Different actions of endothelin-1 on chemokine production in rat cultured
astrocytes: reduction of CX3CL1/fractalkine and an increase in CCL2/MCP-1 and
CXCL1/CINC-1
Chemokines are involved in many pathological responses of the brain.
Astrocytes produce various chemokines in brain disorders, but little is
known about the factors that regulate astrocytic chemokine production.
Endothelins (ETs) have been shown to regulate astrocytic functions through
ETB receptors. In this study, the effects of ETs on chemokine
production were examined in rat cerebral cultured astrocytes.
Methods
Astrocytes were prepared from the cerebra of one- to two-day-old Wistar rats
and cultured in serum-containing medium. After serum-starvation for 48
hours, astrocytes were treated with ETs. Total RNA was extracted using an
acid-phenol method and expression of chemokine mRNAs was determined by
quantitative RT-PCR. The release of chemokines was measured by ELISA.
Results
Treatment of cultured astrocytes with ET-1 and Ala1,3,11,15-ET-1,
an ETB agonist, increased mRNA levels of CCL2/MCP1 and
CXCL1/CINC-1. In contrast, CX3CL1/fractalkine mRNA expression decreased in
the presence of ET-1 and Ala1,3,11,15-ET-1. The effect of ET-1 on
chemokine mRNA expression was inhibited by BQ788, an ETB
antagonist. ET-1 increased CCL2 and CXCL1 release from cultured astrocytes,
but decreased that of CX3CL1. The increase in CCL2 and CXCL1 expression by
ET-1 was inhibited by actinomycin D, pyrrolidine dithiocarbamate, SN50,
mithramycin, SB203580 and SP600125. The decrease in CX3CL1 expression by
ET-1 was inhibited by cycloheximide, Ca2+ chelation and
staurosporine.
Conclusion
These findings suggest that ETs are one of the factors regulating astrocytic
chemokine production. Astrocyte-derived chemokines are involved in
pathophysiological responses of neurons and microglia. Therefore, the
ET-induced alterations of astrocytic chemokine production are of
pathophysiological significance in damaged brains.
The online version of this article (doi:10.1186/1742-2094-10-51) contains supplementary material, which is available to authorized users.
Competing interests
The authors declare they have no competing interests.
Authors’ contributions
YK and MS participated in the design of this study and the preparation of the
manuscript. YK, MK, TS, MK and RK preformed the research work. All authors read and
approved the final manuscript.
Chemokines were originally identified as a family of small proteins having
chemoattractive activities on inflammatory cells. Various chemokines are
constitutively or inducibly expressed in the brain and are involved in physiological
or pathological nerve functions [1, 2]. In brain ischemia, head trauma and neurodegenerative diseases, the
expression of brain chemokines is altered, which modulates neuroinflammation and the
repair process of damaged nerve tissues [3]. Astrocytes are one of the chemokine-producing cells in the brain.
Immunohistochemical observations on damaged nerve tissues showed that production of
brain chemokines, including CCL2/monocyte chemoattractant protein-1 (MCP-1) and
CXCL1/cytokine-induced neutrophil chemoattractant-1 (CINC-1), increased in
astrocytes [4‐6]. Astrocyte-derived chemokines act on brain microvascular endothelial
cells. The chemokine-induced functional changes of vascular endothelial cells
promote infiltration of inflammatory cells and neovascularization at the damaged
areas. In addition to vascular endothelial cells, expression of chemokine receptors
in normal and pathological brains were shown in neurons, astrocytes and microglia [1], suggesting that the function of these brain cells is also regulated by
chemokines. During brain injury, the production of astrocyte-derived extracellular
signal molecules affects the viability of damaged neurons and the repair of nerve
tissues [7]. Studies in cultured neurons showed that some types of chemokines had a
protective effect against neuronal damage, while other types were detrimental [8‐12]. In brain disorders, microglia become activated. Astrocytes are also
involved in the regulation of microglial activation by releasing signal molecules [7]. Microglial activation is accompanied by the enhancement of microglial
function, including phagocytosis, migration and pro-inflammatory cytokine
production. In vitro and in vivo studies showed that these
microglial functions are modulated by certain chemokines [13‐19]. From the various actions of brain chemokines, important roles of
astrocytic chemokine production in neuroinflammation and the tissue repair process
after brain injury are proposed. However, the regulatory mechanisms of chemokine
production in astrocytes are not fully understood.
Endothelins (ETs), a vasoconstrictor peptide family, are present in the brain. The
production of brain ETs is increased in various brain disorders. Increases in brain
ETs are involved in the pathophysiological responses of nerve tissues [20‐22]. Receptors for ETs are classified as ETA or ETB
types. In the brain, high expression of ETB receptors was observed in
astrocytes [23, 24]. ETs have been shown to regulate the function of astrocytes through
ETB receptors. In animal brain injury models, ETB
antagonists reduced astrocytic proliferation [25, 26], indicating that ETB receptors are involved in the induction
of astrogliosis. Activation of ETB receptors was shown to induce the
production of several signaling molecules, such as neurotrophic factors and
cytokines, in cultured astrocytes and in the rat brain [27]. These findings suggest that ETs regulate the pathophysiological response
of the damaged brain by modulating the production of astrocytic signaling molecules.
As for the production of chemokines in the brain, we previously showed that
administration of an ETB agonist increased CCL2 and CXCL1 production in
the adult rat brain [28]. In this study, to clarify the role of ETB receptors in
astrocytic chemokine production, the effect of ETs on chemokine expression in rat
cultured astrocytes was examined.
Anzeige
Methods
Preparation of rat primary cultured astrocytes
All experimental protocols conformed to the Guiding Principles for the Care and
Use of Animals of the Japanese Pharmacological Society and were approved by the
Animal Experiment Committee of Osaka Ohtani University. Astrocytes were prepared
from the cerebra of one- to two-day-old Wistar rats as described previously [29]. The isolated cells were seeded at 1 × 104
cells/cm2 in 75-cm2 culture flasks and grown in
minimal essential medium (MEM) supplemented with 10% fetal calf serum. To remove
small process-bearing cells (mainly oligodendrocyte progenitors and microglia
from the protoplasmic cell layer), the culture flasks were shaken at 250 rpm
overnight, 10 to 14 days after seeding. The monolayer cells were trypsinized and
seeded on six-well culture plates. Astrocytes were identified by
immunocytochemical observations of glial fibrillary acidic protein (GFAP), an
astrocytic marker protein. At this stage, approximately 95% of cells showed
immunoreactivity for GFAP. Cultured neurons and microglia were prepared from the
rat cerebrum according to previously described methods [29].
Treatment with ETs and the other drugs
Before treatment with ETs and other drugs, astrocytes in six-well culture plates
were cultured in serum-free MEM for 48 hours. ET-1 and
Ala1,3,11,15-ET-1 were dissolved in distilled H2O to make
stock solutions. ET antagonists and signal transduction inhibitors were
dissolved in dimethyl sulfoxide (DMSO). Treatments of cultured astrocytes with
ETs and other drugs were started by addition of the stock solutions to
serum-free MEM. As a control for treatments with ET antagonists and signal
transduction inhibitors, equal volumes of DMSO were included in the medium.
Measurement of chemokine mRNA levels by quantitative RT-PCR
Total RNA was extracted using an acid-phenol method as described previously [29]. First-strand cDNA was synthesized from total RNA (1 μg) using
MMLV reverse transcriptase (200 U; Invitrogen, Carlsbad, CA, USA), random
hexanucleotides (0.2 μg; Invitrogen) and an RNase inhibitor (20 U; Takara,
Tokyo, Japan) in 10 μL of buffer supplied by the enzyme manufacturer. The
mRNA levels of chemokines in each sample were determined by quantitative PCR
using SYBR Green fluorescent probes. Each reverse transcription product was
added to the SYBR Green Master Mix (Toyobo, Tokyo, Japan) along with the primer
pairs, and the mixture was placed in a thermal cycler (Opticom 2; MJ Research,
Waltham, MA, USA). The following primer pairs were used:
CCL2,
5′-TTCACTGGCAAGATGATCCC-3′ and
5′-TGCTTGAGGTGGTTGTGGAA-3′;
CXCL1,
5′- GAAGATAGATTGCACCGATG -3′ and 5′-
CATAGCCTCTCACACATTTC-3′;
CCL5/RANTES,
5′-CACCGTCATCCTCGTTGC-3′ and
5′-CACTTGGCGGTTCCTTCG-3′;
CX3CL1/fractalkine,
5′- GAATTCCTGGCGGGTCAGCACCTCGGCATA-3′ and
5′-AAGCTTTTACAGGGCAGCCGTCTGGTGGT-3′
CXCL12/ stromal cell-derived factor-1 (SDF-1),
5′-TTGCCAGCACAAAGACACTCC-3′ and
5′-CTCCAAAGCAAACCGAATACAG-3′;
5′-CTCATGACCACAGTCCATGC-3′ and
5′-TACATTGGGGGTAGGAACAC-3′.
As a standard for the copy number of PCR products, serial dilutions of each
amplicon were amplified in the same manner. The amount of cDNA was calculated as
the copy number of each reverse-transcription product equivalent to 1 μg of
total RNA and normalized to the value for G3PDH.
Anzeige
Determination of chemokine proteins
Serum-starved astrocytes in six-well plates were treated with ET-1 and the
culture medium collected. The level of immunoreactive chemokines in the culture
media were determined using an ELISA kit for rat CCL2 (Biosource, Camarillo, CA,
USA), CXCL1 (Immuno-Biological Laboratories, Gunma, Japan,) and CX3CL1
(RayBiotech, Norcross, GA, USA) according to the manufacturers’ protocols.
The protein content in each well was determined with a BCA protein assay kit
(Pierce, Rockford, IL, USA).
Results
Effect of ETs on chemokine production in cultured astrocytes
In the adult rat brain, the mRNA of CCL2, CXCL1, CCL5/RANTES, CX3CL1/fractalkine
and CXCL12/SDF-1 has been previously detected [4, 6, 30‐32]. These chemokines are produced by different brain cells, including
neurons, microglia and astrocytes [3]. Thus, at first, copy numbers of these chemokine mRNAs in cultured
neurons, microglia and astrocytes were determined. Copy numbers of CCL2 and
CXCL1 in non-stimulated cultured astrocytes were 10 to 50 times higher than
those in neurons and microglia (Table 1). Expression
of CX3CL1 was high in neurons and astrocytes. Copy numbers of CXCL12 and RANTES
were of similar level among these cells.
Table 1
Comparison of chemokine mRNA copy numbers in neurons, astrocytes and
microglia derived from the rat cerebrum
mRNA copy number
(× 103/μg total RNA)
Neuron
Astrocyte
Microglia
CCL2/MCP-1
189.9 ± 9.8
3050.8 ± 521.5
148.9 ± 31.6
CCL5/RANTES
10.3 ± 0.7
52.5 ± 18.7
4.3 ± 2.2
CXCL1/CINC-1
22.0 ± 2.2
1410.0 ± 266.9
34.4 ± 18.1
CXCL12/SDF-1α
92.1 ± 4.0
255.4 ± 45.7
29.1 ± 13.6
CX3CL1/fractalkine
1,118.1 ± 108.4
1,721.0 ± 303.5
23.4 ± 6.6
G3PDH
40,081.9 ± 7,335.2
46,575.5 ± 6,274.4
48,586.5 ± 5,733.6
Cultured neurons, astrocytes and microglia were prepared from the
cerebra of Wistar rats and total RNA was extracted. The copy numbers
of chemokine mRNA were determined by quantitative RT-PCR. The copy
numbers of G3PDH mRNA in the same samples were also determined as an
internal standard. Data are the mean ± SEM of 6 to 10 different
preparations presented as ×103 copy numbers/μg
total RNA. G3PDH, glyceraldehyde-3-phosphate dehydrogenase; SEM,
standard error of the mean.
Treatment of cultured astrocytes with 100 nM ET-1 increased mRNA levels of CCL2
and CXCL1, where the maximum increase was observed in one hour
(Figure 1A). In contrast, CX3CL1 mRNA decreased
following ET-1 exposure to approximately 40% of levels observed in non-treated
cells in six hours. ET-1 did not affect mRNA levels of CCL5 and CXCL12. The
effect of ET-1 on CCL2 and CXCL1 mRNA levels was dose-dependent and a
significant increase was observed at 10 nM (Figure 1B). The ET-induced decrease in astrocytic CX3CL1 mRNA was significant
at 10 nM. Treatment with 100 nM Ala1,3,11,15-ET-1, a selective
ETB agonist, also increased CCL2 and CXCL1 mRNA levels in
cultured astrocytes, while it decreased CX3CL1 mRNA (Figure 2). Increases in CCL2 and CXCL1 mRNA by ET-1 were inhibited by 1
μM BQ788, an ETB antagonist (Figure 3). BQ788 also inhibited the ET-induced decrease in CX3CL1 mRNA.
FR139317 (1 μM), an ETA antagonist, did not inhibit the effects
of ET-1 on astrocytic CCL2, CXCL1 and CX3CL1 mRNA levels. The effects of ET-1 on
chemokine release from cultured astrocytes were examined. Treatment with 100 nM
ET-1 for 1.5 to 3 hours increased the release of CCL2 and CXCL1 protein in the
culture medium, while release of CX3CL1 protein into the culture medium
decreased in the presence of ET-1 (Figure 4).
Figure 1
Effect of ET-1 on chemokine mRNA expression in cultured rat
astrocytes. (A) Serum-starved astrocytes were treated
with 100 nM ET-1 for the times indicated. The expression of CCL2, CXCL1,
CCL5, CXCL12 and CX3CL1 mRNA was normalized to G3PDH and expressed as
the % of 0 hour. Data are the mean ± SEM of 6 to 16 experiments.
*P <0.05 and **P <0.01 versus 0
hour by one-way ANOVA followed by Dunnett’s test. (B)
Astrocytes were treated with the indicated concentrations of ET-1 for
one (CCL2 and CXCL1) or six (CX3CL1) hours. Data are the mean ± SEM
of five to eight experiments. *P <0.05 and **P
<0.01 versus none by one-way ANOVA followed by
Dunnett’s test. ANOVA, analysis of variance; ET-1, endothelin-1;
G3PDH, glyceraldehyde-3-phosphate dehydrogenase; SEM, standard error of
the mean.
Figure 2
Effects of Ala1,3,11,15-ET-1 on CCL2, CXCL1
and CX3CL1 mRNA expression in cultured rat astrocytes.
Serum-starved astrocytes were treated with 100 nM
Ala1,3,11,15-ET-1 for the times indicated. The expression
of CCL2, CXCL1 and CX3CL1 mRNA was normalized to G3PDH and expressed as
the % of 0 hour. Data are expressed as the mean ± SEM of 4 to 14
experiments. *P <0.05 versus 0 hour by one-way
ANOVA followed by Dunnett’s test. ANOVA, analysis of variance;
ET-1, endothelin-1; G3PDH, glyceraldehyde-3-phosphate dehydrogenase;
SEM, standard error of the mean.
Figure 3
Effects of ET receptor antagonists on ET-induced changes in CCL2,
CXCL1 and CX3CL1 mRNA levels. Serum-starved astrocytes were
treated with 10 nM ET-1 for one (CCL2 and CXCL1) or six (CX3CL1)
hours. BQ788 (1 μM) or FR139317 (1 μM) was added to
the medium 30 minutes before treatment with ET-1. The expression of
CCL2, CXCL1 and CX3CL1 mRNA was normalized to G3PDH and expressed as the
% of no treatment cultures. Data are the mean ± SEM of five to nine
experiments. *P <0.05, **P <0.01 versus no ET-1,
#P <0.05, ##P <0.01
versus ET-1 with no antagonist by one-way ANOVA followed by
Fisher’s PLSD test. ANOVA, analysis of variance; ET, endothelin;
G3PDH, glyceraldehyde-3-phosphate dehydrogenase; NS, not significant;
PLSD, protected least significant difference; SEM, standard error of the
mean.
Figure 4
Effect of ET-1 on immunoreactive CCL2, CXCL1 and CX3CL1 released from
cultured astrocytes. Astrocytes were cultured in serum-free MEM
in the absence or presence of 100 nM ET-1 for the times indicated.
Concentrations of immunoreactive CCL2, CXCL1 and CX3CL1 in the culture
medium were measured by ELISA. Results are the mean ± SEM of six to
eight experiments. *P <0.05, **P <0.01
versus no ET-1 by one-way ANOVA followed by Fisher’s
PLSD test. ANOVA, analysis of variance; ET, endothelin; MEM, minimal
essential medium; PLSD, protected least significant difference; SEM,
standard error of the mean.
×
×
×
×
Effects of signal transduction inhibitors on the ET-induced alterations of
chemokine production
The expression of the mRNAs of several chemokines is regulated by transcriptional
mechanisms and alterations of mRNA stability. Involvement of transcriptional
mechanisms in the ET-induced alterations of astrocytic chemokine production were
examined by using actinomycin D, a transcription inhibitor. Actinomycin D (1
μg/mL) gradually decreased basal expressions of CCL2 and CXCL1 mRNAs in the
treatments up to 60 minutes, although the effects were not statistically
significant (Figure 5A and B). In the presence of
actinomycin D, ET-1 did not increase astrocytic CCL2 and CXCL1 mRNAs
(Figure 5A and B). On the other hand, the
ET-induced decrease in CX3CL1 expression was not affected by actinomycin D
(Figure 5A and B). Cycloheximide (10 μg/mL),
a protein synthesis inhibitor, had no effect on ET-induced CCL2 and CXCL1
expression, but prevented the decrease in CX3CL1 expression (Figure 5A).
Figure 5
Effects of actinomycin D and cycloheximide on ET-induced changes in
CCL2, CXCL1 and CX3CL1 mRNA levels. (A) Serum-starved
astrocytes were treated with 100 nM ET-1 for one (CCL2 and CXCL1) or six
(CX3CL1) hours. Actinomycin D (Act-D, 1 μg/mL) or
cycloheximide (CHX, 10 μg/mL) was added to the medium 30 minutes
before treatment with ET-1. The expression of CCL2, CXCL1 and CX3CL1
mRNA was normalized to G3PDH and expressed as the % of no treatment
cultures. Data are the mean ± SEM of 8 to 15 experiments.
*P <0.05, **P <0.01 versus no ET-1,
##P <0.01 versus no inhibitor by
one-way ANOVA followed by Fisher’s PLSD test. NS, not significant.
(B) Effects of ET-1 on CCL2, CXCL1 and CX3CL1 mRNA
expressions in the presence of actinomycin D. Cultured astrocytes were
treated with ( open circle) or without (closed circle) 100 nM ET-1 for
the time indicated in the presence of 1 μg/mL actinomycin D.
Actinomycin D was included in the medium 30 minutes before treatment
with ET-1. Data are the mean ± SEM of six experiments. *P
<0.05 versus control by one-way ANOVA followed by
Fisher’s PLSD test. ANOVA, analysis of variance; ET-1,
endothelin-1; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; PLSD,
protected least significant difference; SEM, standard error of the
mean.
×
ETB receptors belong to Gq-protein coupled receptors. Activation of
astrocytic ETB receptors induces an increase in cytosolic
Ca2+ and activation of protein kinase C (PKC) and
mitogen-activated protein (MAP) kinases [25, 33‐35]. Ca2+ chelation (a combination of 0.5 mM ethylene glycol
tetraacetic acid (EGTA) and 30 μM 1,2-bis(2-aminophenoxy)ethane
N,N,N',N'-tetraacetic acid acetoxymethyl ester. (BAPTA/AM)) and PKC inhibition
(staurosporine, 10 nM) did not affect ET-induced CCL2 and CXCL1 mRNA expression
(Table 2). On the other hand, the decrease in
CX3CL1 expression was inhibited by Ca2+ chelation and staurosporine.
The inhibition by staurosporine was BAPTA/AM dose-dependent, where a significant
effect was obtained at 10 nM (Figure 6). SB203580 (a
p38 inhibitor) and SP600125 (a JNK inhibitor) inhibited the effect of ET-1 on
CCL2 and CXCL1 expression in a dose-dependent manner, but PD98059 (an ERK
inhibitor, 50 μM) had no effect (Table 2 and
Figure 6). The ET-induced decrease in CX3CL1
expression was not affected by these MAP kinase inhibitors (Table 2). Pyrrolidine dithiocarbamate (PDTC, 100 μM) and SN50
(10 μM), which inhibits the transcriptional activities of nuclear
factor-kappaB (NFκB), reduced ET-induced CCL2 and CXCL1 expressions, while
these inhibitors did not alter the effects of ET-1 on CX3CL1 expression
(Table 2 and Figure 6). Mithramycin (500 nM), an inhibitor of transcription factor SP1,
diminished ET-induced CCL2 and CXCL1 expression, but had no effect on the
decrease of CX3CL1 expression (Table 2 and
Figure 6). At the highest concentrations used,
these signal transduction inhibitors did not largely affect basal expressions of
astrocytic CCL2, CXCL1 and CX3CL1 mRNAs [see Additional file 1].
Figure 6
Dose-dependent inhibition of ET-induced changes in CCL2, CXCL1 and
CX3CL1 mRNA levels by signal transduction inhibitors.
Serum-starved astrocytes were treated with 100 nM ET-1 for one (CCL2 and
CXCL1) or six (CX3CL1) hours. Different concentrations of signal
transduction inhibitors (SN50, mithramycin, SB203580, SP600125 and
staurosporine) were included in the medium 30 minutes before treatment
with ET-1. The expression of CCL2, CXCL1 and CX3CL1 mRNA was normalized
to G3PDH and expressed as the % of no treatment cultures. Data are the
mean ± SEM of 6 to 12 experiments. *P <0.05,
**P <0.01 versus no treatment,
#P <0.05, ##P <0.01
versus ET-1 with no inhibitor by one-way ANOVA followed by
Fisher’s PLSD test. ANOVA, analysis of variance; ET, endothelin;
G3PDH, glyceraldehyde-3-phosphate dehydrogenase; PLSD, protected least
significant difference; SEM, standard error of the mean.
×
Table 2
Effect of signal transduction inhibitors on ET-induced expression of
CCL2, CXCL1 and CX3CL1 mRNA
Ratio of chemokine to G3PDH mRNA copy number
(% of no treatment)
CCL2/MCP-1
CXCL1/CINC-1
CX3CL1/fractalkine
no treatment
100.0 ± 31.4 (20)
100.0 ± 22.0 (20)
100.0 ± 17.5 (24)
100 nM ET-1
313.8 ± 65.1 (20)a
404.7 ± 63.9 (20)a
37.5 ± 8.5 (23)a
+ 30 μM BAPTA/0.5 mM EGTA
307.4 ± 89.0 (7)
342.7 ± 65.0 (7)
122.8 ± 25.2 (9)b
+ 10 nM staurosporine
444.8 ± 122.3 (6)
385.4 ± 79.0 (6)
108.6 ± 25.6 (4)b
+ 100 μM PDTC
129.2 ± 16.5 (12)b
140.2 ± 20.7 (12)b
42.5 ± 8.8 (18)
+ 10 μM SN50
188.7 ± 64.3(8)b
136.1 ± 22.6 (8)b
54.6 ± 23.9 (11)
+ 500 nM mithramycin
37.8 ± 9.2 (8)c
49.8 ± 24.1 (8)c
36.3 ± 11.7 (10)
+ 50 μM PD98059
277.4 ± 90.7 (12)
360.2 ± 103.2 (12)
49.6 ± 7.2 (10)
+ 20 μM SB203580
118.3 ± 36.9 (13)c
229.1 ± 73.6 (13)b
37.1 ± 6.3 (20)
+ 1 μM SP600125
110.2 ± 23.6 (8)b
188.5 ± 22.5 (8)b
47.1 ± 22.0 (10)
aP <0.01 versus no treatment, bP <0.05, cP <0.01, versus 100 nM ET-1 by one-way ANOVA
followed by Fisher’s PLSD test. Astrocytes were treated with
100 nM ET-1 in the presence of the signal transduction inhibitors
indicated. Total RNA was extracted at one hour (for CCL2 and CXCL1)
or six hours (for CX3CL1) after the addition of ET-1. The inhibitors
were included in the serum-free medium for 30 minutes before the
addition of ET-1. The copy numbers of CCL2, CXCL1 and CX3CL1 mRNA
was normalized to G3PDH. Results are the mean ± SEM and the
numbers of experiments are indicated in parentheses. ANOVA, analysis
of variance; BAPTA/AM, 1,2-bis(2-aminophenoxy)ethane
N,N,N',N'-tetraacetic acid acetoxymethyl ester; ET, endothelin;
G3PDH, glyceraldehyde-3-phosphate dehydrogenase; PDCT, pyrrolidine
dithiocarbamate; PLSD, protected least significant difference; SEM,
standard error of the mean.
Discussion
ETs increase astrocytic CCL2 and CXCL1 production
Various chemokines, including CCL2, CXCL1, CCL5, CXCL12 and CX3CL1, are
constitutively or inducibly expressed in the adult brain. A comparison of these
chemokine mRNA levels in cultured neurons, microglia and astrocytes
(Table 1) revealed higher expression of CCL2 and
CXCL1 in astrocytes. The higher expression of CCL2 and CXCL1 in cultured
astrocytes is in agreement with the observation that astrocytes are the main
source of these chemokines [3]. We previously showed that intracerebroventricular administration of
an ETB agonist increased CCL2 and CXCL1 production in rat cerebral
astrocytes [28]. In this study, treatment with ETs stimulated the production and
release of CCL2 and CXCL1 in cultured astrocytes (Figures 1 and 4). The effect of ET receptor agonist
and antagonists showed that the actions of ET-1 were mediated by ETB
receptors (Figures 2 and 3).
From these findings, activation of astrocytic ETB receptors is
thought to stimulate CCL2 and CXCL1 production directly. Increased production of
astrocytic CCL2 and CXCL1 was observed in nerve tissue damaged by brain ischemia
and neurodegenerative diseases [4, 6, 36, 37]. Brain ETs have been shown to be increased in several brain
pathologies and regulate several pathophysiological responses of astrocytes,
including the production of extracellular signaling molecules, through
ETB receptors [27]. Thus, the ET-induced chemokine production in cultured astrocytes
suggests that ETs are one of the factors to stimulate CCL2 and CXCL1 production
at the damaged nerve area.
ETs decrease astrocytic CX3CL1 production
Differing from CCL2 and CXCL1, production of astrocytic CX3CL1 decreased
following treatment with ETs (Figures 1 and 4), which was also mediated by ETB receptors
(Figures 2 and 3). CX3CL1
is relatively abundant in the brain, where sub-populations of neurons
constitutively express the protein [1]. We found that cultured astrocytes had a comparably high level of
CX3CL1 when compared to cerebral neurons (Table 1).
As for the regulation of astrocytic CX3CL1, pro-inflammatory cytokines, such as
tumor necrosis factor alpha (TNFα) and IFN-γ, stimulate its production
in cultured astrocytes [38]. On the other hand, a negative-regulatory mechanism of constitutive
CX3CL1 production was suggested by the finding that basal CX3CL1 production in
human astrocytomas was reduced by tumor growth factor beta (TGFβ) [18]. The effects of ETs on CX3CL1 production indicate an involvement of
ETB receptors in the negative-regulation of astrocytic CX3CL1
production. Recently, Donnelly et al. [39] showed that expression of CX3CL1 decreased after spinal cord injury
in mice, although its cellular sources were not identified. Thus, the negative
regulation of astrocytic CX3CL1 by ETs may reflect the reduced CX3CL1 expression
in damaged nerve tissues.
Signal transduction mechanisms mediating the ET-induced chemokine
production
Activation of astrocytic ETB receptors stimulates several
intracellular signal pathways, including PKC, intracellular Ca2+, and
MAP kinases. The effects of ET-1 on astrocytic chemokine production were
significant at 10 to 100 nM (Figure 1B), which
concentrations of ET-1 activated signal mechanisms mediated by PKC,
Ca2+ and MAP kinases [25, 33‐35]. The effects of signal transduction inhibitors (Table 2 and Figure 5) showed that
different mechanisms mediate ETB receptor signals to regulate
astrocytic chemokine expression. In addition to the regulation of gene
transcription, expression levels of CCL2, CXCL1 and CX3CL1 mRNA can be regulated
by alteration of their stabilities [40‐43]. The effect of ET-1 on CCL2 and CXCL1 mRNA expression was inhibited
by actinomycin D (Figure 5A). Further examination
showed that treatments with ET-1 did not affect the degradation rates of
astrocytic CCL2 and CXCL1 mRNAs (Figure 5B). These
results suggest that stimulation of transcription, rather than increases in mRNA
stability, underlie ET-induced astrocytic CCL2 and CXCL1 expression. Both rat
CCL2 and CXCL1 genes have recognition sequences for NFκB and SP1 on the
5′-promotor regions. Through these recognition sites, transcription of
CCL2 and CXCL1 are cooperatively stimulated by NFκB and SP1 [44‐47]. Agreeing with these findings, the inhibition of astrocytic CCL2 and
CXCL1 expression by PDTC, SN50 and mithramycin suggests the involvement of both
NFκB and SP1 in the effect of ET-1. MAP kinases, that is, ERK, JNK and p38,
regulate the transcription activities of NFκB and SP1 in signal
transduction pathways under several receptors. In astrocytes, activation of JNK
and p38 was reported to stimulate NFκB [48, 49]. We also found that ET-induced activation (phosphorylation) of SP1
was reduced by SP600125 in cultured astrocytes [see Additional file 2]. Thus, the inhibition of ET-induced CCL2 and CXCL1
expression by SP600125 and SB203580 may indicate that JNK and p38 mediate ET
receptor signals to NFκB and SP1.
Anzeige
Differing from the effects on CCL2 and CXCL1 expression, the ET-induced decrease
in CX3CL1 mRNA was inhibited by cycloheximide (Figure 5A). This result indicates a requirement of protein de novo
synthesis for the effect of ETs on fractalkine expression. Moreover,
Ca2+ chelation and PKC inhibition, but not MAP kinase inhibition,
prevented the effects of ET-1. Rat CX3CL1 mRNA has AU-rich elements in the
3′ regions, where many regulatory proteins affecting mRNA stability bind [42]. As is reported in the regulatory mechanisms of some inflammatory
factors [50], ET may stimulate the induction of regulatory proteins that
destabilize CX3CL1 mRNA through Ca2+- and PKC-dependent signals.
Pathophysiological significance of the ET-induced changes in astrocytic
chemokine production
In nerve tissues damaged by brain insults and neurodegenerative diseases,
astrocytes undergo a phenotypic change to reactive astrocytes and alter their
ability to produce various chemokines [7]. By altering the production of astrocyte-derived chemokines, the
pathophysiological response of the damaged brain is modulated. In brain
pathologies, brain ETs increase in damaged tissues, which activate astrocytic
ETB receptors and induce reactive astrocytosis [25, 26]. Accompanied with the conversion to reactive astrocytes, ETs modulate
the production of various extracellular signaling molecules [27]. A major finding of the present study is that ETs had different
actions on astrocytic chemokine production: ETs increased CCL2 and CXCL1, but
decreased CX3CL1 production (Figures 1 and 4). The reciprocal regulation of astrocyte-derived
chemokines would result in the possible modulation of chemokine-induced
pathological brain responses by ETs. In the brain, receptors for CCL2, CXCL1 and
CX3CL1 are expressed in vascular endothelial cells, neurons and microglia [1]. CCL2, CXCL1 and CX3CL1 all stimulate the proliferation and migration
of vascular endothelial cells [51‐53], which indicates that these chemokines have similar actions on
neovascularization after brain injuries. The function of these chemokines on
neuronal cells is controversial. While CX3CL1 showed a neuroprotective effect [9, 11], CCL2 and CXCL1 were reported to be detrimental [8] or protective [10, 12] on neuronal cells. Thus, the possible significance of ET-induced
astrocytic chemokine production would be difficult to discuss in view of the
function of neurons and vascular endothelial cells.
On the other hand, the action of CX3CL1 opposes that of CCL2 and CXCL1 in the
regulation of microglial function. CCL2 and CXCL1 caused the activation of
cultured microglia and stimulated the production of proinflammatory molecules [19, 54]. Inhibition of CCL2 signals attenuated microglial activation and
pro-inflammatory cytokine production in animal models of brain injury [19, 55]. Pro-inflammatory cytokine production and migration in cultured
microglia were stimulated by CXCL8/IL-8, a human homologue of rat CXCL1 [14, 15]. In contrast, CX3CL1 attenuated microglial activation and
proinflammatory cytokine production in vitro and in vivo[16, 17]. Mice lacking CX3CL1 receptors showed enhanced activation of
microglia in response to lipopolysaccharide [13], indicating a repressive role of CX3CL1 in microglial function.
Considering the different actions among CCL2, CXCL1 and CX3CL1 on microglia, the
reciprocal regulation of astrocytic chemokine production by ETs may have a
pathophysiological significance in the induction of activated microglia.
Induction of activated microglia promotes the neuroinflammatory response and
results in the aggravation of neuronal degradation. Thus, the increase in ETs
after brain insults and neurodegenerative diseases may show a detrimental action
on the damaged brain through microglial activation induced by altered astrocytic
chemokine production.
Conclusions
In this study, activation of ETB receptors altered the production of CCL2,
CXCL1 and CX3CL1 in cultured astrocytes. Because astrocytes are a main source of
brain chemokines in neurological disorders, alterations of astrocytic chemokine
production affect several responses of the damaged brain. Thus, ET-induced
alterations of astrocytic chemokine production indicate a pathophysiological
significance of astrocytic ETB receptors.
Anzeige
Acknowledgments
This work was supported by a Grant-in-Aid for Scientific Research (C) from the
JPSP (21590108).
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons
Attribution License (http://creativecommons.org/licenses/by/2.0), which
permits unrestricted use, distribution, and reproduction in any medium, provided the
original work is properly cited.
Competing interests
The authors declare they have no competing interests.
Authors’ contributions
YK and MS participated in the design of this study and the preparation of the
manuscript. YK, MK, TS, MK and RK preformed the research work. All authors read and
approved the final manuscript.
Different actions of endothelin-1 on chemokine production in rat cultured astrocytes: reduction of CX3CL1/fractalkine and an increase in CCL2/MCP-1 and CXCL1/CINC-1
Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.
Ist die Tau-Last noch gering, scheint der Vorteil von Lecanemab besonders groß zu sein. Und beginnen Erkrankte verzögert mit der Behandlung, erreichen sie nicht mehr die kognitive Leistung wie bei einem früheren Start. Darauf deuten neue Analysen der Phase-3-Studie Clarity AD.
Neue arznei- und zellbasierte Ansätze, Frühdiagnose mit Bewegungssensoren, Rückenmarkstimulation gegen Gehblockaden – in der Parkinsonforschung tut sich einiges. Auf dem Deutschen Parkinsonkongress ging es auch viel um technische Innovationen.
Wenn Demenzkranke aufgrund von Symptomen wie Agitation oder Aggressivität mit Antipsychotika behandelt werden, sind damit offenbar noch mehr Risiken verbunden als bislang angenommen.
