strain identification. Annu Rev Food Sci Technol. 2012;3:143–62.CrossRefPubMed
10.
Zurück zum Zitat Wroblewski LE, Peek RM, Wilson KT. Helicobacter pylori and gastric cancer: factors that modulate disease risk. Clin Microbiol Rev. 2010;23:713–39.CrossRefPubMedPubMedCentral Wroblewski LE, Peek RM, Wilson KT. Helicobacter pylori and gastric cancer: factors that modulate disease risk. Clin Microbiol Rev. 2010;23:713–39.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Katz ME, Howarth PM, Yong WK, Riffkin GG, Depiazzi LJ, Rood JI. Identification of three gene regions associated with virulence in Dichelobacter nodosus, the causative agent of ovine footrot. J Gen Microbiol. 1991;137:2117–24.CrossRefPubMed Katz ME, Howarth PM, Yong WK, Riffkin GG, Depiazzi LJ, Rood JI. Identification of three gene regions associated with virulence in Dichelobacter nodosus, the causative agent of ovine footrot. J Gen Microbiol. 1991;137:2117–24.CrossRefPubMed
13.
Zurück zum Zitat Cheetham BF, Katz ME. A role for bacteriophages in the evolution and transfer of bacterial virulence determinants. Mol Microbiol. 1995;1:201–8.CrossRef Cheetham BF, Katz ME. A role for bacteriophages in the evolution and transfer of bacterial virulence determinants. Mol Microbiol. 1995;1:201–8.CrossRef
14.
Zurück zum Zitat Akopyanz N, Bukanov NO, Westblom TU, Kresovich S, Berg DE. DNA diversity among clinical isolates of Helicobacter pylori detected by PCR-based RAPD fingerprinting. Nucleic Acids Res. 1992;20:5137–42.CrossRefPubMedPubMedCentral Akopyanz N, Bukanov NO, Westblom TU, Kresovich S, Berg DE. DNA diversity among clinical isolates of Helicobacter pylori detected by PCR-based RAPD fingerprinting. Nucleic Acids Res. 1992;20:5137–42.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Park C-Y, Kwak M, Gutierrez O, Graham DY, Yamaoka Y. Comparison of genotyping Helicobacter pylori directly from biopsy specimens and genotyping from bacterial cultures. J Clin Microbiol. 2003;41:3336–8.CrossRefPubMedPubMedCentral Park C-Y, Kwak M, Gutierrez O, Graham DY, Yamaoka Y. Comparison of genotyping Helicobacter pylori directly from biopsy specimens and genotyping from bacterial cultures. J Clin Microbiol. 2003;41:3336–8.CrossRefPubMedPubMedCentral
16.
Zurück zum Zitat Akopyanz N, Bukanov NO, Westblom TU, Berg DE. PCR-based RFLP analysis of DNA sequence diversity in the gastric pathogen Helicobacter pylori. Nucleic Acids Res. 1992;20:6221–5.CrossRefPubMedPubMedCentral Akopyanz N, Bukanov NO, Westblom TU, Berg DE. PCR-based RFLP analysis of DNA sequence diversity in the gastric pathogen Helicobacter pylori. Nucleic Acids Res. 1992;20:6221–5.CrossRefPubMedPubMedCentral
17.
Zurück zum Zitat Kwon DH, El-Zaatari FA, Woo JS, Perng CL, Graham DY, Go MF. REP-PCR fragments as biomarkers for differentiating gastroduodenal disease-specific Helicobacter pylori strains. Dig Dis Sci. 1998;43:980–7.CrossRefPubMed Kwon DH, El-Zaatari FA, Woo JS, Perng CL, Graham DY, Go MF. REP-PCR fragments as biomarkers for differentiating gastroduodenal disease-specific Helicobacter pylori strains. Dig Dis Sci. 1998;43:980–7.CrossRefPubMed
18.
Zurück zum Zitat Colding H, Hartzen SH, Roshanisefat H, Andersen LP, Krogfelt KA. Molecular methods for typing of Helicobacter pylori and their applications. FEMS Immunol Med Microbiol. 1999;24:193–9.CrossRefPubMed Colding H, Hartzen SH, Roshanisefat H, Andersen LP, Krogfelt KA. Molecular methods for typing of Helicobacter pylori and their applications. FEMS Immunol Med Microbiol. 1999;24:193–9.CrossRefPubMed
19.
Zurück zum Zitat Burucoa C, Lhomme V, Fauchere JL. Performance criteria of DNA fingerprinting methods for typing of Helicobacter pylori isolates: experimental results and meta-analysis. J Clin Microbiol. 1999;37:4071–80.PubMedPubMedCentral Burucoa C, Lhomme V, Fauchere JL. Performance criteria of DNA fingerprinting methods for typing of Helicobacter pylori isolates: experimental results and meta-analysis. J Clin Microbiol. 1999;37:4071–80.PubMedPubMedCentral
20.
Zurück zum Zitat Calleros L, Betancor L, Iraola G, Méndez A, Morsella C, Paolicchi F, Silveyra S, Velilla A, Pérez R. Assessing the intra-species genetic variability in the clonal pathogen Campylobacter fetus: CRISPRs are highly polymorphic DNA markers. J Microbiol Methods. 2017;132:86–94.CrossRefPubMed Calleros L, Betancor L, Iraola G, Méndez A, Morsella C, Paolicchi F, Silveyra S, Velilla A, Pérez R. Assessing the intra-species genetic variability in the clonal pathogen Campylobacter fetus: CRISPRs are highly polymorphic DNA markers. J Microbiol Methods. 2017;132:86–94.CrossRefPubMed
21.
Zurück zum Zitat Lage AP, Godfroid E, Fauconnier A, Burette A, Butzler JP, Bollen A, Glupczynski Y. Diagnosis of Helicobacter pylori infection by PCR: comparison with other invasive techniques and detection of cagA gene in gastric biopsy specimens. J Clin Microbiol. 1995;33:2752–6.PubMedPubMedCentral Lage AP, Godfroid E, Fauconnier A, Burette A, Butzler JP, Bollen A, Glupczynski Y. Diagnosis of Helicobacter pylori infection by PCR: comparison with other invasive techniques and detection of cagA gene in gastric biopsy specimens. J Clin Microbiol. 1995;33:2752–6.PubMedPubMedCentral
22.
Zurück zum Zitat Grissa I, Vergnaud G, Pourcel C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007;35:W52–7.CrossRefPubMedPubMedCentral Grissa I, Vergnaud G, Pourcel C. CRISPRFinder: a web tool to identify clustered regularly interspaced short palindromic repeats. Nucleic Acids Res. 2007;35:W52–7.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870–4.CrossRefPubMed Kumar S, Stecher G, Tamura K. MEGA7: molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol. 2016;33:1870–4.CrossRefPubMed
24.
Zurück zum Zitat Chattopadhyay S, Patra R, Ramamurthy T, Chowdhury A, Santra A, Dhali G, Bhattacharya S, Berg DE, Nair GB, Mukhopadhyay AK. Multiplex PCR assay for rapid detection and genotyping of Helicobacter pylori directly from biopsy specimens. J Clin Microbiol. 2004;42:2821–4.CrossRefPubMedPubMedCentral Chattopadhyay S, Patra R, Ramamurthy T, Chowdhury A, Santra A, Dhali G, Bhattacharya S, Berg DE, Nair GB, Mukhopadhyay AK. Multiplex PCR assay for rapid detection and genotyping of Helicobacter pylori directly from biopsy specimens. J Clin Microbiol. 2004;42:2821–4.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Morales-Espinosa R, González-Valencia G, Delgado G, Méndez JL, Torres J, Cravioto A. Frequency and characterization of vapD gene in Helicobacter pylori strains of different vacA and cag-PAI genotype. Bioquimia. 2008;33:43–50. Morales-Espinosa R, González-Valencia G, Delgado G, Méndez JL, Torres J, Cravioto A. Frequency and characterization of vapD gene in Helicobacter pylori strains of different vacA and cag-PAI genotype. Bioquimia. 2008;33:43–50.
26.
Zurück zum Zitat Berg DE, Lelwala-Guruge J, Incecik ET, Srivastava K, Akopyants NS. H. pylori DNA fingerprinting using the arbitrarily primed PCR (AP-PCR) or random amplified polymorphic DNA (RAPD) method. Methods Mol Med. 1997;8:117–32.PubMed Berg DE, Lelwala-Guruge J, Incecik ET, Srivastava K, Akopyants NS. H. pylori DNA fingerprinting using the arbitrarily primed PCR (AP-PCR) or random amplified polymorphic DNA (RAPD) method. Methods Mol Med. 1997;8:117–32.PubMed
27.
Zurück zum Zitat Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol. 1988;26:2465–6.PubMedPubMedCentral Hunter PR, Gaston MA. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol. 1988;26:2465–6.PubMedPubMedCentral
28.
Zurück zum Zitat Burstein D, Harrington LB, Strutt SC, Probst AJ, Anantharaman K, Thomas BC, Doudna JA, Banfield JF. New CRISPR–Cas systems from uncultivated microbes. Nature. 2017;542:237–41.CrossRefPubMed Burstein D, Harrington LB, Strutt SC, Probst AJ, Anantharaman K, Thomas BC, Doudna JA, Banfield JF. New CRISPR–Cas systems from uncultivated microbes. Nature. 2017;542:237–41.CrossRefPubMed
30.
Zurück zum Zitat Albert TJ, Dailidiene D, Dailide G, Norton JE, Kalia A, Richmond TA, Molla M, Singh J, Green RD, Berg DE. Mutation discovery in bacterial genomes: metronidazole resistance in Helicobacter pylori. Nat Methods. 2005;2:951–3.CrossRefPubMed Albert TJ, Dailidiene D, Dailide G, Norton JE, Kalia A, Richmond TA, Molla M, Singh J, Green RD, Berg DE. Mutation discovery in bacterial genomes: metronidazole resistance in Helicobacter pylori. Nat Methods. 2005;2:951–3.CrossRefPubMed
32.
Zurück zum Zitat Sorek R, Kunin V, Hugenholtz P. CRISPR—a widespread system that provides acquired resistance against phages in bacteria and archaea. Nat Rev Microbiol. 2008;6:181–6.CrossRefPubMed Sorek R, Kunin V, Hugenholtz P. CRISPR—a widespread system that provides acquired resistance against phages in bacteria and archaea. Nat Rev Microbiol. 2008;6:181–6.CrossRefPubMed
33.
Zurück zum Zitat Makarova KS, Wolf YI, Alkhnbashi OS, Costa F, Shah SA, Saunders SJ, Barrangou R, Brouns SJ, Charpentier E, Haft DH, et al. An updated evolutionary classification of CRISPR-Cas systems. Nat Rev Microbiol. 2015;13:722–36.CrossRefPubMedPubMedCentral Makarova KS, Wolf YI, Alkhnbashi OS, Costa F, Shah SA, Saunders SJ, Barrangou R, Brouns SJ, Charpentier E, Haft DH, et al. An updated evolutionary classification of CRISPR-Cas systems. Nat Rev Microbiol. 2015;13:722–36.CrossRefPubMedPubMedCentral
34.
Zurück zum Zitat Westra ER, Buckling A, Fineran PC. CRISPR-Cas systems: beyond adaptive immunity. Nat Rev Microbiol. 2014;12:317–26.CrossRefPubMed Westra ER, Buckling A, Fineran PC. CRISPR-Cas systems: beyond adaptive immunity. Nat Rev Microbiol. 2014;12:317–26.CrossRefPubMed
35.
Zurück zum Zitat Radin JN, Gaddy JA, Gonzalez-Rivera C, Loh JT, Algood HM, Cover TL. Flagellar localization of a Helicobacter pylori autotransporter protein. MBio. 2013;4(2):e00613.CrossRefPubMedPubMedCentral Radin JN, Gaddy JA, Gonzalez-Rivera C, Loh JT, Algood HM, Cover TL. Flagellar localization of a Helicobacter pylori autotransporter protein. MBio. 2013;4(2):e00613.CrossRefPubMedPubMedCentral
36.
Zurück zum Zitat Nelson KE, Clayton RA, Gill SR, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peterson JD, Nelson WC, Ketchum KA, et al. Evidence for lateral gene transfer between Archaea and bacteria from genome sequence of Thermotoga maritima. Nature. 1999;399:323–9.CrossRefPubMed Nelson KE, Clayton RA, Gill SR, Gwinn ML, Dodson RJ, Haft DH, Hickey EK, Peterson JD, Nelson WC, Ketchum KA, et al. Evidence for lateral gene transfer between Archaea and bacteria from genome sequence of Thermotoga maritima. Nature. 1999;399:323–9.CrossRefPubMed
38.
Zurück zum Zitat Sahara S, Sugimoto M, Vilaichone R-K, Mahachai V, Miyajima H, Furuta T, Yamaoka Y. Role of Helicobacter pylori cagA EPIYA motif and vacA genotypes for the development of gastrointestinal diseases in Southeast Asian countries: a meta-analysis. BMC Infect Dis. 2012;12:223.CrossRefPubMedPubMedCentral Sahara S, Sugimoto M, Vilaichone R-K, Mahachai V, Miyajima H, Furuta T, Yamaoka Y. Role of Helicobacter pylori cagA EPIYA motif and vacA genotypes for the development of gastrointestinal diseases in Southeast Asian countries: a meta-analysis. BMC Infect Dis. 2012;12:223.CrossRefPubMedPubMedCentral
39.
Zurück zum Zitat Kwon AR, Kim JH, Park SJ, Lee KY, Min YH, Im H, Lee I, Lee KY, Lee BJ. Structural and biochemical characterization of HP0315 from Helicobacter pylori as a VapD protein with an endoribonuclease activity. Nucleic Acids Res. 2012;40:4216–28.CrossRefPubMedPubMedCentral Kwon AR, Kim JH, Park SJ, Lee KY, Min YH, Im H, Lee I, Lee KY, Lee BJ. Structural and biochemical characterization of HP0315 from Helicobacter pylori as a VapD protein with an endoribonuclease activity. Nucleic Acids Res. 2012;40:4216–28.CrossRefPubMedPubMedCentral
40.
Zurück zum Zitat Louwen R, Staals RH, Endtz HP, van Baarlen P, van der Oost J. The role of CRISPR-Cas systems in virulence of pathogenic bacteria. Microbiol Mol Biol Rev. 2014;78:74–88.CrossRefPubMedPubMedCentral Louwen R, Staals RH, Endtz HP, van Baarlen P, van der Oost J. The role of CRISPR-Cas systems in virulence of pathogenic bacteria. Microbiol Mol Biol Rev. 2014;78:74–88.CrossRefPubMedPubMedCentral
41.
Zurück zum Zitat Sun H, Li Y, Shi X, Lin Y, Qiu Y, Zhang J, Liu Y, Jiang M, Zhang Z, Chen Q. Association of CRISPR/Cas evolution with Vibrio parahaemolyticus virulence factors and genotypes. Foodborne Pathog Dis. 2015;12:68–73.CrossRefPubMed Sun H, Li Y, Shi X, Lin Y, Qiu Y, Zhang J, Liu Y, Jiang M, Zhang Z, Chen Q. Association of CRISPR/Cas evolution with Vibrio parahaemolyticus virulence factors and genotypes. Foodborne Pathog Dis. 2015;12:68–73.CrossRefPubMed
42.
Zurück zum Zitat Hullahalli K, Rodrigues M, Schmidt BD, Li X, Bhardwaj P, Palmer KL. Comparative analysis of the orphan CRISPR2 locus in 242 Enterococcus faecalis strains. PLoS ONE. 2015;10(9):e0138890.CrossRefPubMedPubMedCentral Hullahalli K, Rodrigues M, Schmidt BD, Li X, Bhardwaj P, Palmer KL. Comparative analysis of the orphan CRISPR2 locus in 242 Enterococcus faecalis strains. PLoS ONE. 2015;10(9):e0138890.CrossRefPubMedPubMedCentral
43.
Zurück zum Zitat Liu F, Barrangou R, Gerner-Smidt P, Ribot EM, Knabel SJ, Dudley EG. Novel virulence gene and clustered regularly interspaced short palindromic repeat (CRISPR) multilocus sequence typing scheme for subtyping of the major serovars of Salmonella enterica subsp. enterica. Appl Environ Microbiol. 2011;77:1946–56.CrossRefPubMedPubMedCentral Liu F, Barrangou R, Gerner-Smidt P, Ribot EM, Knabel SJ, Dudley EG. Novel virulence gene and clustered regularly interspaced short palindromic repeat (CRISPR) multilocus sequence typing scheme for subtyping of the major serovars of Salmonella enterica subsp. enterica. Appl Environ Microbiol. 2011;77:1946–56.CrossRefPubMedPubMedCentral
44.
Zurück zum Zitat Shariat N, DiMarzio MJ, Yin S, Dettinger L, Sandt CH, Lute JR, Barrangou R, Dudley EG. The combination of CRISPR-MVLST and PFGE provides increased discriminatory power for differentiating human clinical isolates of Salmonella enterica subsp. enterica serovar Enteritidis. Food Microbiol. 2013;34:164–73.CrossRefPubMed Shariat N, DiMarzio MJ, Yin S, Dettinger L, Sandt CH, Lute JR, Barrangou R, Dudley EG. The combination of CRISPR-MVLST and PFGE provides increased discriminatory power for differentiating human clinical isolates of Salmonella enterica subsp. enterica serovar Enteritidis. Food Microbiol. 2013;34:164–73.CrossRefPubMed
45.
Zurück zum Zitat Gherardi G, Creti R, Pompilio A, Di Bonaventura G. An overview of various typing methods for clinical epidemiology of the emerging pathogen Stenotrophomonas maltophilia. Diagn Microbiol Infect Dis. 2015;81:219–26.CrossRefPubMed Gherardi G, Creti R, Pompilio A, Di Bonaventura G. An overview of various typing methods for clinical epidemiology of the emerging pathogen Stenotrophomonas maltophilia. Diagn Microbiol Infect Dis. 2015;81:219–26.CrossRefPubMed
Metadaten
Titel
CRISPR-like sequences in Helicobacter pylori and application in genotyping
verfasst von
Khotchawan Bangpanwimon
Jaksin Sottisuporn
Pimonsri Mittraparp-arthorn
Warattaya Ueaphatthanaphanich
Attapon Rattanasupar
Christine Pourcel
Varaporn Vuddhakul
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
Gut Pathogens / Ausgabe 1/2017
Elektronische ISSN: 1757-4749
DOI
https://doi.org/10.1186/s13099-017-0215-8

Weitere Artikel der Ausgabe 1/2017

Gut Pathogens 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.