Background
Eosinophils were originally discovered based on their distinctive “eosin-loving” intracellular granules. These granules contain hydrolytic enzymes and pre-formed cationic granule proteins, including major basic protein (MBP), eosinophil cationic protein (ECP), eosinophil peroxidase (EPO) and eosinophil-derived neurotoxin (EDN). Eosinophils have long been described as end-stage effector cells acting through the secretion of granule-derived proteins, which exert toxic effects on parasites and microbes, but can also cause collateral damage to host tissue cells, especially in allergic inflammation (reviewed [
1,
2]). More recently eosinophils have been described as multi-functional leukocytes, acting as sources of numerous cytokines, chemokines, matrix metalloproteinases and reactive oxygen species with a range of functions (reviewed [
3]), in addition to production of eosinophil-specific mediators. Importantly, many, if not all, of the effector molecules are stored within eosinophil-specific granules, allowing for very rapid secretion without the need for
de novo synthesis [
4]. Alongside the increasing repertoire of eosinophil-derived products there has been an increasing awareness of the broader role eosinophils play in immunity, with a plethora of roles identified for them, including helping shape adaptive immune responses and providing plasma cell survival factors in the bone marrow [
5,
6].
Under steady state conditions the gastrointestinal tract (GIT) contains the largest number of eosinophils in the body [
7,
8]. Intestinal eosinophils reside primarily in the lamina propria and are important in the maintenance of immune homeostasis in gut-associated tissues [
9]. Although the GIT is often considered as a single entity, the large and small intestine are anatomically and functionally different and therefore should be analysed as two separate immunological compartments [
10]. In the small intestine there is a higher frequency of eosinophils than in the large intestine [
11] and the eosinophil populations in the large and small intestine are phenotypically different [
12]. The functional significance of these phenotypic variants is however not known, although the increased frequency of eosinophils in the small versus large intestine implies they may be of greater functional significance in this region of the GIT, at least in the steady state.
Despite the literature describing differences in the number and phenotype of eosinophils in the naïve small and large intestine, and a functional role for the eosinophil in supporting plasma cells during steady state conditions, it is not known whether the small intestinal eosinophil has unique functions compared to the large intestinal eosinophil and whether this is altered during inflammation. Eosinophilia is observed in response to infection and during inflammation of both the large [
13,
14] and small intestine [
15], and virtually any inflammatory condition of the GIT can feature an eosinophilia. Thus, eosinophils are not simply indicative of a Th2 disorder, but rather can be prominent in many diverse inflammatory conditions. Indeed, a number of human and translational studies have shown that eosinophils are increased in intestinal tissues affected by inflammatory bowel disease [
14]. Here we use two models of parasitic infection – chronic
Trichuris muris [
16] infection and
Toxoplasma gondii infection, that drive an inflammatory response in the GIT restricted to the large and small intestine, respectively. Thus use of these two complementary infection models allows a dissection of the functional roles of the eosinophil in the context of the IgA
+ cells in both the large intestine and small intestine.
Discussion
Eosinophils are a major cellular component of the gastrointestinal tract and following parasitic infection the number of eosinophils is significantly increased. While historically being viewed as end-stage effector cells, the eosinophil is increasingly recognised as a cell type that interacts with cells of both the innate and adaptive immune system. For example, the generation and maintenance of IgA
+ plasma cells is dependent on eosinophils [
5,
6,
9]. Previous work has reported a reduction in the number of IgA
+ plasma cells in both the small and large intestine of eosinophil-deficient mice under steady state conditions [
9], although no statistical significance was ascribed to these changes. In keeping with this report we see a non-significant decrease in IgA
+ plasma cells in the small intestine of eosinophil-deficient mice under steady state conditions, while the number of IgA
+ plasma cells were equivalent in the uninfected large intestine in the presence or absence of eosinophils.
Importantly, we show for the first time that eosinophils play distinct roles in supporting IgA+ plasma cells following infection-driven intestinal inflammation, depending on the gastrointestinal tract niche they occupy. In the large intestine, eosinophil-deficient mice have a significant increase in plasma cells compared to wild-type mice, whereas in the small intestine plasma cell numbers are significantly lower in eosinophil-deficient mice compared to infected wild-type mice. Our data thus demonstrates a relative dependency of plasma cells on eosinophils according to the intestinal niche, and suggests that there is a critical role for eosinophils in maintaining plasma cells in the small but not large intestine. The regional differences in the requirement for eosinophils in maintaining IgA+ plasma cells is an important and novel observation, suggesting that the enigmatic functions of the intestinal eosinophil may differ according to intestinal niche, and with this data further emphasising that the two compartments of the gut are distinct and that findings from one should not be extrapolated to the other.
Eosinophils have been identified as a key producer of plasma cell survival factors in the bone marrow [
5,
6]. However, it was recently reported that the role of eosinophils in maintaining plasma cells in the intestine appears to be independent of eosinophil-derived APRIL and BAFF [
21]. In keeping with this recent publication, our analysis of intestinal tissue revealed no major differences in the plasma cell survival factors APRIL, BAFF, IL-6 or GM-CSF between eosinophil-deficient and control mice following infection. Therefore, although gastrointestinal eosinophils may be capable of producing these survival factors [
9], they are not the key source of these factors and other intestinal cells, including epithelial cells [
22], T cells and dendritic cells [
23] may compensate for the absence of eosinophils. Furthermore, we also assessed whether the differences in IgA
+ plasma cell frequencies could be attributed to either recruitment or proliferation. Both MAdCAM-1 and CCL25 have previously been suggested to be important in the recruitment of plasma cells to the intestine [
19,
20]; therefore the expression of these molecules in eosinophil-deficient and control mice post-infection was analysed. However, our data suggests that differences in MAdCAM-1 or CCL25 expression do not underlie the different phenotypes observed in the small and large intestine in the absence of eosinophils. Moreover, we detected no IgA
+ plasma cell proliferation within the lamina propria of the small intestine in either the ΔdblGATA-1 or control mice, neither at baseline nor post-infection with
T. gondii, suggesting that the differences observed in plasma cell numbers is not due to altered proliferation of these cells in the intestinal tissue. This is in agreement with previously published data that shows the majority of plasma cells do not divide within the intestinal lamina propria in C57BL/6 mice [
24].
One potential candidate driving differential IgA
+ phenotypes in the small and large intestine is the microbiota, with the abundance and composition of the microbiota being markedly different in the small versus large intestine [
10]. The gut microbiota is known to be important in driving mucosal T cell-independent induction of secretory IgA within the lamina propria [
25]. Recently it was reported that the intestinal milieu contributes to the expression of unique niche-dependent transcripts by eosinophils. For example, CD22 is highly expressed on upper GI tract eosinophils, but present at significantly lower levels by eosinophils in other areas of the gut, with colonic eosinophils having the lowest expression levels [
12]. Moreover, the duodenum and jejunum are particularly enriched for eosinophils that express ST2, CD69, Ly6C and CD11c [
26]. These differences may infer the existence of different subpopulations of eosinophils, with unique functions at different niches throughout the intestine. Therefore, the absence of eosinophils in the small intestine could result in a different effect on plasma cell numbers compared to a deficiency in the large intestinal eosinophil. For example, in niches where eosinophils are rare and appear to be less activated, e.g. expressing lower levels of CD11c, such as the colon [
26], there may be a lower dependence on the eosinophil for maintenance of plasma cell numbers with other cell types taking a more prominent role. Again this further emphasises the need for focused regional dissections of immune function along the GIT.
Methods
Animals, T. muris and T. gondii
BALB/c mice were purchased from Harlan U.K. (Bicester, U.K.). ΔdblGATA-1 mice on a BALB/c background were bred in-house. Male mice were used for all experiments. For
T. muris infections mice were infected with 20 infective
T. muris eggs when 8 –10 weeks old and sacrificed at various time points after infection. The maintenance of
T. muris and the method of infection were as previously described [
27], worm burden in the large intestine was assessed as previously described [
28]. Tachyzoites of the type I eYFP expressing RH and the tandem dimeric tomato RFP- tagged type II Pruginaud (PRU) strains of
Toxoplasma gondii, from Boris Striepen [
29], were maintained by serial passage through confluent monolayers of human foreskin fibroblasts [
30]. Mice were infected by oral gavage with 10
6 RH or PRU tachyzoites and sacrificed at various time points post infection by exposure to carbon dioxide gas in a rising concentration. In order to ameliorate animal suffering mice were regularly weighed during infection and general appearance monitored, if any mice lost more than 20 % bodyweight they were humanely killed. All animal experiments were approved by the University of Manchester Animal Welfare and Ethical Review Board and performed under the regulation of the Home Office Scientific Procedures Act (1986) and the Home Office approved grant 40/3217.
Extraction of total RNA and reverse transcription
Tissue samples from the junction of the caecum and large intestine, jejunum or brain were placed in TRIsure (Bioline, London, UK) and frozen on dry ice. Samples were homogenised using a FastPrep 24 and lysing matrix D (MP Biomedicals, Illkirch, France) and total RNA extracted according to the manufacturer’s instructions for TRIsure. Resulting RNA was quantified on a Nanodrop ND-1000 spectrophotometer (Labtech International, East Sussex, U.K.) and stored at −80 °C until used. 1.0 μg of RNA was treated with RNase-free DNase (Promega, Southampton, UK) and reverse transcribed using BioScript (Bioline) in a final volume of 30 μl according to the manufacturer’s instructions and stored at -20 °C.
Quantitative PCR on intestinal tissue
Quantitative PCR was performed using KAPA SYBR FAST qPCR kit (KapaBiosystems) on a BioRad MyQ
2 Cycler with Optical System software version 2.1. Housekeeping genes GAPDH and YWAHZ were used as internal controls for gene expression. Expression levels of genes of interest are shown as fold change after normalisation to two housekeeping genes.
GAPDH | CCCACTAACATCAAATGGGG | TCTCCATGGTGGTGAAGACA |
YWHAZ | TTCTTGATCCCCAATGCTTC | TTCTTGTCATCACCAGCAGC |
BAFF | AAGATGGGGAAAGCCGTCAG | CATGGCACACTTCGGTTGTG |
APRIL | TCTGTTTGGCTGTGAGGTCA | TCCTGGTCCTCTCGGTCATA |
GM-CSF | CTGCGTAATGAGCCAGGAAC | TCAGCGTTTTCAGAGGGCTA |
IL-6 | GTGGCTAAGGACCAAGACCA | TAACGCACTAGGTTTGCCGA |
CCL25 | CGCCTCAGACTCTCAGACTGA | CATTGGCACTGGCATGCCTA |
Quantitative PCR for T. gondii parasite burden
Parasite burden was assessed as previously described [
31]. Briefly, Quantitative PCR was performed using KAPA SYBR FAST qPCR kit (KapaBiosystems) on a BioRad MyQ
2 Cycler with Optical System software version 2.1. Relative mRNA levels were calculated for toxoplasma cysts (Forward: CGTTTGGAGAAATGGTGTCCCAG; Reverse: CCGCCTGAGTATCCGCTTTTAC) by using an included standard curve for each individual gene and normalised to the housekeeping gene TBP (Forward: AACAGCAGCAGCAACAACAGCAGG; Reverse: TGATAGGGGTCATAGGAGTCATTGG).
Histology
Histological sections were prepared from proximal large intestine or jejunum and preserved in OCT. 6-μm sections were cut using a microtome and placed on polysine adhesion slides. Immunohistochemical staining for IgA was performed as follows. Slides were fixed in 4 % PFA on ice for 10 mins. Endogenous peroxidase was quenched by incubation with 1.5 U/ml glucose oxidase (Sigma, Gillingham, Dorset, U.K.) in the presence of 1.8 mg/ml glucose and 0.064 mg/ml sodium azide for 20 min at 37 °C. Non-specific binding was blocked with 7 % rat serum (Sigma) and endogenous avidin and biotin binding sites were blocked using a kit according to the manufacturer’s instructions (Invitrogen, Paisley, UK). Sections were then incubated with biotinylated rat anti-mouse IgA (5 μg/ml, BD Biosciences) in phosphate-buffered saline, followed by ABC (avidin-biotin complex) (Vector Laboratories) and 3,3′ Diaminobenzidine (DAB; Vector) and colour development monitored. Sections were counter-stained in HaemQS (Vector Laboratories) for 1 min, and mounted in aquamount (BDH, Lutterworth, UK). For MAdCAM-1 and Siglec F staining the same protocol was used but non-specific binding sites were blocked with 7 % goat serum (Invitrogen), a MAdCAM-1 (5 μg/ml, eBiosciences) or Siglec F primary antibody (5 μg/ml, BD Biosciences) was used followed by a biotinylated secondary goat anti rat Fab’ fragment antibody (1 μg/ml, Santa Cruz). For IgA staining 0.05 % Saponin was utilised in all washing and staining steps.
Slides were blinded and positive cells counted in a minimum of 20 crypts or 10 VCUs from 3 sections evenly distributed across the specimen. Images were acquired using a 20×/0.80 Plan Apo objective using the 3D Histech Pannoramic 250 Flash II slide scanner. Isotype control staining was performed and examined to confirm there was no non-specific staining (Additional file
1: Figure S1).
Immunofluorescent staining
Histological sections were prepared from proximal large intestine or jejunum and preserved in OCT. 6-μm sections were cut using a microtome and placed on polysine adhesion slides. Slides were fixed in 4 % paraformaldehyde at 4 °C for 10 min. Sections were blocked using the tyramide blocking kit (PerkinElmer, Cambridge, UK) for 30 min. Endogenous biotins were blocked using the avidin/biotin blocking kit as per the manufacturer’s instructions (Invitrogen). Slides were first stained with biotinylated rat anti-mouse IgA (5 μg/ml, BD Biosciences), followed by a secondary avidin Texas-Red (Vector Lab, 30μg/ml). Slides were then incubated with the primary antibody Ki67-Alexa Flour® 488 (5μg/ml, BD Biosciences). Slides were washed and mounted with vector shield containing 4’,6-diamidino-2-phenylindole (Vector Lab). 0.05 % Saponin was utilised in all washing and staining steps.
Flow cytometry
The proportion of PCs in the MLN was assessed by flow cytometry. Single cell suspensions were incubated with Fc block prior to staining with Biotinylated-B220 or FITC-B220 and APC-CD138 (BD Biosciences) and subsequently Streptavidin-QDOT605 (Invitrogen). Samples were acquired using an LSRII (BD Biosciences) and data were analysed with FACSDiva (BD Biosciences) and FlowJo 10 (Tree Star).
Statistical analysis
Statistical analysis was performed using the Student’s t test or 2 WAY ANOVA with post-hoc Bonferonni’s test, as appropriate with the statistical package GraphPad Prism 6.04 (GraphPad Software, San Diego, U.S.A.). A probability value of <0.05 was considered significant (*p < 0.05, **p < 0.01, ***p < 0.001).
Abbreviations
ECP, Eosinophil cationic protein; EDN, Eosinophil-derived neurotoxin; EPO, Eosinophil peroxidase; GIT, gastrointestinal tract; MBP, major nasic protein; MLN, mesenteric lymph node; NS, Not significant; PRU, Pruginaud; T. gondii, Toxoplasma gondii; T. muris, Trichuris muris
Acknowledgements
The Bioimaging Facility microscopes used in this study were purchased with grants from BBSRC, Wellcome and the University of Manchester Strategic Fund.