Introduction
Progressive occlusive remodeling of the distal pulmonary vasculature is the hallmark of pulmonary arterial hypertension (PAH), a heterogenous group of deadly lung disorders clinically defined by a highly increased mean pulmonary artery pressure at rest in the absence of other causes of pre-capillary pulmonary hypertension (PH) [
1,
2]. Histologically, PAH is associated with a dramatic reorganization of the pulmonary arterial architecture involving medial as well as intimal thickening, an extensive loss of capillaries, and the appearance of characteristic, disorganized plexogenic lesions that are highly enriched with alpha-smooth muscle actin (α-SMA) positive cells [
3]. Phenotypically altered, de-differentiated, partially dysfunctional pulmonary endothelial cells (ECs) are postulated to contribute to the occlusive vascular remodeling in PAH both directly by transforming into smooth muscle (SM)-like cells as well as indirectly through paracrine effects [
4‐
6]. Endothelial-to-mesenchymal transition (EndMT) is an essential developmental process by which mature ECs lose their specific protein expression, morphology, and polarity to acquire mesenchymal characteristics and has moved into focus as a possible source of these highly proliferative SM-like mesenchymal cells in PAH [
7]. Notably, induction of EndMT requires the coordinated action of multiple signaling cascades, induced by both circulating factors and tissue-specific stimuli [
8].
The transforming growth factor beta (TGFβ) family contains central drivers and modulators of the EndMT process and is essential in the control of the EC phenotype [
8]. Interestingly, imbalanced TGFβ signaling is a characteristic feature in all PAH subtypes that includes loss-of-function genetic mutations in components of the bone morphogenetic protein (BMP) signaling pathway (
i.e., ACVRL1,
BMPR1B,
BMPR2) and reduced expression of the BMP type-II receptor (BMPR2) in mutation-positive and -negative cases of PAH [
9]. This shift is associated with decreased BMP-dependent signaling and increased TGFβ-responsiveness in pulmonary ECs of PAH patients [
10]. Consequently, novel experimental treatment efforts aim to restore BMPR2 levels and consecutive downstream signaling to reinstate the balance in TGFβ/BMP activity [
11], for example, by administration of BMP ligands or agonists [
12‐
14].
Although initially discovered by their ability to induce ectopic bone formation in rodents [
15], BMPs have been unveiled as pleiotropic molecules, which play a central role in cell differentiation, organogenesis, vascular development, and vascular homeostasis [
16]. Particularly in ECs, BMP9, the ALK1 receptor high affinity ligand [
17], is generally described as a circulating vascular quiescence and maintenance factor that can exert hematopoietic, hepato-, osteo-, chondro-, and adipogenic functions in a highly context and concentration-dependent manner [
18]. In the mature endothelium, BMP9 appears to have anti-angiogenic and anti-apoptotic effects [
14,
18] and is a known inducer of EndMT during embryonic development and thereby, for instance, controls vascular remodeling and vascular wall-thickening [
7,
19]. However, BMP9 also serves as a pro-angiogenic and pro-tumorigenic factor in cancer cells demonstrating its pleiotropic roles in health and disease [
20].
In the context of PAH, recombinant BMP9 administration has been shown to induce BMPR2 expression in blood-derived circulating ECs from PAH patients carrying different heterozygous
BMPR2 mutations and has beneficial hemodynamic and anti-remodeling effects in PH animal surrogate models when applied preventively or therapeutically [
14]. However, the effects of BMPs on the primary endothelium are highly context-dependent [
21]. The concern that the same ligand might have opposite effects is illustrated by contradicting reports showing that genetic deletion or pharmacological inactivation of BMP9 protects rodents from experimental PH [
22], while a case study associates a homozygous nonsense mutation in
GDF2 (encoding for BMP9) with the development of PAH in infants [
23], and
BMPR2 loss-of-function mutations are known to alter the tissue microenvironment [
24].
To gain insights into the effect of BMP9 on the pulmonary vascular endothelium, in this manuscript, we comprehensively examine effects of BMP9 on control and PAH primary pulmonary EC signaling and phenotype. We identify a novel mechanism modulated through interleukin-6 (IL6) by which BMP9 triggers EndMT in PAH pulmonary ECs. Our discovery of the cell phenotype modulating function by combined action of IL6 and BMP9 will contribute to the understanding of the pathological mechanisms driving PAH-specific vascular changes and may eventually aid in the development of a treatment for this currently untreatable disease.
Material and methods
Cell cultures and in-vitro assays
The institutional review board (IRB) for human studies of the VU University Medical Center (Amsterdam, the Netherlands) approved the study protocols (non-WMO, 2012/306) and written informed consent was obtained from the subjects or their surrogates for the collection of materials and publication of results, if required. Microvascular ECs were isolated from pleura-free peripheral lung tissues, pulmonary artery ECs from rings of the
arteria pulmonalis, and circulating ECs from heparinized peripheral blood, as described previously [
25,
26]. Human PAH lung tissues were obtained from end-stage patients undergoing lung transplantations or from autopsies. Control tissues from lobectomies for suspected or proven non-small cell lung cancer (NSCLC) without PH were assessed by a pathologist and only normal tissues were used for cell isolations. Donor characteristics can be found in Table
1.
Table 1
Patient characteristics
MVECs used in the control group |
Ctrl01 | PCR, RNA-seq, IF, ELISA, ECIS | NSCLC, adenocarcinoma | – | – | No | F | 55 | Caucasian | Lob | No dilation of RV, RA, or LV |
Ctrl02 | PCR, RNA-seq, IF, ELISA | NSCLC, squamous cell carcinoma | 3.11 (100%) | 2.31 (98%) | No | M | 79 | Caucasian | Lob | No dilation of RV, RA, or LV |
Ctrl03 | PCR, RNA-seq, IF, ECIS | NSCLC | 5.3 (96%) | 4.39 (98%) | No | M | 42 | Caucasian | Lob | No dilation of RV, RA, or LV |
Ctrl04 | IF, ELISA, ECIS | NSCLC | 4.13 (110%) | 3.23 (110%) | No | F | 60 | Caucasian | Lob | No dilation of RV, RA, or LV |
Ctrl05 | PCR, RNA-seq, ECIS | NSCLC, squamous cell carcinoma | 2.75 (100%) | 1.17 (50%) | No | F | 61 | Caucasian | Lob | No dilation of RV, RA, or LV |
Ctrl06 | PCR, RNA-seq | Tumoral obstruction | – | – | Yes | M | 42 | Caucasian | Lob | Enlarged RV, small LV, enlarged RA |
MVECs used in the PAH group |
PAH01 | PCR, RNA-seq, ELISA | iPAH | 54 | – | 2.1 | F | 54 | Caucasian | Obd | PDE5-I, ERA, PGI2 |
PAH02 | PCR, RNA-seq, IF, ELISA, ECIS | hPAH (BMPR2) | 68 | – | 1.6 | F | 40 | Caucasian | Ltx | PDE5-I, ERA, PGI2 |
PAH03 | PCR, RNA-seq, ELISA, ECIS | iPAH | 43 | 620 | 2.1 | F | 42 | Caucasian | Ltx | PDE5-I, PGI2 |
PAH04 | PCR, RNA-seq, IF, ELISA, ECIS | iPAH | 89 | 1527 | 1.9 | F | 22 | Caucasian | Ltx | PDE5-I, ERA, PGI2 |
PAH05 | PCR, RNA-seq, IF, ELISA, ECIS | iPAH | 102 | 1375 | 3.4 | M | 21 | Caucasian | Ltx | PDE5-I, ERA, PGI2 |
ECs were purified by magnetic affinity cell sorting (MACS, Miltenyi Biotec) based on CD144 (VE-cadherin) antibody labeling and purity was ensured by regular FACS testing. Cells were cultured on 0.1% gelatin-coated standard cultureware (Corning) in ECM medium supplemented with 1% pen/strep, 1% endothelial cell growth supplement, 5% FCS (all ScienCell), and 1% non-essential amino acids (Biowest). Treatments were performed after 5 h preparative serum starvation with 1% FCS and without additional growth factors. Stimuli were made fresh in final concentrations of 1 ng/mL BMP9 (R&D Systems), 1 ng/mL TGFβ1 (Sigma), 10 ng/mL IL6 (BD Biosciences), and 10 ng/mL IL6 blocking antibody (mabg-hil6-3, InvivoGen).
Barrier function was determined by impedance spectroscopy with ECIS (Electric Cell-substrate Impedance Sensing, Applied Biophysics). Resistance was analyzed and modeling of cell–cell and cell–matrix strength carried out as described previously [
27]. ELISAs for IL6 on cell-free supernatants were carried out with the BD OptEIA human IL6 kit (BD Bioscience) and on human serum with the IL6 kit from Antigenix following the manufacturer’s instructions.
Real-time polymerase chain reaction (RT-PCR)
RNA was isolated with the miRNeasy mini kit (Qiagen), cDNA synthesis performed with the iScript cDNA synthesis kit (Bio-Rad) on a 2720 Thermal Cycler (Applied BioSystems), and RT-PCR carried out with iQ SYBR green supermix on a CFX384 Real-Time System (all Bio-Rad) following the manufacturer’s instructions. Primer details (Sigma-Aldrich) can be found in Table
2.
Table 2
Primer list for human genes
NM_001204.6 | BMPR2_Fwd | GTCCTGGATGGCAGCAGTAT |
BMPR2_Rev | CCAGCGATTCAGTGGAGATGA |
NM_002165.3 | ID1_Fwd | CTGCTCTACGACATGAACGG |
ID1_Rev | GAAGGTCCCTGATGTAGTCGAT |
NM_002167.4 | ID3_Fwd | CACCTCCAGAACGCAGGTGCTG |
ID3_Rev | AGGGCGAAGTTGGGGCCCAT |
NM_000602.4 | PAI1_Fwd | CAATCGCAAGGCACCTCTGA |
PAI1_Rev | TTCACCAAAGACAAGGGCCA |
NM_005985.3 | SNAI1_Fwd | ACCACTATGCCGCGCTCTT |
SNAI1_Rev | GGTCGTAGGGCTGCTGGAA |
NM_003068.4 | SNAI2_Fwd | TCGGACCCACACATTACCTT |
SNA2_Rev | TGAGCCCTCAGATTTGACCT |
NM_000600.4 | IL6_Fwd | ACAGCCACTCACCTCTTCAG |
IL6_Rev | GCAAGTCTCCTCATTGAATCCAG |
NM_001002.3 House Keeping Gene | P0_Fwd | TCGACAATGGCAGCATCTAC |
P0_Rev | ATCCGTCTCCACAGACAAGG |
NM_001289746.1 House Keeping Gene | GAPDH_Fwd | GGTCTCCTCTGACTTCAACA |
GAPDH_Rev | AGCCAAATTCGTTGTCATAC |
NR_146119.1; NR_145820.1 House Keeping Gene | 18S_Fwd | AACGGCTACCACATCCAAGG |
18S_Rev | CAGCTAAGAGCATCGAGGGG |
Western blot
Gel electrophoresis was run with NuPAGE 4–12% Bis–Tris pre-cast gels and the accompanying buffers (Invitrogen) following the manufacturer’s instructions. Antibodies against BMPR2 (1:2000, Ma5-15827, Thermo Fisher Scientific), pSMAD1/5/9 (1:1000, 13820, Cell Signaling), pSMAD2 (1:1000, gift from Prof. ten Dijke at LUMC Leiden), and GAPDH (1:10000, g9295, Sigma-Aldrich) were used for protein detection.
Global transcriptomics (RNA-seq) and analysis
Serum-starved microvascular lung ECs (5 h at 1% FCS, no growth factors) were either stimulated with BMP9 (for 90 min or 24 h) or left untreated. RNA was isolated with the miRNAeasy mini kit (Quiagen). Total RNA was purified using MagMAX-96 total RNA isolation kit (Ambion), in which genomic DNA was removed. mRNA was purified from total RNA using Dynabeads mRNA purification kit (Invitrogen). Strand-specific RNA sequencing libraries were prepared using ScriptSeq mRNA-seq library preparation kit (Epicenter). Sequencing was performed on HiSeq2000 (Illumina) by a multiplexed, single-read run with 33 cycles. Reads were mapped to the human genome hg38. Differential gene expression analysis was performed by the Medical Statistics and Bioinformatics core at LUMC using normalized log-transformed counts per gene with appropriate weights per observation in a fdr multiple testing corrected multivariate regression model. The model tested which genes are differentially expressed between the three conditions (starved, 90-min, or 24-h stimulation) in at least one donor group (control
vs. PAH). Gene Set Enrichment Analysis (GSEA) was run with the pre-ranked tool [
28] on the adjusted log2-fold gene lists. Pathway enrichment was defined by FDR < 0.05 and
p < 0.001. Enrichment map visualization (network graph) was done with the Enrichment Map Pipeline collection in Cytoscape version 3.6.1.
Immunofluorescence staining
Human ECs were fixed in warm 4% paraformaldehyde for 20 min at room temperature (RT), quenched with 2 mg/mL glycine, permeabilized with 0.2% Triton X-100 for 10 min at RT, blocked with 5% BSA, and labeled with VE-cadherin (1:500, 2158, Cell Signaling), SM22α (1:500, ab14106, Abcam)-specific antibodies, and/or Rhodamine-Phalloidin (1:1000, R415, Invitrogen). Samples were preserved in ProLong Gold anti-fading agent with DAPI (Thermo Fisher Scientific). Imaging was done on a Nikon A1 confocal laser microscope at ×60 magnification. Image quantification was performed with ImageJ (NIH) by measuring VE-cadherin and SM22α intensity of a total of nine individual cells per donor at three random locations in the culture well. The resulting intensity values were normalized to the mean intensity of the unstimulated controls within one experiment. F-actin orientation was analyzed using the directionality function in ImageJ on images from three random locations in the culture.
Statistics
Individual cell culture experiments were repeated at least three times, with different combinations of available donors. Numbers of used donors are indicated within figures or by n in figure legends. Experimental data were analyzed by Student’s t tests, multiple corrected t tests, and one-way or two-way ANOVAs where applicable. The appropriate statistical tests are specified in the figure legends. Data were considered significantly different at p values ≤ 0.05. Data were visualized using GraphPad Prism version 7 (GraphPad Software). If not indicated differently, data are presented as mean ± standard deviation.
Discussion
In this study, we demonstrate that PAH microvascular lung ECs exhibited a significantly higher induction of
BMPR2 expression and the BMP target gene
ID1 upon stimulation with BMP9 than control pulmonary ECs and a distinctly different activation pattern than found in ECFCs from patients and controls. This suggests that tissue microenvironment and spatial differences/dysfunctions in the lung may control activation and outcome of BMP-dependent signaling in PAH. The distinct responses of PAH pulmonary ECs in comparison to controls were not due to differential BMPR2 nor downstream SMAD activation, which may indicate that alternative adaptive mechanisms fine-tune the response of microvascular ECs to BMP ligands in the lungs. We approached this hypothesis performing unbiased transcriptome analysis in control and PAH MVECs stimulated with BMP9. Our study revealed that most genes were similarly regulated by BMP9 in control and PAH cells at early time points, but after 24 h this regulatory pattern was lost in PAH cells pointing towards altered homeostatic or negative feedback signaling in PAH. Here, we identified a persistent enrichment in genes previously associated with EndMT and epithelial-to-mesenchymal transition (EMT) in the PAH lung ECs, including the EndMT master regulators
SNAI1 and
SNAI2 that are activated early in the EndMT process [
7]. Accordingly, BMP9 effectively decreased the concentration of the EC marker VE-cadherin at cell–cell junctions while inducing the expression of transgelin (SM22α) in PAH cells leading to compromised endothelial barrier function, while in controls BMP9 even stabilized the barrier. Our pathway analysis identified IL6-dependent signaling to be an underlying mechanism that primes the PAH microvascular pulmonary ECs and enables EndMT upon BMP9 stimulation. Finally, using an IL6-capturing antibody, we demonstrated that the induction of EndMT and consequent loss of barrier function in PAH pulmonary MVECs is mediated by IL6 and triggered by BMP9 (Fig.
5b). Interestingly, we demonstrated that the combined action of IL6 and BMP9 may be a common and robust mechanism in cells from PAH donors representing the two most typical patient subtypes i) younger patients (before their 50s) with more severe hemodynamic impairments but better survival, and ii) an older subtype with more comorbidities [
31].
EndMT is a highly integrative process that can result from tissue-specific pathway crosstalk induced by TGFβ family members, Notch and Wnt ligands, mechanical forces, growth factors, hypoxia, and inflammation [
8]. The relative importance and order of activation depend on stimulus and/or underlying (patho)biology. The pro-inflammatory cytokine IL6 was previously shown to contribute to PH by commanding a proliferative and apoptosis-resistant pulmonary vasculature phenotype, to decrease BMPR2 levels, to exaggerate effects of chronic hypoxia, and to worsen vascular remodeling in BMPR2-deficient animals [
32,
33]. Increased human serum IL6 protein levels are found across the systemic and lung circulation of PAH patients with mild-to-severe disease and are correlated with clinical phenotypes and outcomes in PAH subgroups [
34,
35]. Additionally, we have shown that pro- and anti-inflammatory cytokine responses in MVECs of PAH patients are impaired [
36]. In this study, however, we demonstrate that BMP9 or IL6 alone are not sufficient to induce full mesenchymal trans-differentiation, as previously suggested [
37‐
39], wherefore we postulate that IL6 plays a mechanistic respectively modulating role. In accordance, we recently discovered that TNFα and IL‐1β induce EndMT in human primary aortic ECs by downregulation of BMPR2 which causes an altered signaling response to BMP9 and thereby sensitizing the cells for BMP9-induced osteogenic differentiation [
40]. Similarly, BMP9 alone was reported to have no effect on monocyte and neutrophil recruitment to the vascular endothelium but amplifies the effects of pro-inflammatory stimuli like TNFα and LPS by priming the EC response [
39,
41]. We and others thereby collectively hypothesize that imbalanced inflammatory signaling reactivates developmental programs that—in the diseased
milieu of a PAH patient lung—continuously switches the EC phenotype between different pre-cursor states [
42]. These transitional cells can easily be tipped towards one cell fate or another in response to injury or other triggers, as in this case BMP9.
Postnatally, EMT and EndMT are involved in the general lung repair program [
43] but EndMT is also implicated in numerous pathogenesis including fibrotic diseases, cancer, atherosclerosis, and heterotopic ossification [
8,
30,
44]. In PAH, EndMT was shown to potentially give rise to transitional cells co-expressing endothelial and mesenchymal markers that are found in up to 5% of the diseased lungs and abundantly within the typical vascular lesions [
6,
37]. These transitional cells exert high proliferation rates with a migratory or even invasive phenotype that weakens the EC barrier [
4]. However, due to the absence of EndMT-specific inhibitors it remains to be seen whether EndMT mediates the progression of PAH and aforementioned disorders or reflects an aberrant response to pathological stimuli in an attempt to initiate vascular repair and restore physiological function.
In conclusion, we provide evidence that BMP9-triggered EndMT signaling in conjunction with sustained pro-inflammatory, pro-hypoxic, and pro-apoptotic signaling mediated through IL6 causes an aberrant phenotypic trans-differentiation of the lung microvascular endothelium in PAH. Interestingly, despite all differences in age, gender, genetic background, and hemodynamics all PAH donor MVECs show similar responses to BMP9 going into EndMT in an IL6-dependent manner. Hence, we identify IL6 as a common factor modulating responses to BMP9 in end-stage PAH irrespective of the subtype. Accordingly, our study suggests that further investigations for the therapeutic use of BMP agonists in PAH should be pursued with attention to the features of EndMT as a possible indicator of long-term impact. Given the current findings, co-administration of anti-inflammatory therapy, such as an IL6 neutralizing antibody, could potentially mitigate inadvertent side effects of experimental drug candidates and might be considered as an add-on treatment for all subgroups of patients exerting high IL6 serum levels.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.