Background
Hepatosteatosis, i.e. excess accumulation of triglyceride (TG) in the liver, is the defining feature of non-alcoholic fatty liver disease (NAFLD). As the epidemic of obesity has increased worldwide, NAFLD become a critical public health issue because of its high prevalence, potential progression to severe liver disease, and association with serious metabolic abnormalities including type 2 diabetes mellitus, metabolic syndrome, and coronary heart disease [
1]. Previously considered as an abnormality confined to adult populations, NAFLD, is now an alarming health issue among obese children [
2]. Hence, finding an effective NAFLD therapy is necessary to alleviate the health burden caused by this disease.
Insulin resistance is intimately associated with the pathogenesis of NAFLD, as evidenced by patho-physiologic studies [
3]–[
5]. Insulin binds to its receptor, which results in the tyrosine phosphorylation of insulin receptor substrate (IRS)-1and IRS-2, and subsequently activates downstream molecules such as phosphoinositide 3-kinase, protein kinase B (PKB/Akt), etc. [
6]. Impaired insulin signalling, especially the paradox of selective hepatic insulin resistance of failing to suppress glucose production but preserved insulin sensitivity in lipid synthesis aggravates insulin resistance and contributes to the development of NAFLD, while regimens that reverse insulin resistance can ameliorate steatosis [
7]. Although numerous studies have focused on NAFLD, suggested treatments (thiazolidinediones, statins) do not always produce satisfied results. Calorie restriction and exercise can treat simple or moderate NAFLD effectively, but target drugs are needed when the disease becomes progressive and severe.
For centuries, natural herbal products derived from systemic Traditional Chinese Medicine (TCM) theory and practice have been used to treat nearly all kinds of ailments in China. Formulae, the form of prescription in TCM, typically consists of several medicinal herbs, of which one represents a principal component, and others serve as an adjuvant in assisting the effects or facilitating the delivery of the principal component. Entirely based on TCM theory and NAFLD pathology, Salvia-Nelumbinis naturalis (SNN) formulae (initially called Jiangzhi Granula) was designed, in which
Salviae as being the principal element and
Nelumbinis,
Rhizoma Polygoni Cuspidati,
Herba Artemisiae Scopariae the ancillary components. We have shown that administration of SNN formulae, together with behavioral intervention, to patients with NAFLD for 24 weeks gave rise to a higher remission rate as compared to behavioral intervention alone (76.56% versus 52.54%) [
8]. In addition, with all the cases observed, SNN did not demonstrate any adverse effect during the whole process [
8]. These promising clinical observations of the SNN formulae in ameliorating NAFLD have prompted us to define mechanisms responsible for SNN action. An UPLC-MS method has been established to determine the main active components of SNN [
9], thus ensuring standardized application in clinical and preclinical studies.
High calorie (HC) diet is a method that is extensively used to induce hepatic steatosis and insulin resistance in rats and mice [
10]–[
12], which resemble characteristics of NAFLD in human. In this study, a rat model of HC-induced NAFLD was used to examine the influence of the extract of SNN on NAFLD and its potential role in improving insulin resistance.
Methods
Materials
HepG2 cells were purchased from the American Type Culture Collection (ATCC) bioresource center (Manassas, VA, USA). Dulbecco’s modified Eagle’s medium (DMEM), fetal bovine serum (FBS), and penicillin and streptomycin were from Biowest (Nuaillé, France). The main chemical components of the SNN extract protopanaxadiol, tanshinone IIA, gypenoside, Salvianic acid A sodium, and Salvianolic acid B were obtained from Shanghai Winherb Medical Sci & Tech Development Co. Ltd. (Shanghai, China). Pioglitazone were purchased from Sigma (St. Louis, MO, USA). All other reagents were of analytical grade.
Cell culture
HepG2 were cultured in DMEM supplemented with 10% heat-inactivated fetal FBS, penicillin at 100 U/mL, and streptomycin at 100 μg/mL at 37°C in a 5% CO2 atmosphere. The experiments, started when the cells grew to 80-90% confluence. Cellular steatosis was induced as previously described [
13], in brief, HepG2 cells were seeded on 6-well plates 1× 10
5 cells/well, stimulated by a mixture of 1 mmol/L FFA (the ratio of oleate to palmitate is 2:1) in DMEM containing 1% BSA for 24 h. The steatotic cells were then treated with the chemical components (at 5, 50, and 500 μmol/L concentration for each component) for another 24 h. The cells were stained with Oil-Red O and imaged.
The
Salvia-Nelumbinisnaturalis(SNN) formula composed of
Salviae (Danshen in China) as the principal element and
Nelumbinis (Heye in China)
, Rhizoma Polygoni Cuspidati (Huzhang in China)
, Herba Artemisiae Scopariae (Yinchen in China) as ancillary components. The plant specimens were under a micro plant grinding machine, triturated and blended to powder, and the powder was then mixed with water/methanol (5:95, V/V) by sonication (42 kHz, 30 min) using an ultrasonic processor as described previously [
9]. The main chemical components of the SNN extract has been determined by UPLC-MS system in previous publications [
9].
Animals and study design
Male Wistar rats were obtained from Slac Animal Laboratories (Shanghai, China), and housed under a standard 12-h light–dark cycle (lights on at 7:00 AM) with access to food and water ad libitum. After approximately 1-week acclimation, rats were placed on either standard chow or HC (15% fat, 15% sucrose and 2% cholesterol) diet for up to 12 weeks. During the last 4-week dieting, rats on HC diet were divided into four groups – one group continued on HC diet and the remainder three groups were administered (through oral gavage, daily) with pioglitazone (10 mg/kg body weight), Simvastatin (4 mg/kg), and SNN extract (600 mg/kg), respectively. Oral gavage of saline was applied to control rats. The experimental protocols were approved by Shanghai University of Traditional Chinese Medicine. Rats were housed in a pathogen free environment, and body weight and 24-h food intake were measured weekly.
Oral glucose tolerance test and insulin tolerance test
Oral glucose tolerance test (OGTT) and insulin tolerance test (ITT)were performed with rats at the end of dieting using previously described methods [
14]. Briefly, rats were fasted for 6 h after the start of the light cycle, then orally administered with glucose (1.5 g/kg body weight, for OGTT) or intraperitoneally administrtered with insulin (0.75u/kg body weight, for ITT), tail-vein blood samples were collected at baseline and at indicated time intervals (15, 30, 60, 90, and 120 min) after glucose/insulin administration. Blood glucose levels were determined with a diabetes monitoring strip (Lifescan One Touch, IN). The curve was drawn and the area under the curve (AUC) was calculated.
Serum biochemical analysis
After fasting for 12 h, rats were anaesthetized with sodium pentobarbital (100 mg/kg) and sacrificed, and blood was collected from aorta abdominalis. Serum TG, total cholesterol (TC), high density lipid-cholesterol (HDL-c), low density lipid-cholesterol (LDL-c), free fatty acids (FFA), fasting blood glucose (FBG), almandine aminotransferase (ALT), and aspartate aminotransferase (AST) were analyzed using the Hitachi full-automatic system. Fasting insulin (FIN) was measured using the standard radio-immunity kits (Puerweiye Bioengineering Institute, Beijing, China).
Hepatic histology assessment
Liver sections were stained with Hematoxylin and eosin (HE) and Oil-Red O (Sigma, St. Louis, MO), the procedures were performed according to previously describe methods [
15]. Briefly, the liver tissues were fixed in 10% neutral buffered formalin for 24 h, dehydrated and embedded in paraffin, the sections were cut, deparaffinized and stained with HE. Snap frozen tissues were placed in optimal cutting temperature compound and then sectioned and stained with Oil-Red O.
Hepatic lipid and glycogen content
Liver TG was estimated as described previously [
16]. Briefly, liver tissue (200 mg) was homogenized in 3 ml of ethanol-acetone (1:1) mixture. The homogenate was extracted over night at 4°C, and centrifuged for 15 min at 3,000 rpm at 4°C. The organic layer was removed, TG and cholesterol were measured using commercial kits (Kangtai Bioengineering Institute, Beijing, China). A standard kit (Jianchen tech, Nanjing, China) was used to determine the hepatic glycogen concentration.
RNA analysis
Total RNA was extracted from liver and hypothalamic tissues by using a TRIzol Reagent (Invitrogen Corp., Carlsbad, CA) following the manufacturer’s instructions. A reverse-transcription system (Promega Corp., Madison, WI) was then used to transcribe the RNA. Semi-quantitative reverse transcription polymerase chain reaction method was performed using Mastercycler (Eppendorf, Inc., Germany). The primer sequences are shown in Table
1. The mRNA levels of all genes were normalized using β-actin as an internal control.
Table 1
Sequences of the primers used for amplification of mRNA by PCR
InsR | TCTTCAGGGCAATGTCGTTC | GCTCCTATGCTCTGGTGTCA |
IRS1 | TGCTGGTGGAAGAGGAGG | TGGACAAACGGAGTAGGG |
IRS2 | GACCAAGTCGGTGAGTGC | GCCCGAACCTCAATAACA |
β-actin | CTGGAAGGTGGACAGTGAG | GAGGGAAATCGTGCGTGAC |
Tissue sampling and western blot analyses
Frozen liver and hypothalamic tissues were homogenized in Tissue Protein Extraction Reagent (Pierce Biotechnology, Inc., Rockford, USA), with the addition of protease inhibitor (Roche, Nutley, USA) and phosphatase inhibitor cocktail (Roche, Nutley, USA). Protein concentrations were determined using the bicinchoninic assay reagents and the micro-bicinchoninic assay method (Pierce Biotechnology, Inc. Rockford, USA). For Western blot analysis, 100 μg of protein were fractionated by 8-12% SDS-PAGE, transferred onto a PVDF membrane (Bio-Rad, Hercules, CA), Membranes were blocked with 5% skim milk in Tris-buffered saline and probed with target primary and secondary antibodies. Total and phosphorylated InsR (Tyr1131), IRS1 (Ser302), Akt (Ser473) and SOCS3 antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA), PKCε antibody was from Boster company (Wuhan, China). β-actin and secondary antibodies (from mouse or rabbit) conjugated to peroxidase were purchased from Santa Cruz Biotechnology. The targeted proteins were detected with ECL Detection Kit (Millipore, Billerica, USA), images were taken and qualified by Gel-Pro system (Tanon Technologies).For western blot analysis, the amount of protein loaded was confirmed by the Bradford method, and equal loading was verified by staining with Ponceau S reagent (Sigma Chemical Co.) and by determining the signal of β-actin.
Statistical analysis
For each outcome measure, a one-way analysis of variance was performed (SPSS 18.0) for each animal group studied (n = 8). A significant main effect (p < 0.05 or p < 0.01) was followed-up with Student-Newman-Kuel post hoc comparisons. Values are presented as means ± standard error (SE), and p < 0.05 denotes a statistically significant difference.
Discussion
Natural plant products provide a number of promising therapeutic agents. TCM uses a large variety of such herbal products and provides a rational prescription approach that targets the pattern of the syndrome, which is the essence of its therapeutic strategy. A lipid-lowering agent SNN was designed based on the characteristics of NAFLD and on TCM theory. Clinical studies confirmed SNN as a therapeutic option for the development and progression of NAFLD [
20]. The current study has demonstrated the SNN chemical components can reduce FFA-induced cellular steatosis. While HC diet-induced NAFLD rats exhibited dyslipidemia, hyperinsulinemia, and insulin resistance with concomitant hepatic steatosis, SNN reduced serum levels of LDL-c, and hepatic levels of TG with an attenuation of hepatic steatosis in HC diet-induced rats. These results together indicate that SNN is an effective drug for treating NAFLD.
Hepatic steatosis is the hallmark of NAFLD, and TG accumulation in hepatocytes is considered to be the major pathogenic trigger in the development of NAFLD [
21]. In the current study, SNN components could improve FFA-induced steatosis in HepG2 cells, and animal studies showed that SNN could significantly attenuate the HC diet-induced hepatic steatosis and the lipid accumulation, both of which confirmed the therapeutic effect of SNN. Liver also overproduces several atherogenic factors under nutritional stress [
22],[
23], in this study, the levels of and LDL-c were significantly decreased in SNN-treated rats, which partly confirms the protective nature of SNN against atherogenic risk.
NAFLD is associated with dyslipidemia, increased hepatic fat content often (but not always) correlates with increased hepatic TG secretion. The only route for TG export from hepatocytes is via the assembly of VLDL. However, as NAFLD progresses, the production of VLDL might decrease secondary to the impairment of hepatocellular function. Studies of seven patients with biopsy proven NASH showed decreased apolipoprotein B (apoB, the primary apolipoproteins of VLDL) production rate (by 50%) as compared with obese or lean controls without NAFLD [
24]. We have observed a parabolic response of serum TG level during diet-induced fatty liver progression, indicating the impairment of hepatocellular function. The mechanisms responsible for the parabolic change of serum TG is unclear. Nevertheless, 4-week SNN treatment results in an improved hepatocellular function, evidenced by the restoration of serum TG. Cell culture and animal studies showed that, although moderate FFA overload increases VLDL secretion, prolonged FFA exposure induced ER stress and resulted in decreased VLDL secretion [
25]. Whether or not SNN treatment can reduce ER stress remains to be determined.
The two-hit and multi-hit hypotheses postulate that insulin resistance is the initial trigger of the pathogenesis of NAFLD [
26],[
27]. Insulin sensitivity/resistance is usually tested on glucose metabolism. HOMA-IR is largely used in epidemiological studies because it only requires measuring FIN and FBG, and OGTT indices are frequently used in clinical practice [
28],[
29]. Both tests are commonly used to measure whole-body and peripheral insulin resistance. The results of the experiment in this study showed an increase of HOMA-IR and OGTT indices, which signify insulin insensitivity in NAFLD rats. SNN markedly reduces OGTT indices, but fails to inhibit HOMA-IR increase, which suggests that SNN may not completely reverse whole-body insulin resistance involved in NAFLD.
Insulin has a strong influence on lipogenesis and glucose homeostasis as well [
30],[
31]. The failure of hepatocytes to respond to insulin contributes to the development of glucose intolerance, whereas lipogenesis, which is positively regulated by insulin, remains sensitive to insulin and is driven excessively by the compensatory hyperinsulinemia [
32]. Thus, the failure of the insulin system enhances hepatic glucose and lipid production [
33]. Hepatic insulin resistance is strongly associated with NAFLD and is characterized by the impairment of glycogenesis with an increase of glucogenesis and glycogenolysis [
34]. Glycogen synthesis represents a major pathway for glucose disposal after insulin stimulation, and increased hepatic glycogen synthesis and glycogen content are involved in enhanced insulin sensitivity [
35]. Previous studies suggested that glycogen in the liver is important to maintain physical performance during prolonged exercise, and that glycogen synthesis is reduced in type 2 diabetes mellitus [
36],[
37]. The present study demonstrated that SNN increases hepatic glycogen content, which is parallel to its improvement of insulin signalling transduction in NAFLD rats. The decrease in liver InsR and IRS expression is in accordance with the impairment of the hepatic insulin pathway and represents the therapeutic targets of insulin resistance [
16]. This finding indicates that the improvement of hepatic insulin sensitivity contributes to the reduction of hepatic lipid accumulation in NAFLD rats. Therefore, hepatic insulin resistance is an important target for SNN therapy for HC diet-induced NAFLD.
Hepatic insulin resistance is also associated with activation of regulatory signaling pathways. Among the regulatory molecules, SOCS3 has been shown interfering insulin signaling by competitively binding to the InsR, affecting IRS phosphorylation [
17], or promoting ubiquitin-mediated IRS degradation [
18]. In addition to SOCS3, the isoforms of PKC family have wide-ranging roles in signal transduction, including the positive and negative modulation of insulin action, and they are dependent on diacylglycerol (DAG) for full activation [
38]. PKCε is the isoform most often implicated in association with hepatic insulin resistance, PKCε in liver may affect its ability to phosphorylate the substrates or InsR trafficking in hepatocytes [
39]. In our study, both SOCS3 and PKCε were significantly increased with the development of NAFLD, which was consistent with the impairment of insulin signaling pathway, indicating these regulatory molecules may contribute to the insulin resistance. SNN showed improvement on SOCS3 expression, but not that of PKCε, the potential mechanisms need to be further explored, other isoforms of PKC family may also involved in the regulatory process.
Thiazolidinediones are insulin-sensitizing agents that improve insulin sensitivity and are effective for the treatment of specific metabolic defects. However, the use of thiazolidinediones for NAFLD treatment raises a number of safety concerns [
40],[
41]. In this study, pioglitazone shows beneficial effects on NAFLD rats, but causes body weight gain, which is in accordance with the results in reported clinical studies [
42],[
43]. Moreover, pioglitazone may predispose at-risk patients to exacerbated heart failure [
44]. Because of these side effects in addition to other potential risks, efficacy of some of the insulin sensitizers in NAFLD therapy is limited. This study shows that the two regimens for treating NAFLD rats have similar effects. The results also show that SNN rats do not exhibit any body weight gain, which signifies that SNN is safe and suitable for long-term use.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
LZ and GJ designed the study, LZ and JYX carried out experiments. HYS participated in the data analysis, LZ and ZMY interpreted the data, drafted and edited the manuscript, GJ supervised all the experiments. All authors have read and approved the final manuscript.