Background
Programmed cell death or apoptosis, a fundamental process in growth and development, can be targeted in the treatment of various tumors [
1]. Several years ago we identified a nuclear hormone receptor co-activator which we refer to as Nuclear Receptor Interacting Factor 3 (NRIF3) [
2]. Surprisingly we found that expression of NRIF3 rapidly leads to caspase-2-dependent apoptosis in a wide variety of Estrogen Receptor positive or negative human breast cancer cell lines (e.g. SKBR3, MCF-7, T-47D, MDA-435, MDA-231 and MDA-231/ER
+) and two mouse breast cancer cell lines (4T1 and 67NR) [
2‐
5]. However, NRIF3 expression did not lead to apoptosis in a wide variety of other cell types (e.g. U2OS, human osteosarcoma; 293, human kidney epithelium; UOK-145, kidney carcinoma; HepG2, human hepatoma, and HeLa, human cervical carcinoma) [
2‐
4]. Apoptosis mediated by NRIF3 was documented by FACS analysis, binding of Annexin V, time-lapse imaging, and TUNEL assay [
2,
3]. This apoptotic activity was mapped to a short ~30 amino acid region (amino acids 20–50) of NRIF3. We refer to this region as Death Domain-1 (DD1) since it is necessary and sufficient to mediate apoptosis of breast cancer cells. DD1 does not interact with nuclear receptors, thus, this apoptotic effect of NRIF3 is independent of its action as a nuclear receptor co-activator. Change of Ser28 to Ala28 (S28A) abrogates the ability of NRIF3/DD1 to mediate apoptosis suggesting that phosphorylation of Ser28 is important for this biological effect of NRIF3/DD1 [
2,
3].
We cloned the intracellular target of NRIF3/DD1 and refer to this factor as DD1 Interacting Factor-1 (DIF-1) which is a transcriptional repressor [
4]. Our studies indicated that DIF-1 (a.k.a IRF-2BP2) acts to selectively repress one or more pro-apoptotic genes in breast cancer cells (but not in the other cell types examined) and this repression is reversed by the binding of NRIF3/DD1 [
4]. The notion that DIF-1 represses pro-apoptotic genes in breast cancer cells is further supported by the finding that knockdown of DIF-1 by siRNA leads to apoptosis of breast cancer cells but not of other cell types; including MCF-10A cells and C57MG cells, which are respectively immortalized normal human and mouse breast epithelial cell lines [
4]. Thus, DIF-1 acts as a “death switch” whose activity can be attenuated by the binding of NRIF3/DD1 leading to pro-apoptotic gene expression in breast cancer cells [
4].
Through microarray and expression studies, we identified FASTKD2 (Fas Activated Serine-Threonine Kinase Domains 2) as the pro-apoptotic target gene that is repressed by DIF-1 in breast cancer cells but not other cell types [
5]. DIF-1 binds to the FASTKD2 gene in breast cancer cells but not to the FASTKD2 gene in other cell types (e.g. HeLa cells) [
5]. Knockdown of FASTKD2 by siRNA prevents NRIF3/DD1-mediated apoptosis in breast cancer cells while expression of FASTKD2 leads to apoptosis in all cell types [
5]. Our findings are consistent with a model where rapid and transient de-repression of the FASTKD2 gene in breast cancer cells leads to apoptosis [
5].
Although, the NRIF3/DD1/DIF-1 pathway does not mediate apoptosis of a wide variety of non-breast cancer cell lines, because of certain similarities and gene signatures between breast and prostate cancer [
6‐
8] we explored whether the NRIF3/DD1/FASTKD2 pathway mediates apoptosis of prostate cancer cell lines. We examined LNCaP cells which are androgen dependent (LNCaP-AD) [
9] as well as two other LNCaP cell lines which express high levels of androgen receptor but are androgen independent with regard to growth (LNCaP-AI and LNCaP-abl) [
10,
11]. Interestingly, LNCaP-AI and LNCaP-abl are much more resistant to apoptosis than androgen dependent LNCaP-AD cells [
10,
11]. Here we report that all three LNCaP cell lines rapidly undergo apoptosis in response to NRIF3/DD1 through the rapid expression of the FASTKD2 gene. Moreover, we document that an 81 amino acid sequence in the putative FASTKD2 kinase domain region is sufficient to mediate apoptosis in LNCaP cells and other cell types.
Methods
Plasmids
pLPC-DD1-ERT2 or pLPC-DD1(S28A)-ERT2 retroviral based plasmids were described previously [
5] and the expressed proteins are activated by by 4-hydroxytamoxifen (4-OHT). These vectors express a chimera with an N-Terminal FLAG epitope and a nuclear localization signal [
5]. Full-length FASTKD2 generated by PCR and cloned into p3xFLAG-CMV-14 (Sigma) to yield FASTKD2 with a C-terminal 3xFLAG tag was described previously [
5]. FASTKD2 lacking both the FAST kinase and the RAP domains [FASTKD2(1–455)] was generated by PCR and cloned into the EcoRI-KpnI site of p3xFLAG-CMV-14. DNA corresponding to the FAST2 domain (amino acids 538–619) and the FAST1_FAST2 region (amino acids 456–619) were generated by PCR and cloned into the EcoR1-KpnI site of pEGFP-C3. The number designations used are as described by Simarro et al. [
12] although it has been suggested that Met 17 is the initiating codon [
13]. All constructs were confirmed by sequencing. Vectors expressing pEGFP-DD1 and GAL4-DD1 and GAL4-DD1(S28A) and AIF-GFP were described previously [
2]. YFP vectors expressing all five FASTKD proteins [
12] were generously provided by Maria Simarro and Paul Anderson.
Stable cell lines
LNCaP-AI cell lines stably expressing a DD1-ERT2 or a DD1(S28A)-ERT2 chimera were generated as previously described for T-47D, MCF-7 and SKBR3 breast cancer cells and HeLa cells [
5]. In summary, 293T cells, seeded in 15-cm dishes at 5 million cells per dish, were transfected with ψA retroviral packaging vector and either pLPC-DD1-ERT2 or pLPC-DD1(S28A)-ERT2 by calcium phosphate precipitation. The retroviral supernatant was collected at 36 h and 60 h post-transfection. The supernatant was then filtered through a 0.45 um sterile filter and added to LNCaP-AI cells for infection. Forty-eight h post-infection, cells were selected through resistance to 2 ug/ml puromycin for two weeks. Single colonies of each of the stable cell lines were isolated by serial dilution and screened for the expression of DD1-ERT2 or DD1(S28A)-ERT2 by immunofluorescence using FLAG-M2 antibody (Sigma). Expression of DD1-ERT2, or DD1(S28A)-ERT2 in the isolated clones was also confirmed by FLAG-M2 Western blotting.
Cell culture
All cell lines except HeLa were maintained in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum (FBS) supplemented with glutamine and antibiotics. HeLa cells were maintained in DMEM containing 10% bovine calf serum supplemented with glutamine and antibiotics. Stable cell lines were maintained in DMEM-10% serum supplemented with glutamine and 2 ug/ml puromycin.
siRNA transfection
siRNAs to knockdown FASTKD2 expression were obtained from Qiagen and were previously verified to knockdown FASTKD2 by over 90% [
5]. The target sequence for FASTKD2 was ATGAATCACCGATCTCTTATA. A control siRNA contained four base changes. Cells were transfected with the siRNAs (40 nM) using HiPerfect siRNA transfection reagent (Qiagen) according to manufacturer's recommendation. To obtain efficient knockdown in LNCaP-AI cells, the cells were transfected with the siRNAs twice (on day 1 and day 2) and the cells were studied ~70 h after the initial tranfection.
TUNEL assay
Cell lines were plated at a density of 30,000 cells per well on glass coverslips in 48-well tissue culture plates [
4]. About 24 h later, the cells were transfected with the siRNA(s) as indicated using HiPerfect (Qiagen) or the indicated plasmids (50 ng) using Lipofectamine 2000 (Invitrogen). Generally, cells were usually harvested 15 h after plasmid transfection. The DD1-ERT2 and DD1(S28A)-ERT2 stable cell lines were examined between 5 to 15 h after the addition of 1 uM 4-OHT as indicated. Cells were washed three times with phosphate-buffered saline, fixed in 4% formaldehyde, and assayed for TUNEL using the
in situ Cell Death Detection TMR red kit (Roche Diagnostics). Cells were then stained with 4',6-diamidino-2-phenylindole (DAPI) to visualize nuclei, mounted on slides, examined by fluorescent microscopy, and digitally photographed. Magnification bars are shown at the lower right of each TUNEL assay figure.
Quantitative reverse transcription PCR (qRT-PCR)
qRT-PCR was carried out using total RNA extracted from cells using TRIzol (Invitrogen). One ug of RNA was treated with DNase1 (Fermentas), and reverse transcribed with random hexamers using a cDNA kit (Applied Biosystems) according to manufacturer's protocol. Specific PCR products were amplified using the FASTKD2 PCR primers [
5] (forward primer, TCCTGAATCCCTAAACATGAAAA; reverse primer, GCCATAACTTCCACGAACTG), a 1:50 dilution of cDNA, and the Maxima SYBR Green/Fluorescein qPCR Master Mix (Fermentas). Forward and reverse primers for qRT-PCR of the other 4 FASTKD mRNAs (FASTKD1,3,4,5,) were as previously described [
12]. SYBR green signals were measured in a BioRad iCycler machine. The values were normalized to an internal 18S ribosomal RNA control.
Immunofluorescence
Cells were plated, treated, and fixed as described in the experiments for TUNEL assay. FLAG-M2 antibody (Sigma) and anti-mouse FITC antibody (Zymed) were used to stain for FLAG-DD1-ERT2 or FASTKD2-FLAG expression in fixed cells. After treatments and/or transfections, cells were fixed, and permeabilized with 1x PBS with 0.2% Triton-X100 for 10 min at 25°C. After 3 washes of 1x PBS, the cells were blocked with 3% BSA in 1x PBS for 45 min at 25°C, then incubated with 3 ug/ml of FLAG-M2 antibody (Sigma) in 3% BSA in 1x PBS. After the primary antibody incubation, the cells were washed three times in 1x PBS. The cells were then incubated with 7.5 ug/ml of the secondary anti-mouse FITC antibody (Zymed) for 1 h at 25°C. The cells were finally washed three times in 1x PBS, and stained with DAPI to visualize nuclei, mounted on slides, examined by fluorescent microscopy, and digitally imaged. Magnification bars are shown at the lower right of each figure.
Discussion
FASTKD2 with a nonsense mutation in both alleles on chromosome 2 was identified in a family with a transmitted Infantile Mitochondrial Encephalophy [
13]. These individuals were shown to have a marked decrease in cytochrome c oxidase activity (Complex IV), which receives electrons from cytochrome c and transfers them to molecular oxygen [
13]. FASTKD2 localizes to the inner mitochondrial compartment and is thought to be a component of Complex IV [
13]. Fibroblasts from individuals with Infantile Mitochondrial Encephalophy show less apoptosis in response to Staurosporine [
13]. In microarray studies we previously identified a rapid increase in expression of FASTKD2 in breast cancer cells expressing NRIF3/DD1 but no change in other cells types [
5].
The FASTKD2 gene appears to be repressed by DIF-1 and the binding of NRIF3/DD1 leads to rapid de-repression of the FASTKD2 gene [
5]. Interestingly, the other members of the FASTKD gene family are not enhanced through the NRIF3/DD1/DIF-1 pathway in breast cancer cells or LNCaP cells (Figure
4C) nor does their expression lead to apoptosis (Figure
5). In other cell types examined the FASTKD2 gene is not regulated by NRIF3/DD1 [
5]. ChIP analysis indicated that DIF-1, and its related associated proteins IRF2BP1 and EAP-1, bind to the first untranslated exon of the FASTKD2 gene in breast cancer cells while DIF-1 does not bind to the gene in HeLa cells [
5].
Since FASTKD2 is a highly pro-apoptotic factor, its expression and activity must be tightly controlled and regulated. Mitochondrial proteins encoded by nuclear genes are synthesized on free ribosomes and are thought to enter mitochondria directly through a pre-sequence; while other proteins with internal targeting signals associate with chaperones which target the mitochondrial import mechanism [
22]. The mechanism of FASTKD2 mitochondrial import is not known but it does contain an N-terminal mitochondrial import signal which when removed prevents mitochondrial import [
5,
13]. If FASTKD2 is directly imported
via its pre-sequence, its expression needs be under tight control since over-expression can lead to apoptosis since mitochondrial import of certain proteins may not be an extremely rapid process [
22]. In our studies, expression of NRIF3/DD1 leads to a rapid 3- to 7-fold increase in FASTKD2 expression within 5–8 h in breast cancer cell lines [
5] as well as in LNCaP cells (Figure
4B and
4C). This rapid increase in FASTKD2 may not be rapidly imported into mitochondria and, thus, generate an extra-mitochondrial “threshold” level that is sufficient to spuriously initiate an apoptotic response. Consistent with that model is that expression of FASTKD2 without the mitochondrial import signal [
5], or the FAST1_FAST2 region or just the FAST2 domain (Figure
6), which do not localize to mitochondria, leads to rapid apoptosis. Thus, the 81 amino acid FAST2 region mediates the pro-apoptotic effect of FASTKD2. As indicated in the results section, the FAST1_FAST2 domains do not contain conserved motifs typical of a kinase and the FAST1_FAST2 domains of the five FASTKD proteins are only about 20% similar/identical with significant gaps. Although we can’t exclude the possibility that FASTKD2 mediates its apoptotic response through phosphorylation, it is likely that it initiates apoptosis
via a different mechanism.
Why NRIF3/DD1 regulates the FASTKD2 gene in breast cancer cells and LNCaP cells but not other cell types is currently unknown. For breast cancer cells we showed that the DIF-1 complex containing the related proteins IRF-2BP1 and EAP-1 binds to the 5’-untranslated exon of the FASTKD2 gene [
5]. However, the DIF-1 complex does not bind to this region of the FASTKD2 gene in HeLa cells which expresses DIF-1, IRF2BP1 and EAP1 at similar levels as in breast cancer cells [
5]. Mass spectrometry and silver stain gel studies indicate that the proteins associated with the DIF-1 complex differ in HeLa and T-47D breast cancer cells [
5]. Thus, cells where FASTKD2 is regulated by DIF-1 may express components that allow for DIF-1 complex binding to the gene, possibly displacing regulatory factors that act to regulate low levels of expression of the gene in other cell types. Alternatively, cells where DIF-1 does not regulate the FASTKD2 gene, such as HeLa cells, may contain factors that interact with the DIF-1 complex preventing the complex from binding to and regulating the gene. In future mass spectrometry and functional studies we hope to explore such possible alternative models as well as identify the cellular target(s) of the FAST2 domain.
Conclusions
The NRIF3/DD1/DIF-1/FASTKD2 pathway is a new pathway to therapeutically target Estrogen Receptor negative breast or androgen independent prostate cancer or metastatic cancer for therapy. In particular, in this study we found that expression of NRIF3/DD1 efficiently leads to apoptosis in LNCaP-AI and LNCaP-abl cells which are much more resistant to apoptosis than the parent LNCaP-AD cells [
10,
11]. In previous studies we found that the 104 C-terminal amino acids of DIF-1 binds NRIF3/DD1 [
4]. Future structural studies with this region of DIF-1 with a DD1-S28-phosphopeptide will hopefully lead to a crystal structure that provides a picture of the pharmacophore or chemical blueprint of the DD1/DIF-1 interaction. This can provide the structural basis for identifying small molecule DD1 mimetics that would be useful in targeting DIF-1 in breast and prostate cancer in animal models and in future clinical trials.
Acknowledgements
This work was supported by a New York State Peter T. Rowley Breast Cancer Research Award (C026592) (to H.H.S.). We thank Maria Simarro (Unidad de Investigación, Hospital Clínico Universitario de Valladolid, 47005 Valladolid, Spain) and Paul Anderson (Brigham and Women's Hospital, Boston, MA) for the YFP-FASTKD vectors and Guido Kroemer (University of Paris Descartes) for the AIF-GFP vector.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
HHS, SD, and KTY conceived of the studies. KTY and SD generated the DD1 conditional LNCaP-AI cell line. SD performed the fluorescent microscopy and the qRT-PCR studies. SD, MAM, and KTY generated the plasmid constructs described in the Methods section. HHS wrote the manuscript with input from SD, MAM, and KTY who approved of the final version of the manuscript. All authors read and approved the final manuscript.