Background
Cholesterol is an essential structural and functional component of cells, maintains the cellular integrity and precursors for bile acid, steroid hormones and other signaling molecules [
1,
2]. Most of the cholesterol concentrates in the lipid raft of plasma membrane after transportation from endoplasmic reticulum, regulate cellular proliferation, differentiation and survival [
3]. Earlier reports suggested that accumulation of cholesterol in solid tumors enhances the angiogenesis and aggravate tumor formation, which is now considered as the hallmark for aggressiveness of cancer [
4,
5]. Enrichment of cholesterol in the lipid raft in cancer cells make them more sensitive to cholesterol depletion and induces anoikis like cell death [
6]. It shows the cholesterol in lipid raft having immense role in cancer cells survival and its progression [
7]. Cholesterol enrichment in lipid raft requires for the recruitment and activation of caspase-8 and FADD in death inducing signaling complex (DISC) which execute apoptotic and non-apoptotic functions [
8,
9]. Cholesterol and its metabolites are associated with initiation of different kind of programmed cell death. In recent years there are some reports suggesting induction of apoptosis and autophagy as well as anoikis like cell death mechanism in cholesterol depleted cells [
10,
11]. Cholesterol depletion via cholesterol oxidase as well as cholesterol metabolites (such as 24[OH] cholesterol) was reported for induction of apoptosis and necroptosis [
12,
13]. Caspase-3 activation is known for its dubiousness and can also be the results of caspase-independent cell death in cholesterol depleted cells especially due to reverse activation of caspase-8 without involvement of MOMP or receptor related signals from outside of cells [
14]. Lipid raft is reported as reservoir of death inducing signaling complex where caspase-8 and FADD migrated after death receptor ligand binding. Disruption of lipid raft inhibits the migration and activation of caspase-8 [
15] as well as FADD which can create opportunity for caspase independent cell death [
16].
There are four major forms of caspase independent programmed cell death—autophagy, necroptosis, paraptosis and pytoptosis which are directly or indirectly associated with cholesterol metabolism [
17‐
19]. Caspase-8 is the key regulator of many caspase independent cell deaths as well as executes many non-apoptotic functions which can be advantageous for the cancer cell’s progression [
20‐
22]. Our initial observations on cholesterol depleted MDA-MB 231 cells was with no response to pan caspase inhibitor (Z-VAD [OME]-FMK) but a sign of programmed cell death. This inspired us to examine extensively all the major forms of programmed cell death, involvement of caspases-8 and its impact on the migration efficiency of cancer cells.
Materials and methods
Material
Methyl-β-cyclodextrin (Sigma, C4555-5G) soluble cholesterol (Sigma, C4951-30MG), cycloheximide (Sigma, C6255), necrostatin-1 (MerckMillipore, 480065), Z-VAD [OME]-FMK (Cayman, 187389-52-2), 3-methyl adenine (Cayman, 5142-23-4), Cholesterol assay kit (Abcam, ab133116), MTT (MPBio, 102227), Alexa Fluor® 488 Annexin V/Dead Cell Apoptosis Kit (Life technology), Mitomycin C (Cayman, 1-800-364-9897); RNA isolation kit (Nucleopore, NP-84105), Revert H Minus first strand cDNA synthesis Kit (Thermo scientific, K1631).
Cell line and cell culture
MDA-MB-231 cell line (NCCS, Pune), BALB/c 3T3 cell line (NCCS, Pune), 4T1 cell line (Kind gift from division of Animal Biotechnology, IVRI), MCF-7 cell line (NCCS, Pune), Vero cell line (NCCS, Pune), Leibovitz-15 Media (MPBIO, 1251054), DMEM (Himedia, AL151A-500 ml), RPMI-1640 (Himedia, AL162A-500 ml). All cells were maintained in 10% FBS along with penicillin (100 U/ml) and streptomycin (100 µg/ml) at 37 °C in CO2 incubator. MDA-MB 231 cells in Leibovitz-15 media was separately maintained.
Cell treatment
Chemical agents were freshly prepared in recommended media and filtered with sterile syringe filter. All cells were treated with MβCD and other target agents in indicated concentration as per the protocol given for each assay.
Qualitative estimation of membrane cholesterol
4T1 and MDA-MB 231 cells at 15000 cells/well were seeded in 96 well plate and incubated for overnight. Cells were exposed to 5 mM MβCD for 1 h in serum free media and subsequently by 1 mM soluble cholesterol (complex of MβCD and cholesterol). Cells were stained with filipin and images were collected by fluorescent microscopy [
23]. Qualitative quantification of fluorescent intensity was measured and analyzed by Imagej software. Corrected total cell fluorescence (CTCF) was calculated using following formula: Integrated density − [mean area of sample × mean of background fluorescence]. This CTCF was converted into percentage against controls [
24].
Cell viability assay
MDA-MB 231, 4T1, BALB/c 3T3, and Vero cells were seeded at 15,000 cells per well in 96-well microplate and after overnight incubation treated with various concentration of MβCD in serum free media for indicated period. Cytotoxicity was determined by the MTT assay, propidium iodide (PI), acridin orange (AO) and ethidium bromide (EB). Mitochondrial membrane potential was assessed by JC-1 dye as per the manufacturer’s protocol.
Assessment of programmed cell death
MDA-MB 231 and MCF-7 cells were seeded at 0.5 × 10
5 cells per well in 24 well plate and incubated for overnight. Next day, treated with 5 mM MβCD for 2, 4 and 6 h. Annexin-V binding assay was performed as per the manufacturer’s protocol. MDA-MB 231 cells and Vero cells were seeded at 3 × 10
5 cells per well in six well plate and next day treated with and without pan caspase inhibitor, Z-VAD [OME]-FMK along with the 5 mM MβCD and incubated for 2, 4, 6, 12 and 24 h. Cell viability was measured by MTT, XTT and PI [
25]. For Necroptosis assessment MDA-MB 231 cells were treated with Z-VAD [OME]-FMK and 5 mM MβCD in the presence and absence of necrostatin-1 for 6 h [
25]. Cell death was analyzed by MTT. Assessment of autophagy was performed by incubation of MDA-MB 231 cells with 5 mM MβCD in the presence and absence of autophagy inhibitor 3-methyl adenine (3-MA) for 6 h [
26]. Cell viability was estimated by PI and MTT assay. Pyroptosis assessment was performed by exposing the Z-VAD [OME]-FMK pretreated MDA-MB 231 cells to the 5 mM MβCD in the presence and absence of glycine, a pyroptosis inhibitor [
27]. Cytotoxicity was quantified by MTT assay.
Determination of the role of caspases in autophagy
MDA-MB 231 cells were seeded at 0.3 × 10
6 cells in six well plate and next day cells were treated with 5 mM MβCD in the presence and absence of mitomycin c, a pan caspases activator [
28] and cell death was assessed by JC-1 membrane potential assay and PI. In another experiment MDA-MB-231 cells were incubated with 5 mM MβCD and in presence and absence of cycloheximide (CHX) @ 50 µg/ml, a caspase-8 activator for 6 h [
29]. Cell viability was measured by PI.
Real time polymerase chain reaction
MDA-MB 231 cells were exposed to the 5 mM MβCD for 4 h, after incubation total RNA was isolated by the RNA-isolation kit as per the manufacturer’s protocol. RNA integrity was checked in 1.2% agarose gel and c-DNA synthesis was done using Revert Aid H minus First Strand cDNA synthesis kit as per the manufacturer’s protocol. Primers for caspase-8, LC-1, Beclin-1, PI3KclassIII, ATG-3, RIPK-1, Cyclophylin-A, cFLIP and PUM-1 mRNA were designed (Table
1). PUM-1 used as reference mRNA for normalization. Relative quantitation of mRNA of caspase-8, PI3KClassIII, Beclin-1, LC-1 (MAP1LC3A), ATG-3, FLIP-c, Cyclophilin-A and RIPK-1 were performed in Step One Real time PCR (Applied Bio system).
Table 1
Details of primers used in experiment
CASPASE-8 | XM_005246891.4 | Forward | GTTGTGTGGGGTAATGACAATCT | 58.92 | 183 |
Reverse | CCATTCCTGTCCCTAATGCTG | 58.42 |
MAP1LC3A | XM_011529085.2 | Forward | TCCTGAACTGAGCTGCCTCTA | 60.27 | 131 |
Reverse | CACCCAGAGGGACAACCCTA | 60.55 |
BECN-1 | NM_001313998.1 | Forward | GGTTGAGAAAGGCGAGACACG | 61.52 | 133 |
Reverse | TGTCCACTGCTCCTCAGAGT | 60.18 |
RIPK-1 | NM_001317061.1 | Forward | TGGCAGGAAAGAAGGCCC | 59.56 | 144 |
REVERSE | CCTAGGCTGCCCATGGTGTT | 62.22 |
CFLAR | XM_017005196.1 | Forward | GCAGCCTCTTGGAGGTGGAT | 61.92 | 116 |
Reverse | CGCAGTACACAGGCTCCAGA | 61.88 |
ATG-3 | M_001278712.1 | Forward | CGAGTGAAGCAAAGCGAGGA | 60.67 | 128 |
Reverse | GACCGGACCCAGCTGTCA | 61.31 |
Cyclophylin-A | M_001300981.1 | Forward | CTCGAATAAGTTTGACTTGTGTTT | 56.17 | 165 |
Reverse | CTAGGCATGGGAGGGAACA | 58.38 |
PUM-1 | NM_014676.2 | Forward | AGCCCAATAACAACCTGGCA | 59.89 | 144 |
Reverse | CGCCGAGAGAACTGCTACTT | 59.83 |
PIK3C3 | XM_011526031.2 | Forward | CCTGGAAGACCCAATGTTGAAG | 59.18 | 236 |
Reverse | CGGGACCATACACATCCCA | 58.78 |
Cell migration assay
4T1 and MDA-MB 231 cells were seeded at 1 × 10
6 cells per well into six well plate. Cells were washed with serum free media and treated with mitomycin c (10 µg/ml for 30 min). After incubation cells were again washed thrice with serum free media and 5 mM MβCD was given to the cells for 1 h. Scratch was made by 200 µl micro tip, cell debris was removed and cells were kept in fresh serum free media for next 24 h [
30]. Multiple images of created wound were taken in subsequent interval and analyzed by Imagej analyzer.
Statistical analysis
Statistical analysis was performed by HPSS 11.4 free online available software. Data are presented as mean ± sde of mean at least two independent experiments. One-way anova post hock Tukey’s and Dunnett’s was used for statistical significance in multiple comparisons. Paired-t test was used to compare the lesser than three groups.
Discussion
Lipid raft in plasma membrane is known as signaling platform for cellular proliferation and survival. Elevated level of cholesterol are reported in various tumors especially in chemo resistance cancer cells [
32]. Raft disruption induces more cell death in certain cancer cell line comparable to normal counterpart [
11]. Recent publications emphasized on the role of 24-hydroxycholesterol and cholesterol oxidase in induction of necroptosis and apoptosis [
12,
13]. However apoptosis and autophagy induction after cholesterol depletion was reported earlier. They described down regulation of Bcl-xl, Akt inactivation, caspase-3 activation and accelerate conversion of LC-I to LC II after raft disruption [
10]. But caspase-3 activation and autophagy induction are contrasting phenomenon. In our initial experiment on incubation of cholesterol depleted cells with pan caspase inhibitor (Z-VAD [OME]-FMK) shows no significant differences in cell death in cholesterol depleted cells. These contrasting observations motivated us to extensively explore the mechanism associated with programmed cell death, subsequently the pivotal role of caspase-8 in migration potential of cancer and non-cancer cells.
In our study we first confirmed the MβCD mediated depletion of the membrane cholesterol and its subsequent replenishment by the complex of MβCD and cholesterol in 4T1 and MDA-MB 231 cells. Depletion of cholesterol changed the morphology of MDA-MB 231 cells but subsequent enrichment restored the cellular morphology through cytoskeletal rearrangement which was consistent with the earlier report [
11]. Cholesterol helps to maintain the membrane fluidity. Adhesion of cells with substrata is essentials for survival of cells and changes in morphology initiates the anoikis like cell death [
33]. In our experiment cholesterol depletion was shown significant cytotoxicity from 5 mM MβCD in 4T1, BALB/c 3T3 and MDA-MB 231 cells. Although we have not observed any significant differences in cell death among the cancerous and non-cancerous cell lines with 5 mM MβCD concentration. More probably due to highly diversification in number, type and size of lipid raft among cells of different origins [
34]. Hyper susceptibility of MDA-MB 231 and MCF-7 cancer cells to the cholesterol depletion compared to MCF-10A cells were shown earlier [
11]. After confirming cell death in various cell lines, we next found out the existence of programmed cell death in cholesterol depleted cells. Co-incubation of MDA-MB231 and MCF-7 cells with 5 mM MβCD undermined the mitochondrial health and induces programmed cell death. Mitochondrial depolarization is the marker for the compromised mitochondria which can be assessed by JC1 dye. In our experiment we identified the expression of PS, a hallmark for early apoptosis as well as the mitochondrial depolarization within 6 h of cholesterol depletion which ensures onset of programmed cell death in MDA-MB 231 and MCF-7 cells. Caspases are bedding for both caspase dependent and independent cell death [
33]. Caspase-8, caspase-9 and caspase-1 are the major driver of apoptosis and pyroptosis respectively [
35]. Incubation of MDA-MB 231 cells with pan caspase inhibitor (Z-VAD [OME]-FMK) after cholesterol depletion brings no significant changes in cell death. Even relative quantitation of caspase-8 mRNA shows significant down regulation in cholesterol depleted MDA-MB 231 cells. Together our finding shows that disruption of lipid raft by MβCD follows caspase independent cell death and caspase-8 down regulation might be associated with certain kind of program cell death. Caspase-1 activation is crucial for pyroptosis and directly dependent on caspase-8 for processing [
35]. Our experiment with pan-caspase (Z-VAD [OME]-FMK) and Glycine inhibitor together, nullified the existence of pyroptosis in cholesterol depleted MDA-MB 231 cells. Absence of pyroptosis indirectly supports the downregulation of caspase-8, as it requires for the activation of caspase-1.
Necroptosis, autophagy and paraptosis are the major caspase independent cell death. Caspase-8 down regulation is essential for caspase independent cell death because it cleaves the substrates necessary for autophagy and necroptosis [
36]. Product of cholesterol metabolism such as 24(S)-hydroxycholesterol and 4-cholesten-3-one were found to be associated with RIPK-1 activation in neurons and ROS mediated induction of autophagy in cancer cells [
32]. We were also expecting such response in cholesterol depleted cells, but our study revealed absence of necroptosis in cholesterol depleted cells. There was no significant difference in cell death when cells were co-incubated with necrostatin-1 (a necroptosis inhibitor) and 5 mM MβCD in presence and absence of pan caspase inhibitor (Z-VAD [OME]-FMK). Release of the chromatin protein high mobility group B1 (HMGB1) and Cyclophylin-A are reported as marker for late and early necrotic cell death [
37]. To confirm, we performed relative quantitation of Cyclophylin-A, cFlip and RIPK-1, results shows no significant difference at mRNA level. It shows that down regulation of caspase-8 do not favor the promotion of receptor interacting protein kinase-1 (RIPK-1) but something else. Cytotoxic stimuli in compromised caspase-8 in presence of Z-VAD [OME]-FMK can activate the autophagy death in certain cell lines [
33,
34]. 3-Methyl adenine (3-MA) is the inhibitor of PI3Kclass III–Beclin-1 complex, inhibit the autophagy initiation [
38]. When MDA-MB 231 cells were co-incubated with 3-MA and 5 mM MβCD, cell death was significantly reduced. It indicates that Beclin-1–PI3K class III complex playing role in onset of autophagy in cholesterol chelated cells and facilitated by down regulation of caspase-8. We gained more confident when treatment of MDA-MB 231 cells with mitomycin c (60 µg/ml) and cycloheximide (50 µg/ml) restore the viability of cell death in cholesterol depleted cells. Mitomycin c is known for DNA damage, activation and processing of caspase-9 and caspase-8 whereas cycloheximide repress the cFLIP and finally stimulate the caspase-8 [
28,
29]. Activation of caspase-8 by these agents may cleave Beclin-1 and ATG-3 and reduces the autophagy which culminate in more viability of cholesterol depleted cells. This finding was further confirmed when caspase-8 activation did not abrogate cell death in cholesterol depleted cells, simultaneously treated with 3-MA, a PI3Kclass III–Beclin-1 complex inhibitor. These results strongly suggested that compromised caspase-8 facilitate autophagy by promotion of Beclin-1–PI3K class III complex which can be abrogated by caspase-8 activation. Although relative quantitation of PI3K class III, Beclin-1, ATG-3 and LC1 at transcription level not revealed any significance differences. Because processing and interaction between caspases and autophagy components might be taken place at cellular or translational level [
39]. Characteristics feature of paraptosis shows inhibition with cycloheximide and no response to pan caspase inhibitor and 3-MA an autophagy inhibitor [
31]. However, we clearly observed both cycloheximide and 3-MA stops MβCD induced cell death. Hence our results reject the occurrence of paraptosis in cholesterol depleted cells. Cholesterol depletion might be associated to the upstream of autophagy regulator such as ULK-1 complex or mTOR complex known for nutritional sensitive, this requires further study in future. Recently it was claimed that cycloheximide inhibit the starvation induced autophagy by activating the mTORC-1 [
40] but here we had also confirmed our observations with mitomycin c a potent caspase-8 activator in different combinations. However, we cannot ignore the direct or indirect (mitochondrial mediated) induction of autophagy via downregulation of mTOR1 which need investigations in future.
Cell migration is an important physiological phenomenon occurs during embryonic development, tissue organization, disease development as well as cancer progression [
41]. Actin polymerization is the key player for the migration of cells which controlled by highly complexed multi nodal regulatory components [
42]. Alteration in membrane cholesterol disrupt the actin cytoskeletal organization and detached the cells from substrata. We have implicated this observation to assess the migration efficiency of MDA-MB 231 cells and 4T1 cells. Apart from apoptosis, caspase-8 also involved in the regulation of cellular proliferation and cell migration [
9,
43]. Cholesterol enrichment reported to promote the ᾳ6β1 integrin-mediated adhesion and assembly of the focal adhesion complex recruit caspase-8 to promote the cell migration [
44]. In our experiment we noticed that cholesterol depletion significantly reduces the migration efficiency of MDA-MB 231 and 4T1 cells. Taking together our findings suggest that down regulation of caspase-8 during cholesterol depletion retard the migration efficiency of MDA-MB 231 and 4T1 cancer cells. Though we have not found significantly differences in migration efficiency between cancer (MDA-MB 213 cells) and non-cancer cell line (Vero cells) (data not included). Highly diversification in the size and shape of lipid raft in among cell lines might be the major restriction to assess the cell migration in cancer and non-cancer cell lines [
34]. Moreover other study in same line shows depletion of membrane cholesterol leads down regulation of FAK and disrupt the actin cytoskeletal organization which in turn stops caspase-8 recruitment and reduce the cell migration [
45]. Although we had not studied the invasiveness and epithelial mesenchymal transition in cholesterol depleted cells but similar studies suggested that MβCD mediated cholesterol depletion also reduces the cancer cell invasion and epithelial mesenchymal transition (EMT) [
46‐
50].
Authors’ contributions
MK designed this project and executed cell culture experimentations, data analysis. KI planned the real time PCR experiments and reviews the manuscript. MK given her expert ideas to design the experiments. All authors read and approved the final manuscript.