Downregulation of PPARγ by miR-548d-5p suppresses the adipogenic differentiation of human bone marrow mesenchymal stem cells and enhances their osteogenic potential

hBMSCs were purchased from Cyagen Biosciences Co. Ltd. (Guangzhou, China), cell identification by flow cytometry revealed that hBMSCs were positive for CD29, CD44 and CD105, negative for CD34 and CD45. They were cultured in low glucose complete DMEM culture medium (containing 10% fetal bovine serum, 100 kU/mL penicillin, 100 mg/L streptomycin, 50 mg/L vitamin C, 1 mmol/L L-glutamine, and 20 mmol/L HEPES) and incubated in a humidified atmosphere of 5% CO₂ at 37°C. The third passage hBMSCs were used in this study.

Dexamethasone was added to hBMSCs medium which requiring dexamethasone induction at a final concentration of 10⁻⁷ mol/L. The same concentration of dexamethasone was added to new medium each time it was replaced.

The miR-548d-5p agomir (GMR-miR™ microRNA-548d-5p agomir) used in this study was synthesized by Shanghai GenePharma Co. Ltd. (Shanghai, China). Prior to transfection, hBMSCs were plated in six-well plates at a density of 1.5 × 10⁵ cells/well. Once cells reached ~50% confluence, transient transfections were conducted using Lipofectamine™2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions, each well was transfected with 50nmol miR-548d-5p agomir.

Total RNA was extracted from cells using a Total RNA Kit (OMEGA, Norcross, GA, USA), according to the manufacturer’s instructions. cDNA was synthesized using the RevertAid First Strand cDNA (Thermo Fisher Scientific, Waltham, MA, USA). qRT-PCR was carried out using SYBR Green I (TaKaRa, Dalian, China), and gene expression levels were normalized to GAPDH. All experiments were performed in triplicate. To verify mature miRNA expression levels, qRT-PCR was performed using a High-Specificity miR-548d-5p qRT-PCR Detection Kit (Stratagene Corp, La Jolla, CA, USA) in conjunction with an ABI 7500 thermal cycler, according to the manufacturer’s recommendations. The miR-548d-5p expression level was normalized to U6 small nuclear RNA (U6 snRNA), and measured using the comparative Ct (2^-ΔCt) method. The primers for miR-548d-5p were 5’GTCGTATCCAGTGCAGGGTCCGAGGTATT CGCACTGGATACGACGGCAAAA3’ (RT primer), 5’TCCGAAAAAGTAATTGTGGT 3’ (forward), 5’GTGCAGGGTCCGAGGT 3’(reverse). The primers for U6 were 5’GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAATA3’ (RT primer), 5’TCCGATCGTGAAGCGTTC3’ (forward), 5’GTGCAGGGTCCGAGGT 3’ reverse).

Oil red O staining was conducted at day 14 following dexamethasone treatment. Cells were washed twice with PBS and fixed with 10% formalin for 10 min at room temperature. After fixation, cells were stained with filtered oil red O solution for 1h at room temperature.

Cellular TG content was determined using a Triglyceride Determination Kit (Applygen, Beijing, China) at day 14 of dexamethasone treatment. hBMSCs were collected, with a final cell density of 1 × 10⁶ cell/mL in each group. After centrifugation at 1000 r/min for 10 min, cells were washed twice with PBS and lysed with 1% TritonX-100 for 30 min. Then, 3 μL of cytochylema and 300 μL of working solution were added into 96-well plates, meanwhile set blank wells and calibration wells. Cells were incubated at 37°C for 5 min after blending, and the absorbance values were measured at a wavelength of 500 nm.

ALP activity was determined using an enzyme-linked immunosorbent assay (ELISA) test kit (R&D Systems, Minneapolis, MN, USA) at day 6 of culture. hBMSCs were suspended in 1 mL buffer solution and centrifuged at 15 000 r/min for 15 min at 4°C after repeated freezing-thawing treatment to lyse the cells. Set standard wells on the ELISA plates and prepared standard solution. Forty microliters of diluent and 10 μL of supernatant were added into sample wells, and incubated at 37°C for 30 min after blending, meanwhile set blank wells. After washing 3 times, 50 μL of horseradish peroxidase was added into the sample wells, and incubated at 37°C for 30 min. After washing for three times, 100 μL of chromogenic solution was added and incubated at 37°C for 15 min. Finally, 50 μL of stop solution was added and absorbance values were measured at a wavelength of 450 nm.

By bioinformatic analysis using TargetScan (http://​www.​targetscan.​org/​) and miRBase (http://​www.​mirbase.​org/​), we suggest that PPARγ as a candidate target of miR-548d-5p. Human PPARγ 3′-UTR fragments containing putative binding sites for miR-548d-5p were amplified by PCR from human genomic DNA. Mutant PPARγ 3′-UTRs were obtained by overlap extension PCR. The fragments were cloned into a pmirGLO reporter vector (Promega), downstream of the luciferase gene, to generate the recombinant vectors pmirGLO-PPARγ-Wt and pmirGLO-PPARγ-Mut. For the luciferase reporter assay, hBMSCs were transiently co-transfected with miRNA (miR-548d-5p agomir or scrambled negative control) and reporter vectors (wild-type reporter vectors or mutant-type reporter vectors), using Lipofectamine™2000 (Invitrogen, Carlsbad, CA, USA). Luciferase activities were measured using a Dual-Luciferase assay kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions at 48 h post-transfection.

Total proteins of cultured cells were extracted using RIPA buffer containing phenylmethanesulfonylfluoride. Protein concentration was determined using the BCA protein assay kit (Beyotime, Haimen, China) according to the manufacturer’s protocol. Proteins were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes. After blocking, the membranes were incubated overnight at 4°C with diluted (1:300) primary antibodies (monoclonal mouse anti-PPARγ or anti-C/EBPα or anti-OCN or anti-Runx2; Santa Cruz Biotechnology, Dallas, TEX, USA). Following extensive washing, the membranes were incubated with diluted (1:3000) horseradish peroxidase-conjugated rabbit anti-mouse IgG (Santa Cruz Biotechnology, Dallas, TEX, USA). Signals were determined using a chemiluminescence detection kit (Amersham Pharmacia Biotech, Piscataway, NJ, USA). An antibody against β-actin (Santa Cruz Biotechnology, Dallas, TEX, USA) served as endogenous reference.

Based on studies showing that supraphysiological doses of glucocorticoids induce the differentiation of hBMSCs into adipocytes, 10⁻⁷ mol/L of dexamethasone was chosen as the effective dose [9]. Compared with non-induced (Blank) cells, hBMSCs cultured in the presence of dexamethasone had higher cytoplasmic oil red O staining (Figure 1a) and higher TG content (P < 0.05; Figure 1b) after 14 days, and decreased levels on day 6 of ALP, an early marker of osteogenic differentiation (P < 0.05; Figure 1c). Moreover, relative to cells in the Blank group, dexamethasone-treated hBMSCs had lower levels of miR-548d-5p (day 7 and day 14, P < 0.05; Figure 1d) and the osteogenic markers Runx2 and OCN (day 6, P < 0.05, Figure 1e, 1g). Furthermore, qRT-PCR (day 6, P < 0.05; Figure 1f) and western blotting (day 6, Figure 1h) showed that levels of the adipogenic transcription factors PPARγ and C/EBPα were higher in the dexamethasone-induced group than in the Blank group. Collectively, these results confirm the induction by dexamethasone of adipogenic differentiation in hBMSCs, and its inhibition of osteogenic differentiation in these cells. The induction of miR-548d-5p expression in dexamethasone-treated hBMSCs suggested to us that miR-548d-5p had a role in the regulation of their adipogenic differentiation.

We next sought to elucidate the role of miR-548d-5p during dexamethasone-induced adipogenic differentiation of hBMSCs by transfection studies using the miR-548d-5p agomir. Cells were divided into four groups, namely: Blank Group: untransfected, uninduced hBMSCs; Control Group: untransfected hBMSCs induced with dexamethasone; NC Group: scrambled agomir-transfected hBMSCs induced with dexamethasone; and miR-548d-5p Group: miR-548d-5p agomir-transfected hBMSCs induced with dexamethasone. qRT-PCR analysis showed that miR-548d-5p levels were eight-fold higher in the miR-548d-5p Group compared with the Control and NC groups (day 2, Figure 2b). Oil red O staining assay on day 14 of induction showed that, in contrast to cells in the Blank and miR-548d-5p groups, in which no or few cells stained positive, cells in the Control and NC groups contained reddish-orange fat droplets in their cytoplasm (Figure 2a). Consistent with this, TG content in the Blank and miR-548d-5p groups was significantly lower than in the NC and Control groups (day 14, P < 0.05; Figure 2c). Moreover, the higher ALP activity in the miR-548d-5p group relative to the NC and Control groups (day 6, P < 0.05; Figure 2d) suggested that miR-548d-5p maintained the osteogenic potential of hBMSCs. Compared with the NC and Control groups, overexpression of miR-548d-5p depleted PPARγ and C/EBPα at both the mRNA and protein levels (P < 0.05), and increased protein levels of the osteogenic markers Runx2 and OCN (P < 0.05) (day 6, Figure 2e, 2f). These results indicated to us that overexpression of miR-548d-5p suppressed the dexamethasone-induced adipogenic differentiation of hBMSCs and supported the osteogenic potential of these cells.

Bioinformatic analysis using TargetScan and miRanda indicated that PPARγ is a candidate target of miR-548d-5p (Figure 3a), leading us to speculate as to whether miR-548d-5p could directly down-regulate PPARγ expression. Western blotting assay indicated that overexpression of miR-548d-5p substantially decreased cellular levels of PPARγ (Figure 3b). Consistent with this, we found that compared with cells in the NC group, luciferase activity was reduced by cotransfection of miR-548d-5p with the pmirGLO-PPARγ-Wt vector, but not the pmirGLO-PPARγ-Mut vector (Figure 3c). These results indicated that miR-548d-5p regulated PPARγ expression by directly targeting the 3′-UTR of PPARγ.

Western blotting analysis showed that cell levels of PPARγ were decreased in miR-548d-5p agomir-transfected hBMSCs, but not in cells co-transfected with miR-548d-5p agomir and PPARγ lacking the 3′-UTR sequence (pcDNA3.1-PPARγ) (Figure 4a). Moreover, we found that TG content was not decreased in hBMSCs co-transfected with pcDNA3.1-PPARγ and miR-548d-5p agomir (Figure 4b). These results indicated that PPARγ expression restores the anti-dexamethasone-induced adipogenic differentiation function of miR-548d-5p.