Background
Porcine circovirus type 2 (PCV2), a member of the
Circoviridae family, is a small non-enveloped virus, containing a single-stranded circular deoxyribonucleic acid (DNA) genome [
1], it is distributed worldwide and is considered to be an important emerging pathogen associated with several different syndromes and diseases in pigs, collectively grouped as porcine circovirus diseases (PCVD) [
2]. PCV2 is the major infectious agent of PCVAD in pigs, a multifactorial disease, considered one of the most economically important swine diseases worldwide [
3]. PCV2-associated systemic infection is clinically characterized by wasting, dyspnea, and lymphadenopathy and might be associated with diarrhea, pallor, and jaundice [
4]. The most relevant histological lesions in this condition occur in lymphoid organs and consist of extensive lymphocytic depletion, macrophage infiltration, a few multinucleated giant cells, and botryoid basophilic cytoplasmic inclusion bodies [
5].
PCV2 DNA genome is about 1767–1768 nucleotides long [
6] and encodes for three open reading frames (ORFs) [
7]. The ORF1 encodes the replication-related proteins: Rep (helicase) and Rep’ (nickase) that is the result of Rep-transcript alternative splicing process [
8,
9]. The ORF2 encodes the capsid protein, the only structural viral protein that is also the most variable nucleotide sequence of the viral genome [
10,
11]. Finally, the ORF3 embedded within ORF1, encodes a protein that is not essential for viral replication but is fundamental to the development of the viral pathogenesis [
12,
13].
PCV2 is classified into two main genotypes, PCV2a and PCV2b which were further subdivided into different clusters, 1A–1C and 2A–2E for PCV2b and PCV2a, respectively [
11]. A third genotype, PCV2c, has only been found in Denmark [
14]. A new type of PCV referred to as PCV1/2a was reported in Canada in 2009, it was found to be a chimeric virus containing ORF1 of PCV1 and ORF2 of PCV2a [
15]. Recently, two additional genotypes PCV2d and PCV2e, were described following sequence analysis of PCV2 isolates from China [
16]. However, a subsequent analysis of data sequences failed to support the new genotypes reported [
17].
In South America, PCV2 has been circulating in Brazil since 1988 [
18], but it was also detected in Argentina [
19,
20], and Chile [
21]. PCV2-associated systemic infection was first reported in 2007 [
22] in Colombia from pig farms located in different regions. In spite of that, genetic information about PCV2 strains in pig herds from the country had been unavailable until now. The main purpose of this work was to establish molecular detection and to achieve genetic and phylogenetic comparisons of full-length sequences of the ORF2 from PCV2 strains recovered from clinically healthy and PCV2-associated systemic infection affected pigs from different production systems in Colombia. Another purpose was to study the viral genotypes dynamics through time to trace temporal changes, in order to understand the molecular epidemiology of PCV2 in Colombia.
Discussion
PVC2 was detected in Colombian pigs associated with a wide variety of clinical conditions as described previously [
22,
23]. In this study, the presence of PCV2 was demonstrated by PCR in 22.4% of the serum and 83.6% of the tissue samples examined. The identification of PCV2 not only in cases associated with PMWS but also in healthy pigs, suggests that various risk factors may contribute to the exacerbation of PCV2 infection and the development of associated lesions. An epidemiological survey of PCVAD conducted between November 2008 and December 2009 in Colombia identified some factors associated with high mortality rates in the three major swine rearing areas in the country [
22,
23]. Herds that did not have good management practice, presence of poliserositis in weaned pig and low feed intake resulted in a major risk of increased mortality. In that study it was found that vaccination against PCV2, authorized since 2008, represented a high effective intervention practice on controlling PCAVD outbreak even though PCV2 infection itself wasn’t considered a risk factor for PCVAD development. It remains unclear which factors contributed to maintain a subclinical PCV2 infection in Colombian swine herds and thus it needs to be further investigated.
Unfortunately, samples collected before 2002 were not available at the time of the study, but it is reasonable to assume that PCV2 was already present in the Colombian pig population prior to this time frame. The earliest confirmed detection of PCV2 worldwide was in 1962 in Germany [
25], before that, the virus was probably causing subclinical infections or remained unknown for many decades before the description of PCVAD as a disease complex. An alternative to gain access to the knowledge of the PCV2 infection is the use of archived material, it is how in the UK investigations in archived formalin-fixed material established PCV2 detection using TaqMan1-PCR and immunohistochemistry in material originated from the 1970s [
26]. The earliest PCV2 infection in Swiss archived material was found in 1986 by using immunohistochemistry, resulting in the recognition of the earliest histological lesions typical for PCV2-associated systemic infection [
27]. Similarly, a study from Spain revealed the presence of PCV2 in archived material from 1985 onwards, and the occurrence of typical PCV2-associated systemic infection lesions as early as 1986 [
28]. A retrospective study of PCV2 infection in Japan reported seven cases in 1989 [
29]. Also, the earliest PCV2 infection in Thailand was reported in 1993 by using Nested PCR from formalin fixed tissues of PCV2-associated systemic infection affected pigs [
30].
When considering Colombia, the data presented here showed an increase in the incidence of PCV2b infection between 2006-2007, in that period PCVAD was epizootic and caused problems in numerous farms in several provinces [
22]. During that time, PCV2 positive samples by immunohistochemistry were collected from pigs showing characteristic lesions of PCV2-associated systemic infection and some of them were later studied by PCR. As mentioned earlier, 50 cases were collected from pigs with wasting problems during a time period between 2009 -2010. Forty of these samples were PCR positive and PCV2 DNA was identified in the 25.2% of the serum samples collected at that time from healthy pigs. It is well known that detection of PCV2 alone, without the three criteria for diagnostic of PCVAD, does not indicate PCVAD but merely PCV2 infection [
3]. However, there was no evidence that could relate the PCV2 strain groups and pathogenic PCV2 isolates from PCV2-associated systemic infection cases and besides that it cannot be concluded that PCV2 isolates from healthy pigs are non-pathogenic.
This study characterized and reconstructed phylogenetic analysis of 23 ORF2 of PCV2 strains obtained from pigs with PCV2-associated systemic infection and healthy pigs during 2002 -2010. Molecular characterization of the isolates was based on the analysis of cap gene. This region is suitable for genotyping studies and is considered a reliable phylogenetic marker for PCV2 strains since it is possible to reconstruct the same tree as with the whole viral genome [
11]. Porcine circovirus type 2 (PCV2) is divided into two major genotypes based on sequencing analysis. Recently, both genotypes were proposed and referred to as PCV2a and PCV2b [
31].
The alignment of the amino acid sequences of the ORF2 PCV2 capsid protein performed in the present study has identified three major regions of amino acid heterogeneity located at amino acid positions 57 -89, 121 – 134 and 190- 210 within heterogenic regions (Figure
3) similar to previous reports [
24,
32]. It is interesting to note that two of these regions (57-89 and 121-134) correspond with two dominant immunoreactive areas (65-87 and 113-139) as identified by Pepscan analysis [
32]. These immunodominant regions of the capsid protein of PCV2 exposed to selective immune pressure could represent potential candidate regions involved in the emergence of PCV2 variants. However, no repeatable or characteristic amino acid motifs for these two regions of the capsid protein of PCV2 could be associated with strains identified from pigs with PCV2-associated systemic infection or healthy pigs. Whether the anti-PCV2 antiserum generated from Colombian PCV2 strains could recognize the same epitopes in strains from other countries is not yet known but the results presented here contribute to the knowledge of the variability of the immunoreactive regions among PCV2 strains.
In terms of PCV2 genotype and its dynamics over time, there was not a relationship between the genotype of PCV2 and year of detection. Among the 23 Colombian PCV2 strains in this study, the strain CO6602 collected in 2002 belonged to the genotype PCV2b, whereas in the period from 2002 to 2010, in spite of being genotype 2b more prevalent, the isolates were a mix of genotypes PCV2a and PCV2b. The results presented here suggest that PCV2b has become the main genotype acting in Colombia over time. Previous studies revealed that both genotypes were associated with PCVAD-affected and non-affected herds [
24,
33‐
35]. Nevertheless, PCV2b is currently prevailing in naturally occurring infections worldwide [
36], a similar situation could be occurring in Colombian pig populations.
Furthermore, several recent publications have reported a shift from the genotype PCV2a to PCV2b which might be related to the occurrence of PCVAD outbreaks in Canada [
37], Sweden [
38], Switzerland [
35] and Spain [
39], indicating that PCV2b may be more virulent than PCV2a. However, in Colombia PCV2b has been present since 2002 in healthy animals and then it was associated to the PCVAD epizootic occurrence in farms of several regions of the country in the period 2006 – 2009. Nevertheless, in farm 2 a shift from PCV2a (2005) to PCV2b (2006) was found and, in farm 18 the variation was from PCV2b (2006) to PCV2a (2009). In addition, the PCV2b strains CO6602 and CO2906 collected in the same farm in the years 2002 and 2006 respectively showed less than 1.3% differences in the amino acid sequence of ORF2. It is well known that Colombia keeps a wide commercial exchange with North American countries, which includes the import of live animals and semen, so it is not surprising that the strains analyzed in this work were found to be closely related to Canadian and American strains isolated between 2004 - 2010, sharing 74,7% - 100% identity at the amino acid level. This coincides with findings in some countries, where the presence of PCV2 has been linked to imported pigs [
40] and the movement of asymptomatic PCV2- infected pigs that occurs as a result of the swine trading which has been suggested to be responsible for the rapid spread of PCV2 around the globe. Unfortunately, there is a lack of information regarding the origin of breeding animals in the herds which limits the capacity to shed light over the potential source of infection and why it is not possible to determine the exact year of introduction of PCV2 in Colombian swine farms.
Methods
Samples
This study analyzed three different groups of samples, each one from a different time frame. The first group corresponded to a retrospective study that included a total of 110 blood serum samples belonging to the bank sera of the Instituto Colombiano Agropecuario (ICA) collected during 2002 - 2005 as part of the national swine serologic monitoring program which focused on farms with 50 or more sows. Serum samples were from nursery/grower pigs (6-12 weeks of age) from 22 previously reported seropositive farms and they were mostly from animals with unknown or healthy clinical status [
22]. The second group of samples was from archived necropsy material collected between July 2006 and May 2007 from pigs with historical records of PCV2-associated systemic infection (by immunohistochemistry assays) from eleven different herds of four Colombian geographic regions (Table
1).
Additionally, a third group of serum and tissue samples collected between January 2009 and February 2010 were also examined (Table
2). Five pigs per farm from the 27 farms evaluated were used for serum collection. The criteria for serum selection included the age (between 8 and 15 weeks), weight (under 60 kg) and no clinical evidence of PCVAD in the animals. A total of 50 pigs, between 6 to 16 weeks old, with wasting problems after weaning were investigated in 18 of these farms. Field veterinarians selected 1 - 5 pigs from each farm based on loss of body condition, with the additional clinical signs of diarrhea, skin pallor, and/or respiratory disorders. Clinical samples (popliteal and inguinal lymph nodes, tonsil, spleen and kidney) of the affected euthanized animals were collected. The samples were kept at -70°C until performing DNA extraction and PCR analysis.
DNA extraction and PCV2 DNA amplification
The DNA was extracted from 200μl of serum or 20 mg of organ tissue homogenate using a commercial kit (QIAamp DNA Mini Kit, Qiagen, USA) according to the manufacturer’s recommendations. To avoid cross contamination, samples were processed individually and stored at -20°C.
Conventional PCR for PCV-2 was performed using primers previously described [
41] which amplified a 657 base pair (bp) fragment. The forward primer (5′-GCCAGTTCGTCACCCTTTC-3′) was located between genomic positions 940 and 958 (found in PCV2 ORF1). The reverse primer (5′-CTCCCGCACCTTCGGATAT-3′) was located between positions 1578 and 1596 (found in PCV2 ORF2). The optimized PCR reaction mixture contained 200 nM dNTPs, 1.5 mM MgCl, 1× PCR buffer, 500 nM of each primer and 0.05U of Taq polymerase (Promega M8298) in a 25 μl final volume.
The reactions were run in a thermocycler Bio Rad ALS-1296 (Bio-rad Laboratories, Inc USA) under the following conditions: one cycle at 94°C for 5 min, followed by 35 cycles of 94°C during 30 s, primer annealing 64°C for 1 min, initial extension at 72°C for 30 s, and a final extension of 72°C for 7 min. The amplified product was visualized by standard gel electrophoresis of 10 μl of the final reaction mixture on a 1.5% agarose gel (Sigma A-9539) in TBE Buffer 10× (Invitrogen 15581-044). Amplified DNA fragments of specific size were observed by ultraviolet fluorescence after staining with EZ Vision™ Three (Amresco N-313, USA). The length was verified by a 100 bp DNA ladder (Invitrogen 15628-019). Control DNA from a PCV2 strain (Genbank accession number JF290418) was included in each reaction.
PCR amplification of ORF2 gene
One set of specific PCV2 primers, based on PCV2 genome from the strain ZhuJi2003 (AY579893) published in the Gen Bank was designed to amplify the complete ORF2 PCV2 sequence. A full-length ORF2 gene of PCV2 was amplified by PCR with forward primer (capFw 5′CCGTTGGAATGGTACTCCTC 3′) located between genomic positions 825 and 844 (found in PCV2 ORF1). The reverse primer (cap Rw 5′ ACAGCGCACTTCTTTCGTTT3′) was located between positions 1760 - 1741 (found in PCV2 ORF2). PCV2 specific primers amplified a 935 bp DNA fragment. The optimized PCR reaction mixture contained 200 nM dNTPs, 1.5 mM MgCl, 1× PCR buffer, 600nM of each primer and 0.05U Taq polymerase (Promega M8298). Reaction conditions were as follows: initial denaturation at 94°C for 5 min, followed by 35 cycles of 95°C during 45 s, primer annealing 57°C for 45 s, initial extension at 72° for 45 s, and a final extension of 72°C for 12 min.
The specificity of the primers was tested by adding extracted nucleic acids from several viral and bacterial swine pathogens such as: Actinobacillus pleuropneumoniae, ( ATCC 27088), Mycoplasma hyopneumoniae (field strain), Haemophilus parasuis (ATCC 19417), Streptococcus suis ( ATCC 700794), swine influenza virus H1N1 (A/SW/Iowa/H1N1 NVSL 003 IDV 9501), porcine reproductive and respiratory syndrome virus (NVSL 130 PDV 9801), Aujeszky’s disease virus (Shope strain NVSL 070 - PDV), porcine parvovirus (Mengeling strain NVSL 080- PDV9501) and porcine circovirus type 1. Control DNA from PCV1 was obtained from the supernatant of the PK15 cell line, which is persistently infected with this virus (ATCC CCL-33). The sensitivity of the PCV2 PCR was estimated through the evaluation of serial DNA dilutions extracted from the PCV2 positive control. The amplified products were run in a 1.5% agarose gel and visualized by staining with EZ VisionTM (Amresco N -313, USA).
Viral sequences and phylogenetic analysis
DNA fragments of the calculated sizes were excised and recovered from the agarose gel using spin columns as described by the manufacturer (QIAquick Gel Extraction Kit, Qiagen 2876, USA). The purified PCR products were used as templates in cycle sequencing reactions primed with the PCV2 primers (capFw, capRw) and sequenced in both directions by Macrogen Sequencing Service, USA. Sequence alignment was performed using ClustalW software; genotype studies were performed by analyzing ORF2 compared to published sequences corresponding to different genotypes. The degree of identity among sequences at the nucleotide and amino acid levels was determined using BioEdit package v.7.0.9 [
42]. The phylogenetic tree was constructed by neighbor-joining method with the Kimura two-parameter as the model of nucleotide substitution using MEGA v.5.0 software [
43]. Confidence in the NJ tree was estimated by 1000 bootstrap replicates.
The sequencing of ORF2 presented greater difficulties with the electropherograms, with lower quality peaks. Only 23 were considered of good quality, with a definitive interpretation of the base sequence. The phylogenetic tree was constructed for ORF2 by comparing positive samples from various regions of Colombia as well as 68 sequences from the GenBank database, representative of all PCV2 genotypes described in North America, South America, Europe, Cuba and Asian countries (Table
4). The tree was rooted with a PCV1 sequence (accession number FJ475129).
Table 4
Accession numbers and geographic origin of the ORF2 sequences included in the phylogenetic analysis
AB072302 | No. 26 | Japan | PCV-2a | Imai et al. (2001) |
AF055391 | nd | USA | PCV-2a | Meehan et al. (1998) |
AF055392 | nd | Canada | PCV-2a | Meehan et al. (1998) |
AF109399 | 2-E | Canada | PCV-2a | Hamel et al. (2000) |
AF154679 | nd | Taiwan | PCV2-2a / 2B | Kuo et al. (1999) |
AF117753 | 2-D | Canada | PCV-2a | Hamel et al. (2000) |
AF201307 | GER3 | Germany | PCV-2a / 2C | Mankertz et al. (2000) |
AF201309 | SPA2 | Spain | PCV-2a | Mankertz et al. (2000) |
AF364094 | nd | Taiwan | PCV-2a | Wang et al. (2001) |
AF381175 | BF | China | PCV-2a | Lu et al. (2001) |
AY180397 | Pingtung-5 | China | PCV-2a | Liao et al. (2002) |
AY256459 | 336 | Hungary | PCV2-2a 2C | Dan et al. (2003) |
AY321982 | Fh14 | France | PCV-2b | de Boisseson et al. (2004) |
AY321983 | Fh20 | France | PCV-2b | de Boisseson et al. (2004) |
AY321984 | Fd3 | France | PCV-2b | de Boisseson et al. (2004) |
AY322001 | Fh21 | France | PCV-2b | de Boisseson et al. (2004) |
AY484407 | NL_Control_1 | Netherlands | PCV-2b | Grierson et al. (2004) |
AY484412 | NL_Control_6 | United Kingdom | PCV-2b | Grierson et al. (2004) |
AY484415 | NL_PMWS_3 | United Kingdom | PCV-2b | Grierson et al. (2004) |
AY556477 | HuNan | China | PCV2- 2b 1C | Zhixin et al. (2004) |
AY678532 | ZS0401 | China | PCV-2b | Zhou et al. (2004) |
AY682997 | ZC | China | PCV-2b | Wang et al. (2004) |
AY691169 | QZ0401 | China | PCV-2b | Zhou et al. (2004) |
AY699793 | nd | USA | PCV2-2a 2E | Fenaux et al. (2004) |
AY847748 | BJW | Singapore | PCV2-2b 1B | Liu et al. (2005) |
AY754017 | Aust 6 | Australia | PCV2-2a 2A | Muhling et al. (2005) |
DQ151643 | GS | China | PCV-2b | Ma et al. (2005) |
DQ220728 | FMV05-6317 | Canada | PCV-2b | Tremblay et al. (2005) |
DQ220734 | FMV05-7389 | Canada | PCV-2b | Tremblay et al. (2005) |
DQ220736 | FMV05-7537 | Canada | PCV-2b | Tremblay et al. (2005) |
DQ220739 | FMV05-6302 | Canada | PCV-2b | Tremblay et al. (2005) |
DQ233257 | ROM | Romania | PCV-2b | Cadar et al. (2007) |
DQ629115 | n32eu | USA | PCV-2b | Cheung et al. (2007) |
DQ629117 | k52 | USA | PCV-2b | Cheung et al. (2007) |
DQ861896 | am22 | Brazil | PCV-2b | Castro et al. (2006) |
DQ861899 | am9 | Brazil | PCV-2b | Castro et al. (2006) |
DQ861902 | am21 | Brazil | PCV-2b 1A | Castro et al. (2006) |
DQ870484 | hk102 | USA | PCV-2a | Cheung et al. (2007) |
DQ923524 | 15/23R | Brazil | PCV-2b | Dezen et al. (2010) |
EF524517 | GS04 | China | PCV-2d | Wang et al. (2009) |
EF524526 | LN05 | China | PCV-2e | Wang et al. (2009) |
EF524533 | GX0602 | China | PCV-2e | Wang et al. (2009) |
EF524539 | TJ06 | China | PCV-2d | Wang et al. (2009) |
EU057185 | P0404c/03 | Brazil | PCV-2b | Esteves et al. (2007) |
EU148503 | DK1980PMWSfree | Denmark | PCV-2c | Dupont et al. (2008) |
EU148505 | DK1990PMWSfree | Denmark | PCV-2c | Dupont et al. (2008) |
EU186062 | Chile C | Chile | PCV-2b | Bucarey et al. (2007) |
EF394775 | 05-22779 | Canada | PCV2 –2a 2E | Tremblay et al. (2007) |
EU519223 | Chile-I | Chile | PCV-2b | Bucarey et al. (2007) |
EU747125 | PCU1 | Korea | PCV-2a | Vijayachandran et al. (2008) |
EU755378 | BRA9 | Brazil | PCV-2b | Chiarelli-Neto et al. (2009) |
EU980087 | isolate 5 | Argentina | PCV-2b | Pereda et al. (2008) |
EU980092 | isolate 11 | Argentina | PCV-2b | Pereda et al. (2008) |
EU980093 | isolate 11 | Argentina | PCV-2b | Pereda et al. (2008) |
FJ233907 | SoPCV2b | Canada | PCV-2b | Chaiyakul et al. (2008) |
FJ475129 | BJ-1 | China | PCV1 | Zhou et al. (2008) |
FJ905463 | C7155 | Korea | PCV-2b | Kim et al. (2009) |
FJ905471 | C7189 | Korea | PCV-2a | Kim et al. (2009) |
FN398024 | Villa Clara V2 | Cuba | PCV-2b | Pérez et al. (2010) |
FN398025 | Villa Clara V4 | Cuba | PCV-2b | Pérez et al. (2010) |
FN398026 | Pinar del Rio | Cuba | PCV-2b | Pérez et al. (2010) |
GQ404852 | MN614 | USA | PCV-2b | Li et al. (2010) |
GU049341 | Sp-10-7-54-13 | Spain | PCV-2b | Fort et al. (2010) |
GU049342 | Sp-10-7-54-13 | Spain | PCV-2b | Fort et al. (2010) |
JN644769 | SeUy1 | Uruguay | PCV-2b | Ramos et al. (2010) |
JN644770 | SeUy2 | Uruguay | PCV-2b | Ramos et al. (2010) |
JN644771 | SeUy3 | Uruguay | PCV-2b | Ramos et al. (2010) |
Competing interests
The authors declare that they have no competing interest.
Authors’ contributions
MARM, JDMG, GCRN, VJV, JJC designed the study. MARM prepared virus isolates and clinical data. MARM conducted experiments. MARM, JDMG, GCRN contributed to analysis and interpretation of data. MARM, JDMG, GCRN, VJV and JJC wrote the manuscript. All authors read and approved the final manuscript.