Dexrazoxane may prevent doxorubicin-induced DNA damage via depleting both Topoisomerase II isoforms

DRZ was purchased from Chiron (Amsterdam, The Netherlands), DOX was from Pfizer (Karlsruhe, Germany). ICRF-161 and ICRF-193 were kindly provided by Dr. Annemette V. Thougaard (TopoTarget A/S, Copenhagen, Denmark). The following antibodies were used in Western blot: TOP2A/B (1: 200) and TOP2A (1:2,000) from StressGen, TOP2B (1:2,000) from BD Pharmingen, γ-H2AX (1:500) from Abcam, GFP (1:5,000) from Clontech, GAPDH (1:10,000) from Santa Cruz Biotechnology, α-tubulin (1:5,000) from Dianova (Germany) and β-tubulin (1:100,000) from Sigma.

HTETOP cells express TOP2A exclusively from a transgene under the control of a tetracycline-repressive promoter, have been previously established [20]. HTETOP and the parental HT1080 cells were provided by Dr. Andrew C.G. Porter (Centre for Haematology, Faculty of Medicine, Imperial College London, England) and cultured as previously described [14]. To obtain differentiation, H9C2 cells (provided by Dr. Tomas Simunek, Department of Biochemical Sciences, Charles University in Prague, Czech Republic) were continuously cultured for 14 days: 3 days in 10% FCS medium and the following 11 days in 1% FCS medium. HEK293 cells were obtained from Dr. Christian Mielke (Institute of Clinical Chemistry and Laboratory Diagnostics, Heinrich-Heine-University, Düsseldorf, Germany) and NYH cells were from Dr. Annemette V. Thougaard (TopoTarget A/S, Copenhagen, Denmark).

Wild type C57BL/6 J (B6) mice were purchased from Jackson Lab (Bar Harbor, ME) and they were 8–12 weeks old at the onset of experiment. Mice were injected i.p. with 100 μl of saline (control group, n =3) or 200 mg/kg DRZ in the same volume of saline (DRZ group, n =9). Animals were sacrificed by cervical dislocation 6, 24 or 48 h after DRZ injection and the whole hearts were isolated and snap-frozen in liquid nitrogen. In parallel experiments, mice were injected with 200 mg/kg DRZ alone (n =3), 20 mg/kg DOX (n =3) alone or in combination (n =3, DRZ was injected 30 min before DOX). Heart tissues were removed 24 h later for Western blot analysis. The mouse experiments described in this paper have been permitted by the Animal Care Committee of Rhineland-Palatinate (Koblenz, Germany) with the permit No. AZ 23 177-07/G 12-1-043.

Heart tissues from control or drug-treated mice were homogenized thoroughly in RIPA buffer containing proteinase inhibitors [14]. The lysate was subsequently incubated for 2 h at 4°C with agitation. Cultured cells were harvested and lysed in RIPA buffer followed by 30 min incubation on ice. Twenty to 50 μg protein samples were separated by SDS-PAGE as described previously [14]. Densitometric analysis of protein bands was performed using the NIH Image J software.

siRNA oligos were used to knock down human TOP2B with the target region GCTTAACAATCAAGCCCGT [21]. siRNA oligos against the GFP sequence GGCTACGTCCAGGAGCGCACC were used as non-silencing control. To specifically knock down the endogenous TOP2B without affecting the transfected TOP2B-YFP, three siRNA oligos targeting the 3-UTR of human TOP2B mRNA were applied, since the TOP2B-YFP expression vector encompasses only the open reading frame of TOP2B without 3-UTR. The target sequences for 3-UTR region were as follows: siRNA1: GAAATGTCACGTACTGTCTGA; siRNA2: ACTGTCTGATTGGCTTGTAGA; siRNA3: GCTTGTAGAATTGTTATAGAC. For H9C2 cells, the target sequence of siRNA to knock down rat Top2b was: GAACAAAGCTGGTGTATCA. siRNA oligos were transfected at the final concentration of 50 nM using the jetPRIME^TM transfection reagent (Polyplus Transfection SA, Illkirch, France) according to the specifications of the manufacturer.

The bicistronic vector expressing human TOP2B fused with enhanced yellow fluorescent protein (YFP) at the C-terminal has been described previously [22]. Single amino acid substitution was introduced into this vector with the site-directed mutagenesis Kit (QuikChange, Stratagene). Primers for individual TOP2B mutants are shown in Table 1. The mutated sites are highlighted by italic bold letters. PCR conditions for mutagenesis were according to the manufacturer’s instructions. The introduction of the desired and the absence of off-target mutations was verified by sequencing.

The raw RNA-Seq data obtained from diverse human or mouse organs were downloaded in Fastq format from Gene Expression Omnibus (GEO) in NCBI (accession number GSE30352) [23]. Original reads were mapped against human (version GRCh37/hg19) or mouse (version NCBI37/mm9) genome with TopHat using gene annotation file as the reference for alignment [24]. The genomic sequence data and gene annotation files were downloaded from UCSC (http://​genome.​ucsc.​edu/​). Mapped reads were assembled with the program Cufflinks [24] and the expression levels of individual transcripts were calculated as Fragment Per Kilobase of exon per Million fragments mapped (FPKM).

Western blot analysis of mouse heart homogenates revealed a single band with molecular weight corresponding to Top2b (time 0 h, Figure 1A). This was in agreement with TOP2B/Top2b mRNA transcripts accounting for >95% of combined TOP2A and TOP2B transcripts in human or mouse hearts (Figure 1B). To investigate DRZ effects on Top2b protein expression in vivo, B6 mice were injected with 200 mg/kg DRZ and heart tissues were removed 6, 24 or 48 h later for Western blot analysis. DRZ treatment clearly depressed Top2b protein expression 6 h after injection, with partial recovery observed at 48 h (Figure 1A). The depletion of Top2b was observed also when DRZ was followed 30 min later by 20 mg/kg DOX given i.p., which modelled the recommended time-course of combining anthracyclines with DRZ in humans (Figure 1C).

These in vivo data differed from the reported expression of both Top2 isoforms in the cardiomyocyte-derived H9C2, with DRZ selectively depleting Top2b [15]. We therefore assessed Top2 levels as a function of H9C2 differentiation from fibroblast-like cells to multinucleated myotubes, which form only after >10 days of culturing (Figure 2A). Undifferentiated cells expressed both Top2 isoforms (day 2, Figure 2B). The differentiation was accompanied by pronounced decrease of Top2a protein expression and by modest increase of Top2b (Figure 2B). DRZ and the likewise Top2-binding analogue ICRF-193 depleted Top2b from differentiated H9C2 cells, in contrast to the non-binding [25] analogue ICRF-161 (Figure 2C). DRZ, but not ICRF-161 reduced the accumulation of DOX-induced DSB (Figure 2D). These results were suggestive of DRZ capable of reducing DOX-induced DSB in cardiac cells via depletion of the DOX target Top2b, the predominant cardiac Top2 isoform.

To provide a more direct proof of Top2b involvement in the protective effect of DRZ, we manipulated this enzyme’s level. In H9C2 cells, Top2b depletion by means of siRNA (Figure 3A) protected against 0.1 μM DOX-induced DNA damage (Figure 3B) in a similar way as did DRZ (Figure 2D). Top2b knockdown by siRNA was less protective against DSB by 1 μM DOX, consistent with non-enzyme mediated DSB formation by high concentration of DOX [14]. Nevertheless, the reduction of Top2 still may have been an accompanying rather than causative event in the prevention of DOX-induced DSB. To establish a causative link, we took advantage of the previously identified TOP2A variants which confer resistance against DRZ. We focused on five of those variants in the N-terminal domain of Top2A, which is responsible for binding DRZ and other bisdioxopiperazines [26]. Wild-type residues of all five Top2A variants i.e. T49I [27], Y50F [27], R162Q [28], Y165S [29] and L169F [30, 31], are conserved between human TOP2A and TOP2B. The corresponding residues of TOP2B were individually mutated (T65I, Y66F, R178Q, Y181S, and L185F) by site-directed mutagenesis in a vector expressing wild-type human TOP2B with YFP fused at the C-terminus [22]. Plasmids encoding WT or mutated TOP2B were then transiently transfected into human fibrosarcoma-derived HTETOP cells. We employed for this experiment HTETOP cells, as they are easier to transfect and offer the possibility of tetracycline (TET)-mediated depletion of TOP2A [20]. With the exception of R178Q, all mutants were resistant to DRZ-induced depletion when compared to WT TOP2B in Western blot using anti-YFP antibody (Figure 3C, upper panel). This was confirmed by an anti-TOP2B antibody, which also showed the expected depletion of the endogenous WT TOP2B following DRZ exposure (Figure 3C, lower panel).We then investigated if the four TOP2B mutants resistant to DRZ-induced depletion still exhibit protection against DOX-induced DSB. To be able to distinguish between DSB mediated by the transfected TOP2B-YFP and those mediated by endogenous TOP2A or TOP2B, the endogenous TOP2A was removed by pre-treatment with TET and TOP2B was knocked down using siRNA oligos targeting the 3-UTR (Figure 4A). The protein level of TOP2B-YFP expressed from transfected plasmids remained unchanged upon siRNA transfection (Figure 4B) as the 3-UTR of TOP2B is absent from these constructs. DOX-induced DSB formation was much higher in cells depleted of endogenous TOP2A and TOP2B and transfected with wild-type or mutated TOP2B-YFP than in mock-transfected cells. As expected, DRZ attenuated DOX-induced DSB formation in cell transfected with wild-type TOP2B. In contrast, this protection was abolished by mutant M181 (Figure 4C, upper panel) and weakened by mutants M185, M65, and M66 (Figure 4C, lower panel). The above results were consistent with prevention of DOX-induced DSB by DRZ being mediated by the bisdioxopiperazine binding site of TOP2B.

In contrast to post-mitotic cells such as cardiomyocytes, proliferating cells such as tumor cells express TOP2A or both isoforms rather than TOP2B alone. As any DRZ interference with TOP2A could affect the TOP2A-mediated therapeutic response to anthracyclines [19], we investigated the effect of DRZ on TOP2A and on DOX-induced DSB mediated by this isoform.

We previously reported DRZ-induced TOP2A depletion in HTETOP cells, which was proteasome-independent and accompanied by TOP2A mRNA reduction [14]. The depletion most likely required direct TOP2A-DRZ interaction, as it was absent from cells treated with the non-binding DRZ analogue ICRF-161 (Figure 5A). Likewise, ICRF-161 did not reduce DOX-induced DSB accumulation, in contrast to DRZ and ICRF-193 (Figure 5A).Does DRZ affect DOX-induced DSB formation mediated by TOP2A? To answer this question we first assessed the contributions of the individual TOP2 isoforms to DOX-induced DNA damage. DSB were barely detectable in DOX-treated HTETOP cells depleted of TOP2B by means of siRNA and of TOP2A by TET (lanes 11–12 vs. 2–3 in Figure 5B). The DSB level was higher in DOX-treated cells expressing TOP2A but not TOP2B (lanes 11–12 vs. 8–9 Figure 5B). Likewise, DOX-induced DSB were reduced by TET-mediated TOP2A removal in cells expressing TOP2B (lanes 5–6 vs. 2–3 in Figure 5B). These results demonstrated that both TOP2 isoforms mediated DOX-induced DSB.We then assessed the effect of DRZ on the DOX-induced DSB formation mediated by each TOP2 isoform. The formation of DOX-induced DSB in HTETOP cells depleted of TOP2A by TET was reduced by DRZ (lanes 8–9 vs. 5–6 in Figure 5C). This was accompanied by TOP2B depletion and it was consistent with the involvement of TOP2B in DOX-induced DNA damage. The effect of DRZ on DOX-induced and TOP2A-mediated DSB was assessed in HTETOP cells depleted of TOB2B by means of siRNA (Figure 5D). The level of DOX-induced DSB in these cells was further reduced by DRZ (lanes 6 vs. 3 in Figure 5D), indicating the contribution of TOP2A to the protective effect.How general a phenomenon is the DRZ-triggered TOP2A depletion? DRZ (100 μM, 24 h) reduced the level of TOP2A protein in fibrosarcoma-derived HT1080 (Figure 6A), but neither in lung cancer-derived NYH cells (Figure 6B), nor in human embryonic cells HEK293 (Figure 6C). In contrast, DRZ depleted both Top2a and Top2b in a time – and concentration-dependent manner from differentiated H9C2 cells, which re-express TOP2A following the addition of fresh serum (Figure 6D).