Background
Hepatocellular carcinoma (HCC) is the fifth most prevalent cancer and the third leading cause of cancer mortality worldwide[
1‐
3]. Although the clinical course and survival rates in HCC depend on the disease stage at diagnosis, most patients are initially diagnosed at the advanced stages, there is no effective therapeutic treatment, resulting in short survival time and poor prognosis[
4,
5]. Poor understanding of the mechanisms underlying HCC pathogenesis renders early-stage diagnosis and treatment difficult[
6]. Therefore, further studies are needed to investigate the progression of HCC initiation and pathogenesis, which would contribute to the exploration of effective schemes for HCC diagnosis and therapy.
Wnt/β-catenin signaling pathway is highly conserved in evolutionary processes and reported to be overactivated in the progresses of multiple tumors, including HCC[
7‐
14]. The varying distribution of β-catenin in tumor cells leads the abnormal activation of Wnt/β-catenin signaling pathway correlated with cancers prognosis[
11,
14‐
16]. Satoshi
et al. reported that β-catenin plays essential roles in promoting HCC progression by stimulating HCC cell proliferation and suppressing cell adhesion, and is associated with a poor prognosis of HCC patients[
14]. Furthermore, Wnt/β-catenin signaling pathway modulates multiple genes correlated with tumor progression, such as Cyclin D, Ki67, and E-cadherein[
14]. Therefore, it is of great interest to investigate the regulatory mechanism of Wnt/β-catenin signaling pathway in HCC and it might be potential target for HCC diagnosis and therapy.
As a member of the expanding low-density lipoprotein (LDL) receptor family, lipoprotein receptor-related protein 6 (LRP6), is found to be expressed in different types of human tissues and LRP6 is one of Wnt-coreceptors, which could activate the transcription of Wnt/β-catenin target genes by promoting β-catenin translocation into the nucleus[
17‐
19]. Meanwhile, LRP6 is also found to be correlated with cancer initiation and progression and significantly overexpressed in various types of human cancers, such as liver cancer, colon cancer, and kidney tumor[
20,
21]. In HCC, LRP6 is also reported to be upregulated and overexpression of LRP6 enhanced HCC cells proliferation, migration and invasion[
22]. It has been reported that transducin β–like protein 1 (TBL1X) and its highly related family member TBLR1 could bind to the E3 ubiquitin ligase components SIAH-1 and SKP1 to inhibit β-catenin degradation leading to the activation of Wnt/β-catenin signaling and TBL1-TBLR1and β-catenin recruit each other to Wnt target-gene promoter for transcription activation and oncogenesis[
23]. Depletion of TBL1–TBLR1 inhibited Wnt-β-catenin-induced gene expression and oncogenic growth[
23,
24]. Therefore, it would be interesting to investigate the regulatory mechanism of LRP6 or TBL1X in HCC.
MicroRNAs (miRNAs), a class of small noncoding RNAs, are important elements in numerous biological activities and modulation of multiple cellular processes through negative regulation of gene expression by targeting the 3’ untranslated region (3’ UTR) of specific mRNAs in a sequence-specific manner[
25‐
27]. Aberrant miRNAs expressions have been implicated in the initiation and progression of various tumors and plays vital roles in tumor development[
28‐
37].
In the present study, we reported that miR-610 was downregulated in HCC cell lines and tissues. Inhibition of miR-610 promoted, while upregulation of miR-610 suppressed, HCC cell proliferation and tumorigenicity both in vitro and in vivo. Furthermore, we demonstrated that miR-610 inhibited Wnt/β-catenin signaling activity through directly downregulation of LRP6 and TBL1X. Therefore, our results suggest that miR-610 might play important functions in HCC progression and represent a potential target for HCC diagnosis and therapy.
Discussion
More than 80% of all HCC cases occur in developing countries, and approximately 55% of all cases occur in China, particularly in the southeast regions[
38]. Therefore, discovery of effective diagnostic biomarkers and therapeutic methods is urgent. An increasing number of studies have shown that miRNAs may be significant diagnostic and prognostic markers[
6,
35‐
37]. In the current study, we found that miR-610 was downregulated in HCC tissue and reduced miR-610 levels were significantly correlated with HCC progression and poor patient survival, suggesting that reduced miR-610 might play essential roles in HCC progression and represent a potential target for HCC therapy.
Numerous-reports demonstrated that the Wnt/β-catenin signaling pathway plays important roles in the progression of various human cancer types via modulation of many biological processes, including cell growth, invasion and metastasis, apoptosis, differentiation and stem cell development[
39‐
42]. Herein, we demonstrated that miR-610 suppressed HCC cell proliferation and tumorigenicity both
in vitro and
in vivo by regulating the Wnt/β-catenin signaling pathway. Previously, it has reported that multiple downstream target genes of Wnt/β-catenin pathway were increased in various malignancies, which were correlated with tumor progression and prognosis[
8,
9,
14,
43]. We examined the expression of the main downstream target genes of the β-catenin signaling pathway, i.e.
CCND1,
MYC,
AXIN2,
LEF1,
JUN,
FGF4 and
MMP7, and found that ectopic miR-610 decreased the mRNA expression of these genes, suggesting miR-610 modulates β-catenin signaling pathway. As Wnt/β-catenin signaling pathway regulates a series of genes related to biological progression in various tumors, it would be interesting to further investigate whether miR-610 also contributes to the aggressiveness of HCC, such as invasion and metastasis.
Since cancer is a heterogeneous and multi-step disease that cannot be successfully treated by targeting a single gene of interest, therefore understanding of the regulatory networks of many molecules will aid the exploration of effective therapeutic methods. It has been reported that miR-21 is involved in glioblastoma progression and is recognized as an anti-apoptotic factor due to its ability to block the genes responsible for controlling apoptosis[
44]. MiR-486 overexpression correlates with progression of gliomas and promotes glioma aggressiveness by sustaining nuclear factor κB (NF-κB) activity via disrupting multiple NF-κB negative feedback loops[
45]. miRNA-374a promotes breast cancer metastasis by downregulating WIF1, PTEN and WNT5A expression, consequently activating WNT/β-catenin signaling[
46]. Our study suggests that miR-610 inhibits HCC cell proliferation and tumorigenesis through direct and specific regulation of LRP6 and TBL1X, which have been demonstrated to acted as positive regulators of the β-catenin signaling pathway. The results provide more information for establishing effective and promising therapeutic strategies aiming at miRNA-modulating networks.
Both LRP6 and TBL1X are found to function as oncogenes during tumor progression[
18,
23,
47]. LRP6 is found to be targeted and suppressed by miR-126-3p leading to inhibition of tumor metastasis and angiogenesis of hepatocellular carcinoma[
48]. Zhang Y
et al. found that miR-202 suppresses cell proliferation in human hepatocellular carcinoma by downregulating LRP6 protein expression[
49]. Meanwhile, it has been reported that miR-483-5p modulates the protein level of TBL1X, which is one of the Methyl CpG-binding protein 2 (MeCP2)-interacting corepressor complexes during human fetal development[
50]. In the current study, we found LRP6 and TBL1X are targeted by miR-610, and overexpression of miR-610 could inhibit proliferation and tumorigenesis of HCC cells by suppressing the expression of LRP6 and TBL1X, followed by downregulation of β-catenin signaling activity.
MiR-610 locates at chromosome 11p14.1. The region 11p14.1 deletion was found to be associated with multiple disease, such as Attention-Deficit Hyperactivity Disorder (ADHD), autism, developmental delay, obesity, neurobehavioral problems and WAGR syndrome (Wilms tumor, aniridia, genitourinary anomalies, and mental retardation)[
51,
52]. Therefore, it would be of great interest to further investigate whether reduced miR-610 in HCC is attributed to genomic deletion and/or other transcriptional regulation mechanism.
Methods
Cell culture
The immortalized normal liver epithelial cell lines THLE-3 and LO2 were purchased from American Type Culture Collection (Manassas, VA, USA) and cultured according to the manufacturer’s instructions. HCC cell lines (HepG2, BEL-7404, Huh7, BEL-7402, PLC/PRF, Hep3B, HCCC-9810) were purchased from American Type Culture Collection and maintained in RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen) at 37°C in a 5% CO2 incubator.
Generation of stably engineered cell lines
The miR-610 expression plasmid pMSCV-miR-610 was generated by cloning the genomic precursor miR-610 gene into a retroviral transfer plasmid pMSCVpuro (Promega, Madison, WI, USA). pMSCV-miR-610 was then cotransfected with the packaging plasmid into 293FT cells using the standard calcium phosphate transfection method[
53]. Puromycin (0.5 μg/ml, Sigma-Aldrich) was used to select stably transduced cells. Real-time quantitative polymerase chain reaction (PCR) was used to confirm miR-610 expression. MiR-610 mimic, inhibitor and negative control were purchased from RiboBio (Guangzhou, China). Oligonucleotide transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions.
Tissue specimens and patient information
We examined 76 paraffin-embedded, archived HCC specimens and 10 pairs of snap-frozen HCC tumors and matched adjacent normal tissues that had been histopathologically diagnosed and verified by experienced pathologists. The fresh tissues were frozen and stored in liquid nitrogen until further use. Prior patient consent and approval from the Institute Research Ethics Committee were obtained for the use of clinical materials for research purposes.
RNA extraction and real-time quantitative PCR
Total cellular RNA was extracted using TRIzol (Invitrogen) according to the manufacturer instructions. Reverse transcription was performed using the M-MLV Reverse Transcription system (Promega). Real-time PCR was performed using a standard SYBR Green PCR kit protocol (Applied Biosystems, Foster City, CA) in an ABI PRISM 7500 Sequence Detection System (Applied Biosystems). Gene expression levels were normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the control and calculated as 2-[(Target gene Ct) – (GAPDH Ct)], where Ct represents the threshold cycle for each transcript. The relative expression levels were calculated as 2-[(miR-610 Ct) – (U6 Ct)] following normalization with reference to the expression of small nuclear RNA U6.
The primers used were: LRP6 forward, 5′-TCAGTCCATTT GGCCAGTAA-3′, reverse: 5′-CAACCCAGAGCTATTGCCTT-3′; TBL1X forward, 5′-CAGGGCTCCTTATGGTG ACT -3′, reverse: 5′- CATATCAGATG CCTCGCAGA -3′;cyclin D1 (CCND1) forward, 5′-AACTACCTGGACCGCTTCCT-3′, reverse: 5′-CCACTTGAGCTT GTTCACCA-3′; MYC forward: 5′-TCAAGAGGC GAACACACAAC-3′, reverse: 5′-GGCCTTTTCATTGTTTTC CA-3′; AXIN2 forward: 5′-TTATGCTTTGCACTACGTCC CTCCA-3′, reverse: 5′-CGCAAC ATGGTCAAC CCTCAGAC-3′; lymphoid enhancer - binding factor 1 (LEF1) forward: 5′-CACTGTA AGTGATGAGGGGG-3′, reverse: 5′-TGGATCTCTTTCTCCACCCA-3′; JUN forward: 5′-CAGGTGGCACAGCTTAAACA-3′, reverse: 5′-GTTTGCAACTGCTGCGTTA G-3′; fibroblast growth factor 4 (FGF4) forward: 5′-CGTGGTGAGCATCTTCGGAGTGG-3′, reverse: 5′-CCTTCTTGGTCCGCCCGTTC TTA-3′; matrix metalloproteinase 7 (MMP7) forward: 5′-GTATGGGACATTCCTCTGAT CC-3′, reverse:5′-CCAATGAATGAATGAATGG ATG-3′; GAPDH forward: 5′-GACTCAT GACCACAGTCCATGC-3′, reverse: 3′-AGAGGCAGGGATGATGTTCTG-5′. The primers used for miR-610 and U6 stem–loop reverse transcription–PCR were purchased from RiboBio.
Western blotting
Cells were lysed in 1× sample buffer and protein concentrations were measured using Bio-Rad protein assay reagent (Bio-Rad Laboratories, Berkeley, CA, USA). Protein (20 μg) was separated by electrophoresis and transferred onto polyvinylidene difluoride membranes (Millipore, Billerica, MA, USA). The membranes were probed with polyclonal rabbit antibodies, anti-LRP6 (Cell Signaling, Danvers, MA, USA), anti-TBL1X (Sigma-Aldrich), anti-β-catenin, anti-phospho-β-catenin, anti-CCND1 and anti-c-Myc (Cell Signaling). The membranes were then stripped and re-probed; an anti-α-tubulin antibody (Cell Signaling) was used as a loading control.
Cell viability assay
Cell viability was measured by MTT assay. Cells (1 × 104) were cultured in 96-well plates and stained at the indicated time points with 100 μl sterile MTT (0.5 mg/ml; Invitrogen) for 4 h at 37°C, followed by removal of the culture medium and the addition of 150 μl dimethyl sulfoxide (Sigma-Aldrich), followed by measurement of the absorbance at 570 mm. Relative cell numbers were calculated in sextuplicate in three independent experiments.
Cells were trypsinized and seeded in 6-well plates (1 × 103 cells per well). After 10 days, cells were fixed with 10% formaldehyde for 15 min, stained with 1.0% crystal violet for 5 min, and then counted and photographed. All experiments were performed in triplicate.
BrdU incorporation assay
The level of DNA synthesis was determined by estimating DNA uptake of 5-bromo-2’-deoxyuridine-5’-monophosphate (BrdU). Cells were trypsinized, transferred to a sterile coverslip and allowed to settle. After 48-h serum starvation and 4 h incubation in complete medium, cells were fixed and permeabilized with 0.1% Triton for 10 min. Subsequently, cells were labeled with BrdU (10 μM; Sigma-Aldrich) for 1 h, incubated in serum-free medium containing anti-BrdU antibody for 1 h at 37°C and incubated with 4’, 6-diamidino-2-phenylindole for nuclear staining. Each experiment was repeated three times independently; stained cells were counted under a fluorescence microscope (Olympus, Tokyo, Japan).
Flow cytometry analysis
Cells were harvested by trypsinization and fixed in 80% ice-cold ethanol in phosphate-buffered saline. Bovine pancreatic RNase (2 μg/ml; Sigma-Aldrich) was added to the cells, followed by 30-min incubation at 37°C, and then 30-min incubation in propidium iodide (10 μg/ml, Invitrogen) at room temperature. Propidium iodide–stained cells (>10,000 cells) were analyzed using a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA). All experiments were performed in triplicate.
Anchorage-independent growth assay
RPMI 1640 medium (1.5 ml) containing 10% FBS and 0.33% agar was plated in 6-well plates that were stored at 4°C for the agar to solidify. The cells were trypsinized and 1 × 103 cells per well were mixed with RPMI 1640 medium containing 10% FBS and 0.66% agar and plated on the prepared 6-well plates. After 10-day incubation, colony sizes were measured using an ocular micrometer; colonies >0.1 mm in diameter were scored. All experiments were performed in triplicate.
Xenograft tumors
We used 5-week-old BALB/c nude mice for the HCC xenograft model. Medium (0.2 ml) containing 5 × 106 HCC cells were injected subcutaneously into the left and right posterior flank regions of each mouse. Mice were housed in a pathogen-free environment and tumor growth was examined every three days. Mice were sacrificed after 21 days, and the weight and volume of each tumor were calculated. All experimental procedures were conducted in accordance with the Guide for the Care and Use of Laboratory Animals and conformed to our institutional ethical guidelines for animal experiments.
Luciferase assay
The 3’ UTR of the LRP6 or TBL1X gene was PCR-amplified from genomic DNA and inserted downstream of the luciferase reporter gene in a pGL3 reporter vector (Promega). The primer sets used were: 3’-UTR of LRP6 containing the miR-610 binding site, 5′- AATCCGCGGGG GTTGTATTTCTTTATCATT -3′ and 5′- GCCCTGCAG CGCATACCTCTTCAGTCTC -3′; 3′-UTR of TBL1X containing the miR-610 binding site, 5′- AATCCGCGGTGTCTTGGG CTTGTTGTC -3′ and 5′- GCCCTGCATCTGTGGC TTC TTCGGTTC -3′. LRP6-3′UTR mutant: 5′- AGCTCCATTCCCCAGTAGGCTTAGGAGTTC AATTTGACT GCTGTTTTTGC-3′ and 5′- CAGCAGTCAAATTGAACTCCTAAGCCTA CTGGGGAATGGAGCT-3′; TBL1X-3’UTR mutant: 5′- ATCACCTTGTGTGTTGTAG GAGA TTTGTTTCAAGAGAGAATCAACAGATC-3′ and 5′- GATCTGTTGATTCTCT CTTGAAA CAAATCTCCTACAACACACAAGGTGAT-3′. Reporter plasmids containing wild-type (CCTTTGATC; TOPflash) or mutated (CCTTTGGCC; FOPflash) T cell factor (TCF)/LEF DNA binding sites were purchased from Upstate Biotechnology (Lake Placid, NY, USA). Cells were plated in a 24-well plate and incubated for 24 h prior to transfection. Firefly luciferase constructs containing the 3’ UTR of the potential miR-610 target, pRL-TK Renilla luciferase normalization control (Promega), miRNA mimic, inhibitor or negative control were cotransfected using Lipofectamine 2000 (Invitrogen). Lysates were collected 48 h after transfection and measured using a Dual-Luciferase Reporter System (Promega) according to the manufacturer protocol. Three independent experiments were performed and the data presented as the means ± SD.
The nuclear protein extraction assay was conducted using Nuclear Extraction Kit (Life Technologies, Carlsbad, CA, USA). Briefly, Collect cells (5 × 106) were collected and washed by cold PBS, and gently resuspended with 500 μl 1× Hypotonic Buffer, followed by incubating on ice for 15 minutes. Add 25 μl detergent (10% NP40) and vortex for 10 seconds at highest setting. Centrifuge the homogenate for 10 minutes at 3,000 rpm at 4°C. Transfer and save the supernatant. This supernatant contains the cytoplasmic fraction. The pellet is the nuclear fraction. Resuspend nuclear pellet in 50 μl complete Cell Extraction Buffer for 30 minutes on ice with vortexing at 10 minute intervals. Centrifuge for 30 minutes at 14,000 g at 4°C. Transfer supernatant (nuclear fraction) to a clean microcentrifuge tube. The nuclear extracts are ready for assay.
Micro-ribonucleoprotein complex immunoprecipitation assay
Cells were cotransfected with a plasmid encoding hemagglutinin–argonaute 1 (HA-Ago1 or -Ago2) (Addgene, Cambridge, MA, USA) and miR-610 mimic (100 nM), followed by HA-Ago1 or -Ago2 immunoprecipitation (IP) using an anti-HA antibody (Roche Applied Science, Mannheim, Germany). The association of the LRP6 and TBL1X mRNA with the RNA-induced silencing complex was tested using real-time PCR analysis of the IP product. The primers used: LRP6, 5′- CGACTTGAA CCATCCATTCC-3′ and 5′- CAACCCAGAGCTATTGCCTT-3′; TBL1X, 5′- TGTATG GACCTGTGGACCAG-3′ and 5′- CATATCAGATGCCTCGCAGA-3′.
Statistical analysis
All statistical analyses were performed using SPSS software. The association between miRNA expression and tumor stage was assessed using the Fisher exact test or Pearson χ2 test. We used the Kaplan–Meier method to estimate survival; log-rank testing was used to test differences between survival curves. Data are reported as means ± SD; mean values were compared using Student’s t-test. Results were considered statistically significant when P <0.05.
Xian-Cheng Zeng: Department of Hepatic Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Department of General Surgery, Zengcheng People’s Hospital, (BoJi-Affiliated Hospital of Sun Yat-Sen University), Department of clinical laboratory, Zengcheng People’s Hospital (BoJi-Affiliated Hospital of Sun Yat-Sen University), Department of Hepatic Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, Guangdong, China; Fo-Qiu Liu: Department of Gastroenterology, Zengcheng People,s Hospital (BoJi-Affiliated Hospital of Sun Yat-Sen University), Zengcheng, Guangdong, China; Rong Yan: Department of Hepatic Surgery, The Third Affiliated Hospital of Sun Yat-sen University, Guangzhou, Guangdong, China; Hui-Min Yi: Department of Hepatic Surgery, the Third Affiliated Hospital of Sun Yat-sen University; Tong Zhang: Department of Hepatic Surgery, the Third Affiliated Hospital of Sun Yat-sen University; Guo-Ying Wang: Department of Hepatic Surgery, the Third Affiliated Hospital of Sun Yat-sen University; Yang Li: Department of Hepatic Surgery, the Third Affiliated Hospital of Sun Yat-sen University; Nan Jiang: Department of Hepatic Surgery, the Third Affiliated Hospital of Sun Yat-sen University.
Acknowledgements
This study was supported by the National Natural Science Foundation of China (No. 81000959, No. 81201781), Guangdong Natural Science Foundation (No.S2013010016023, No.10451130001004472), Science and Technology Planning Project of Guangdong Province, China (No.2009B030801007), Science and Technology Program of Guangzhou Municipal Government (No.2013 J4100081), Foundation of Science and Technology Innovation of Zengcheng (No.ZC201004), The Fundamental Research Funds for the Central Universities(No.12ykpy47, No.12ykpy43), National 12th Five-Year Science and Technology Plan Major Projects of China (No. 2012ZX10002017 -005). Guangzhou Municipal Health Bureau (No. 20141A011117).
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
XZ, WC and FL carried out most of the laboratory analyses, drafted the manuscript and were actively involved in the field work. HY, TZ and GW prepared cell culture assays for biological function analyses. YL analyzed genes and proteins expression and analyses. XZ and NJ designed and supervised the study, were involved in data analyses and wrote the finalized manuscript. All authors read and approved the final manuscript.