Introduction
Diffuse large B cell lymphoma (DLBCL), the most common subtype of non-Hodgkin lymphoma (NHL) with aggressive property could be divided into three subgroups based on gene expression profile: germinal centre B cell-like DLBCL (GCB-DLBCL), activated B cell-like DLBCL (ABC-DLBCL) and primary mediastinal B cell lymphoma [
1,
2]. R-CHOP, a combination of rituximab plus chemotherapy including cyclophosphamide, doxorubicin, vincristine and prednisolone, has been established as the first-line treatment for DLBCL, but approximately 30–40% of patients still become primary and secondary resistant to these drugs [
3,
4]. So there is an urgent demand for the novel target therapy, which could provide alternatives for the treatment of individuals with recurrent or refractory disease.
B cell antigen receptor (BCR) signaling pathway has been recognized essential for the development of normal B cell and pathogenesis of B cell malignancies [
5‐
8]. Bruton tyrosine kinase (Btk), a crucial regulator within the BCR signaling pathway, belongs to non-receptor tyrosine kinase of Tec family that expressed in many hematopoietic lineages [
9]. After antigen binding to BCR complex, Btk translocates from cytoplasm to membrane, clocking at IPI3 converted from IPI2 by PI3K [
10,
11]. After the phosphorylation at Tyr551 and Tyr223 residues, Btk activates phospholipase C gamma 2 (PLCγ2), which leads to Ca
2+ mobilization and PKC activation [
12,
13]. PKC propagates downstream pathways such as nuclear factor κB (NF-κB) signaling and mitogen-activated protein (MAP) kinases, such as ERK1/2 that regulates cellular survival and apoptotic responses [
14‐
17]. Thus, targeting small molecules within BCR signaling pathway, especially Btk inhibition would be a novel approach for treating B cell lymphomas.
In recent years, several novel agents targeting BCR signaling pathway, especially ibrutinib (PCI-32765), have shown great anti-lymphoma activities in preclinical study and clinical trials [
18‐
20]. Ibrutinib is an irreversible and selective Btk inhibitor, which binds covalently to the target cysteine-481 residue [
21]. In preclinical research, ibrutinib showed its cytotoxicity towards B cell malignancies, including chronic lymphocytic leukemia (CLL) and mantle cell lymphoma (MCL) by preventing Btk auto-phosphorylation [
22,
23]. Furthermore, 60% of patients with relapsed or refractory B cell malignancies achieved an objective response in a phase I open-label clinical trial [
24].
The constitutive activation of NF-κB signaling sustained by chronic BCR pathway plays an essential role in proliferation of ABC-DLBCL cells, which had been demonstrated through shRNA interference experiment [
25‐
27]. Although it is reported that the survival of GCB-DLBCL did not so much rely on activated NF-κB pathway [
27], in our investigation we indeed found that the viability of some GCB-DLBCL cell lines was also inhibited by ibrutinib and different GCB-DLBCL cell lines showed diverse sensitivity.
Discussion
In this experiment we investigated the inhibition effects induced by ibrutinib in GCB-DLBCL cells. Tumor cell proliferation was inhibited by ibrutinib in a dose- and time-dependent manner in both cell lines, but the IC50 value of OCI-LY7 cells was 4.4 times higher than that of SU-DHL-16 cells. SU-DHL-16 cells were more sensitive towards ibrutinib treatment than OCI-Ly7 cells.
Many investigations have shown that the targeted inhibitors of crucial tyrosine kinases in BCR signaling pathway, such as Syk inhibitor PRT060318 and the inhibitor of Src family kinases (SFKs) dasatinib, could prevent the proliferation of GCB-DLBCL cell lines by causing cell-cycle arrest or inducing cell apoptosis [
30,
31]. Our results above also demonstrated that ibrutinib, as an important inhibitor of BCR signal activation and transduction, inhibited proliferation of tumor cells in a dose and time dependent manner.
Herman et al. has demonstrated that ibrutinib could induce apoptosis in CLL cells through caspase-dependent pathway [
22]. Similarly, we also found that ibrutinib could induce a time-dependent apoptosis with the degradation of caspase-3 and cleavage of PARP in SU-DHL-16 but not so much in OCI-Ly7 cells, which confirmed the distinct sensitivity towards ibrutinib treatment between different GCB-DLBCL cell lines.
It is reported that the secretory chemokines CCL3 and CCL4 played an important role in the cross talk between CLL cells and their microenvironment, which promoted the proliferation and metastasis of tumor cells [
28,
29]. Ponader et al. demonstrated that ibrutinib down-regulated the secretion of chemokines CCL3 and CCL4 in CLL cells both in vitro and in vivo [
32]. In our experiment, we also observed that the expression of CCL3 and CCL4 were dramatically decreased after treatment of ibrutinib, but the decreasing degree were much more obviously observed in SU-DHL-16 than that in OCI-Ly7 (
p < 0.05).
Many reported demonstrated that the activation status of downstream kinases related to outcome of the target inhibitor. Yang et al. found that dasatinib induced considerable reduction in the phosphorylation of Syk and PLCγ2 in sensitive cell lines, other than in resistance cell lines [
30]. Phosphorylated-Syk and PLCγ2 might serve as potential biomarkers to predict response to dasatinib treatment. In much the same way, Cheng et al. also found that phosphorylation of PLCγ2 and AKT was reduced in a dose-dependent fashion in sensitive but not resistant cell lines after Syk inhibitor PRT060318 treatment [
31]. Thus, to further investigate the possible mechanisms of different sensitivities towards ibrutinib treatment, the basal level and phosphorylation status of key regulatory enzymes (Btk, PLCγ2 and Erk1/2) of BCR signal pathway were analyzed by western blotting. We examined the phosphorylation of Btk and downstream molecular PLCγ2 and ERK in GCB-DLBCL cells lines before and after ibrutinib treatment. Phosphorylation of Btk and PLCγ2 was similarly inhibited by ibrutinib in both cell lines, but phosphorylation of ERK was dramatically inhibited in SU-DHL-16 cells but not in OCI-Ly7 cells. Therefore, inhibitory level of p-ERK could be an important response predictor to ibrutinib. On the other hand, the distinct genetic background of SU-DHL-16 and OCI-LY7 cells may also contribute to the different sensitivity toward ibrutinib treatment, but the further experiments are needed to investigate the possible mechanisms in detail.
Together, in this study we revealed that ibrutinib inhibited the proliferation of GCB-DLBCL cell lines through down-regulation of BCR signaling pathway and activation of caspase-3. Phosphorylation level of ERK in GCB-DLBCL could be a useful response predictor to ibrutinib.
Materials and methods
Reagents and antibodies
Ibrutinib was purchased from Selleck Chemicals (Houston, TX, USA. Cat No. S2680) and dissolved to a 40 mM stock solution in dimethylsulfoxide (DMSO). Antibodies for phospho-Tyr223-Btk (5082), phospho-ERK1/2 (4370), phospho-Tyr759-PLCγ2 (3874), Btk (8547), ERK1/2 (9102), PLCγ2 (3872) and Caspase-3 (9662) used in western blotting were all purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-PARP antibody was obtained from BD Pharmigen (Cat No.556362, BD Pharmigen, San Jose, California, USA). β-actin used as an internal control for western blotting was generated by Sigma-Aldrich (Cat No. A5441, Sigma-Aldrich, St. Louis, MO, USA). HRP-conjugated anti-rabbit IgG (Cat No.458) and HRP-conjugated anti-mouse IgG (Cat No.330) were purchased from MBL (MBL International Corporation, Nagoya, Aichi-ken, Japan).
Cell lines and culture conditions
The non-Hodgkin lymphoma cell lines SU-DHL-16, OCI-Ly3 and OCI-Ly7 were obtained from Professor Fu Kai in University of Nebraska Medical Center. The SU-DHL-16 and OCI-Ly7 cell lines possess t(14;18)(q32;q21) and t(8;14)(q24;q32) translocation, respectively. These cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen, Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Life Technologies), L-glutamine and penicillin–streptomycin in humidified 5% CO2 at 37°C.
Cell viability assay
In vitro cytotoxicity assays were performed by Cell Titer-Glo Luminescent Cell Viability Assay (Cat No. G7572, Promega Corporation, Madison, WI, USA). Cell lines were plated in opaque-walled 96-well plates at a density of 1 × 105/ml and incubated with various concentrations of ibrutinib for 24 hours. Then, 20 μL of the assay reagent was added to each well, and the cell lysates were incubated on an orbital shaker at room temperature for 10 minutes. Luminescent signal was measured by LMax II (Molecular Devices, Sunnyvale, CA, USA). The half maximal inhibitory concentration (IC 50) of ibrutinib was calculated using Graphpad prism 5 software (GraphPad Software Inc., San Diego, CA, USA).
Western blotting
Cell lines treated or non-treated with ibrutinib were harvested and lysed using RIPA buffer (Cat No. 9806, Cell Signaling Technology, Danvers, MA, USA) supplemented with protease inhibitor cocktail tablets (Cat No. 04693124001, Roche, Mannheim, Baden-Wuerttemberg, Germany) to get the protein in total cell extracts. Then equivalent amounts of protein were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) on which separating gel contained 4-15% acrylamide (Cat No. 456–1083, Bio-Rad, Hercules, CA, USA), transferred to polyvinylidene fluoride (PVDF) membrane (Cat No. IPVH00010, Millipore Corporation, Billerica, MA, USA) and probed with appropriate primary and secondary antibodies mentioned above to study the BCR signaling pathway and apoptosis-related protein. ECL select western blotting detection reagent (Cat No. RPN 2235, GE Healthcare, Little Chalfront, Bukinghamshire, UK) was used for detection on a Fluor Chem HD2 (Cell Biosciences, Santa Clara, CA, USA).
Quantification of apoptosis
After incubated with ibrutinib or not for the indicated periods, 1 × 106 cells were washed with cold PBS, labeled using Annexin-V-FITC and propidiumiodide (PI) in binding buffer according to the manufacturer’s protocol of the Annexin-V-FITC apoptosis detection kit purchased from Beijing Biosea Biotechnology (Cat No. CX1001, Beijing, China) and analyzed by BD Accuri C6 flow cytometer (BD Biosciences, San Jose, California, USA). Early stage apoptosis cells were defined as Annexin-V positive and PI negative and late stage apoptosis cells were defined as Annexin-V and PI dual positive.
RNA extraction and real-time PCR
Total RNA was extracted using TRIzol reagent (Cat No. 15596–026, Life Technologies, Carlsbad, CA, USA), according to the manufacturer’s instructions. Reverse transcription was performed using TransScript First-Strand cDNA Synthesis SuperMix (Cat No. AT301, TransGen Biotech, Beijing, China). Real-Time PCR was performed with the specially designed primers and probes and Platinum Quantitative PCR SuerMix-UDG (Cat No.11730-017, Life Technologies, Carlsbad, CA, USA). The primers and probes were as follows: Btk sense CCGGAAGACAAAAAAGCCTCTT, antisense GGCGGTAGTGGCTTTTTCAA, Probe FAM-CCCAACGCCTGAGGAGGACCAGA-TAMRA; CCL3 sense GAGCCCACATTCCGTCACCT, antisense CACTGGCTGCTCGTCTCAAA, Probe FAM-CCACTGCTGCCCTTGCTGTCC-TAMRA; CCL4 sense CAGCGCTCTCAGCACCAA, antisense AGCTTCCTCGCAGTGTAAGAAAA, Probe FAM-CTCAGACCCTCCCACCGCCTGC-TAMRA; ACTB sense CCTGGCACCCAGCACAAT, antisense GCCGATCCACACGGAGTACT, Probe FAM-ATCAAGATCATTGCTCCTCCTGAGCGC-TAMRA. After UDG incubation (50°C for 2 min) and pre-amplification (95°C for 2 min), the PCR was amplified for 40 cycles (95°C for 15 s and 60°C for 30 s) on a ABI 7500 Real Time PCR System (Life Technologies, Carlsbad, CA, USA). The fold change in mRNA was calculated by the 2-ΔΔCt method.
Preparation of human peripheral blood B cells
Peripheral blood lymphocytes were isolated from 15 ml EDTA-blood obtained from healthy volunteers using Lymphocyte Separation Medium (Cat No. LTS1077, Tian Jin Hao Yang Biological Manufacture CO.,LTD, Tianjin, China) according to the protocol from the manufacturer. Normal B cells were separated from the peripheral blood lymphocytes using B Cell Isolation Kit (B-CLL) human (Cat No. 130-093-660, Miltenyi Biotec, Bergisch Gladbach, Germany) according to the protocol from the manufacturer. This research protocol was approved by our Institutional Review Board.
Statistical analysis
Statistical significance from controls was assessed by Student’s t-test and p < 0.05 values were accepted as statistically significant. Results represent the mean ± standard deviation (SD) of three independent experiments. Western blotting experiments were repeated three times or more and the representative results were shown in the figures.
Competing interests
All authors declare that they have no competing interests.
Authors’ contributions
ZJ, SYQ and DN designed the study and review the final manuscript. ZXH designed, performed the experiment, analyzed data and wrote the manuscript. FLX helped to preparation of human peripheral blood B cells. All authors read and approved the final manuscript.