Background
Enterovirus 71, a positive-stranded RNA virus, is highly infectious and can cause hand-foot-and-mouth disease (HFMD), herpangina, neurological diseases with potentially more serious complications such as encephalitis, aseptic meningitis, brain stem encephalitis (BE) in infants and young children. Many of patients died from fulminant pulmonary edema (PE) or hemorrhage, which was based on nervous system injury [
1,
2]. In recent years, its prevalence in Malaysia, Taiwan, Singapore, China, Korea and so on, and continuous spreading widely provoked global concern [
3‐
7].
Although the pathogenesis of neurogenic PE caused by EV71 remains unclear, host factors especially host immune response rather than EV71 itself or its genotype may be one of important determinants for the disease severity [
1,
8]. Excessive proinflammatory cytokine and chemokine responses were thought to contribute to the severity of EV71 infection [
9]. Current findings implied that the inflammatory cytokines or chemokines are probably synthesized by infiltrated mononuclear cells (macrophages or T cells) in tissues or neuron-surrounding cells, such as microglia (the resident macrophages in central nervous system (CNS)) or astrocytes in EV71 infection [
9‐
11]. Since monocyte-derived macrophages and microglia are derived from the common precursors in the bone marrow, express similar surface markers and perform roughly similar functions [
12], both of them may be involved in the immune response to EV71 infection.
Previous studies have identified that the immune cells such as human peripheral blood mononuclear cells, human T cell line (Jurkat), monocytic cells, human immature dendritic cells can be infected with EV71 [
13‐
15]. Macrophages play an important role in the innate immunity system, however, the interaction between macrophages and EV71 remains unknown. Furthermore, Toll-like receptors (TLRs) and RIG-I-like helicases (RLHs) recognize a number of viruses resulting in the activation of an innate immunity response that induce secretion of proinflammatory cytokines and chemokines [
16‐
19]. In this study, we focused on the proinflammatory cytokine and chemokine responses of MDMs to EV71 infection. And we also investigated whether TLRs and RLHs were involved in EV71-infected MDMs, and explored the possible mechanisms of inflammatory responses to EV71 infection.
Discussion
Macrophages, which are shown to support the infection of various viruses including HIV-1, influenza viruses, and poliovirus and so on, play a critical role in presentation of antigens, pathogen clearance, and induction of inflammation during the early phase of viral infection [
21‐
23]. In this study, both viral gene and antigen of EV71 were detected. The increases of virus yields and the number of viral gene copies were observed in EV71-infected MDMs between the 6-h and 48-h POI. Excess cytokine and chemokine responses of MDMs were triggered by EV71. These findings suggested that macrophages may be not only the target cells but also the effectors during EV71 infection.
It is controversial whether TNF-α was involved in fatal EV71 infection. Significant or minor change of blood TNF-α in EV71 patient with both encephalitis and PE was reported by different clinical studies [
24,
25]. Significant stronger release of TNF-α from EV71-infected MDMs at 12-h POI than 24-h POI in the study, implying that TNF-α was induced by EV71 infection at early stage and maybe involved in its pathology. Consistent with clinical features of EV71 patients with encephalitis and PE, who are presented with higher levels of the proinflammatory cytokines in blood [
9,
24], IL-6, IL-1β and TNF-α were induced in EV71-infected MDMs. These proinflammatory cytokines are thought to be the potent pyrogens inducing fever, and the magnitude of febrile response correlates with the level of virus shedding in human and animals [
26]. Notably, a transient increase of blood brain barrier (BBB) permeability and its injury were found at early stage of EV71 infection [
27]. The pathology may be due to an augmentation of systemic and local TNF-α production, which exhibits detrimental effects by enhancing cell infiltration, cytopathic damage, or functioning as a paracellular pathway for the virus across the BBB [
28]. Furthermore, the subsequent responses of acute phase proteins and chemokine activations mediated by IL-6, IL-1β and TNF-α could exacerbate virus induced inflammation and pathology [
29]. Therefore, the rapid and strong proinflammatory response of MDMs to EV71 may partially explain the clinical severity.
Macrophages or plasmacytoid DCs, specialized in secreting large amounts of type I IFN after virus infection, play an important role in viral infection. However, minor change of IFN-α in EV71-infected MDMs was detected in our study. It is likely that the 3C protein of EV71 virus inhibits type I interferon activation by viral nuclear acid or RIG-I signalling [
30]. Although elevated level of IFN-γ in both plasma and cerebrospinal fluid was found in patients with PE [
10], the IFN-γ from EV71-infected MDMs was undetectable here. The discrepancy may be a result of the main cellular source of IFN-γ
in vivo from activated T and NK cells other than macrophages. A series of IFN-γ-responsive and inflammatory chemokines such as RANTES, IP-10 and IL-8 in MDMs were triggered by EV71 virus. Not only live- but also UV-inactivated EV71 can induce IL-8 releasing from MDMs, which suggested that viral proteins may also be involved in inducing of IL-8. IL-8 is a potent chemoattractant and activator of neutrophils, one of the major immune cells responsible for inflammation of CNS during meningitis or encephalitis [
31]. Our
in vitro findings support the clinical findings that a higher total WBC count, absolute neutrophil count and elevated IL-8 and IP-10 level in patients with BE or PE [
11,
25].
TLRs and RLHs recognize distinct ligands and trigger host immune response in different virus infection [
32]. The recognition of human rhinovirus, human parechovirus 1, rotavirus or coxsackie B virus by different host cells are mediated through elevated TLR2, 7, 8 and (or) Mda5 expression, which induce secretion of proinflammatory cytokines, chemokines, and interferons [
16‐
19]. When TLR2, TLR7 and TLR8 were silenced, there was a considerable decrease in cytokine secretion in human airway epithelial cells with HRV-6 infection [
18]. In our study, elevated TLR2, TLR7 and TLR8 expressions as well as increased proinflammatory cytokines and chemokines were observed in EV71-infected MDMs. Furthermore, enhanced IL-8 and TLR2 mRNA expression were also found in UV-inactivated virus treated-MDMs. It is likely that the interaction between TLR2 on cell surface and viral proteins rather than viral RNAs is necessary for the activation of MDMs. Significant up-regulations of mRNA for TLR7 and TLR8 were observed at different time points, and it suggested that there were differential kinetics between TLR7 and TLR8 involvements in EV71-infected MDMs. These results indicated the cytokine productions in EV71-infected MDMs may be partly through the activation of TLR2, TLR7 and (or) TLR8. Further investigations such as gene knockout experiments are needed to determine the exact roles of them.
As documented previously, younger children less than 5-year-old were the most susceptible groups to EV71 and usually presented with severe infection [
3]. The underlying mechanisms for the severity remain unknown. And enhanced proinflammatory cytokines and chemokines were indeed found in children patients with encephalitis or PE [
9,
11,
24]. Although there is differential expression level of chemokine receptors on adult and neonatal MDMs [
33], one of possible factors for the age-related severity in avian influenza virus infection, a similar cytokines/chemokines profile was found in influenza virus-infected adult and neonatal MDMs and the levels of most of the cytokines/chemokines were comparable [
23]. Moreover, the adults can also be infected with EV71 and the clinical severity in adult patients with acute encephalitis was similar to those of EV71 infection in children [
34]. Therefore, the findings on adult MDMs infection model here may partially reflect natural
in vivo infection.
Methods
Isolation and culture of monocyte-derived macrophages
The study was approved for human subject protection by the Ethics Committee of National Institute for Viral Disease Control and Prevention, China CDC. Following informed consent was written by participants.
Peripheral blood obtained from 8 healthy blood donors aged from 20 to 40 years old. Peripheral blood mononuclear cells (PBMCs) were isolated by a Ficoll-Paque density gradient (Pharmacia Biotech, Uppsala, Sweden) to remove erythrocytes, platelets, and cell debris. Monocytes were isolated by plastic adherence, harvested, counted and seeded on tissue culture plates in RPMI 1640 (Invitrogen Life Technologies, Great Island, NY, USA) medium supplemented with 10% heat-inactivated autologous plasma at 106cells/ml. The purity of monocytes was determined by flow cytometry with anti-CD14 monoclonal antibody (Mab, PharMingen, San Diego, CA, USA) and was consistently above 90%. The monocytes were reseed with 2-5 × 105 cells per well onto a 24 well culture plate, and were allowed to differentiate into MDMs for 10–14 days in vitro.
Infection of MDMs with EV71
Enterovirus 71 virus was propagated in RD cells (obtained from ATCC) in DMEM containing 2% fetal bovine serum (FBS, Invitrogen, Grand Island, NY, USA) and incubated at 35°C with 5%CO2. When 80% of the cells showed the typical enteroviral cytopathic effect (CPE), the infected cells were harvested after being frozen and thawed for three times. Cell debris was removed by centrifugation and filtration using a 0.22 μm membrane filter (Millipore, Billerica, CA). EV71 viruses were inactivated using ultraviolet radiation 3000 mj/cm2, 30 mins on ice (UV-inactivated EV71). Differentiated MDMs were infected by EV71 and UV-inactivated EV71 at MOI (multiplicity of infection) of 0.1, 0.5, 1 and 5. This is taken to be 0-h point of infection (POI.) for the experiments described below. Virus titters were performed by measuring the 50% tissue culture infective dose (TCID50) on Vero cells and calculated by using the Reed and Muench formula.
Immunofluorescence assay of viral VP1 protein in infected cells
MDMs were fixed with methanol: acetone (1:1) for 5 min. The cell monolayer was incubated by anti-EV71 VP1 monoclonal antibody (MAB979, Millipore, Billerica, CA) at room temperature for 60 min, and followed by labelling FITC-conjugated goat anti-mouse IgG for 1-h. After being completely washed, the cells were observed under a fluorescence microscope.
Quantification of mRNA by real-time RT-PCR
Infected MDMs cultured in macrophage serum-free medium (Invitrogen, Grand Island, NY, USA) were harvested at 2-h, 6-h, 12-h, 24-h and 48-h POI. Total RNAs were extracted using QIAGEN RNeasy mini kit(QIAGEN, Hilden, Germany). Reverse transcription was performed on DNase-treated total RNA. The cDNA was synthesized from mRNA with oligo(dT)
12–18 primer and Superscript II reverse transcriptase (Invitrogen, Grand Island, NY, USA). Specific primers and probes used in the real-time PCR assay were listed in Table
1 and Q-PCR were performed by Rote-Gene 3000 Sequence Detection System (QIAGEN, Hilden, Germany). Viral gene copies were quantified on the basis of a TaqMan Probes fluorescence signal after PCR. We expressed viral gene variability as the number of target gene copies per 10
4copies of β-actin. The relative changes of other human genes were analyzed by SYBR green real-time PCR. Dissociation curve analysis was performed after each assay, to ensure specific target detection.
Table 1
Primer sequences and probes used in real-time PCR assay
EV71 | (R) CCCGCTCTGCTGAAGAAACT | 89 | AF302996 |
| (F)AGTGATGAGAGTATGATTGAGACACG | | |
| (P) TCGCACAGCACAGCTGAGACCACTC | | |
β-actin | (R) CAAGTACTCCGTGTGGATCG | 90 | NM_001101.3 |
| (F) GGATGCAGAAGGAGATCACTG | | |
| (P) CCCTGGCACCCAGCACAATGA | | |
RIG-1 | (R) CCTCTGCACTGTTGCTCAGGAC | 192 | NM_004585.3 |
| (F) CTCTTGGCTTCGAGATGGCTTC | | |
MDA5 | (R) ATTGGTGACGAGACCATAACGGATA | 196 | NM_022168.2 |
| (F) AGGAGTCAAAGCCCACCATCTG | | |
TLR2 | (R) CACAAAGTATGTGGCATTGTCCAG | 158 | NM_003264.3 |
| (F) GTGTTGCAAGCAGGATCCAAAG | | |
TLR3 | (R) AGTGCCGTCTATTTGCCACACA | 181 | NM_003265.2 |
| (F) AACAGTGCACTTGGTGGTGGAG | | |
TLR4 | (R) ATGCGGACACACACACTTTCAAATA | 143 | NM_138554.3 |
| (F) TTGAGCAGGTCTAGGGTGATTGAAC | | |
TLR6 | (R) AGCCTTCAGCTTGTGGTACTTGTTG | 138 | NM_006068.2 |
| (F) CAGAGTGAGTGGTGCCATTACGA | | |
TLR7 | (R) TCTTCAACCAGACCTCTACATTCCA | 172 | NM_016562.3 |
| (F) GGAACATCCAGAGTGACATCACAG | | |
TLR8 | (R) GATTGCTGCACTCTGCAATAACTGA | 196 | NM_138636.3 |
| (F) GCTGCTGCAAGTTACGGAATGA | | |
TLR9 | (R) CAGGGCCTTCAGCTGGTTTC | 97 | NM_017442.2 |
| (F) CCGTGACAATTACCTGGCCTTC | | |
TLR10 | (R) TGTGTTGCAAGATAATTCGTGGAGA | 103 | NM_001017388.1 |
| (F) CATGATGGTTGGATGGTCAGATTC | | |
β-actin | (R) CTAAGTCATAGTCCGCCTAGAAGCA | 186 | NM_001101.3 |
| (F) TGGCACCCAGCACAATGAA | | |
Measurement of cytokines
Concentration of cytokines from culture supernatants were determined by Cytometric Bead Array(CBA). IL-1β, IL-6, TNF-α, IFN-α, IFN-γ, IP-10, IL-8, RANTES, MCP-1, MIG Flex Set reagents (BD Biosciences, San Diego, CA) were used to measure cytokines by flow cytometry according to the manufacturer’s protocol. The results are presented as the means of assays performed in duplicate wells. Data were analyzed by using FCAP Array 0.1 and BD Cytometric Bead Array 1.4 software assay. The theoretical limits of detection were listed as follows: IL-1β(2.3 pg/ml), IL-6 (1.6 pg/ml), TNF-α (1.2 pg/ml), IFN-α (1.5 pg/ml), IFN-γ(1.8 pg/ml), IP-10 (0.5 pg/ml), IL-8 (1.2 pg/ml), RANTES (0.002 pg/ml), MCP-1 (1.3 pg/ml), MIG (1.1 pg/ml).
Statistical analysis
Statistical significance was determined by Two-Way ANOVA or the Mann–Whitney rank sum tests. All analyses were performed using the Statistical Package for Social Sciences (SPSS13.0) software (SPSS Inc, IL, USA). A probability P < 0.05 was considered statistically significant.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
Conceived and designed the experiments: ZD, YJ, XG and JZ. Performed the experiments: XG and JZ. Analyzed the data: XG and JZ. Contributed reagents/materials/analysis tools: WZ, NL, JL and LL. Wrote the paper: XG, JZ, WZ and ZD. All authors read and approved the final manuscript.