Skip to main content
Erschienen in: BMC Complementary Medicine and Therapies 1/2015

Open Access 01.12.2015 | Research article

Fast and reliable detection of toxic Crotalaria spectabilis Roth. in Thunbergia laurifolia Lindl. herbal products using DNA barcoding coupled with HRM analysis

verfasst von: Sahachat Singtonat, Maslin Osathanunkul

Erschienen in: BMC Complementary Medicine and Therapies | Ausgabe 1/2015

Abstract

Background

Nowadays, medicinal plants are used as a popular alternative to synthetic drugs. Many medicinal plant products have now been commercialized throughout various markets. These products are commonly sold in processed or modified forms such as powders, dried material and capsules, making it almost impossible to accurately identify the constituent species. The herbal plant known as ‘Rang Chuet’ in Thai has been widely used as remedies for various ailments. However, two medicinal plants species, Thunbergia laurifolia and Crotalaria spectabilis share this name. Duo to the similarity in nomenclature, the commercial products labeled as ‘Rang Chuet’ could be any of them. Recently, the evidence of hepatotoxic effects linked to use of C. spectabilis were reported and is now seriously concern. There is a need to find an approach that could help with species identification of these herbal products to ensure the safety and efficacy of the herbal drug.

Methods

Here DNA barcoding was used in combination with High Resolution Melting analysis (Bar-HRM) to authenticate T. laurifolia species. Four DNA barcodes including matK, rbcL, rpoC and trnL were selected for use in primers design for HRM analysis to produce standard melting profiles of the selected species. Commercial products labeled as ‘Rang Chuet’ were purchased from Thai markets and authentication by HRM analyses.

Results

Melting data from the HRM assay using the designed primers showed that the two ‘Rang Chuet’ species could easily be distinguished from each other. The melting profiles of the all four region amplicons of each species are clearly separated in all three replicates. The method was then applied to authenticate products in powdered form. HRM curves of all ten test samples indicated that three of the tested products did not only contain the T. laurifolia species.

Conclusion

The herbal drugs derived from different plants must be distinguished from each other even they share the same vernacular name. The Bar-HRM method developed here proved useful in the identification and authentication of herbal species in processed samples. In the future, species authentication through Bar-HRM could be used to promote consumer trust, as well as raising the quality of herbal products.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​s12906-015-0692-6) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

MO planned the study; SS and MO collecting the plant materials, performed the study and conducted the data analysis; MO prepared data for the additional supporting file; SS and MO wrote the manuscript; MO thoroughly revised the manuscript; Both authors discussed the results and approved the final manuscript.

Background

Herbal medicines

Natural products from plants have played a considerable role in the way of life of people around the world since ancient times. Plant products have been consumed as food and used as medicinal remedies. An enormous number of scientific reports highlight the benefits of using medicinal plants and herbs as an alternative to modern synthetic drugs [1]. It is clear that medicinal plants are a popular alternative to synthetic drugs. According to the World Health Organization [2], over 70% of the world’s population in developing countries uses herbal products. Many medicinal plant products have now been commercialized. These products are commonly sold in processed or modified forms such as powders, dried material, tablets, capsules and tea bags, making it almost impossible to accurately identify the constituent species [35]. Because of this, consumer safety could be a concern. Misidentification of the constituent plants may lead to the inclusion of undesirable, unrelated species, with a potential health risk to the end users. Substitution of the product’s ingredients either intentionally or inadvertently can have negative effect on both consumers and producers. Because of these identification issues, any measures that may aide in the identification of herbal products would be beneficial. Many species from the Acanthaceae family are considered in Thailand to have health benefits, several species (Acanthus ebracteatus, Andrographis paniculata, Rhinacanthus nasutus and Thunbergia laurifolia) are now included on the Thai National List of Essentials Medicine (NLEM; Thailand). These Acanthaceae species are commonly used in Thai household as remedies for various ailments and thus are regularly sold on the markets throughout Thailand. There is a need to find an approach that could help with the quality control of these herbal products to ensure both the satisfaction and safety of consumers.
Thunbergia laurifolia is one of common Thai medicinal plant with various used such as antipyretic, detoxification against insecticides, alcoholic and metallic poisons. T. laurifolia commonly known in Thai as ‘Rang Chuet’ has been used in Thailand as a natural remedy for decades. Commercial products of ‘Rang Chuet’ in tea, capsule, and powder forms in herbal markets are claimed to have beneficial effects on human health. However, confusion has arisen because of the similarity in the vernacular names of the plants. In Thailand, there are at least three species are being called ‘Rang Chuet’, one of these is Crotalaria spectabilis. There are several documentations reported that seeds and leaves of C. spectabilis contain pyrrolizidine alkaloids which causes Hepatotoxicity in humans and mammals [610]. Due to the fact that, Rang Chuet was immensely sold in Thailand local markets and used as household remedy in form of processed products. Therefore it is almost impossible for consumer to know exactly which ‘Rang Chuet’ products they are buying so this could be a real big issue and is now seriously concern.

Molecular species identification

Recently, many works have been focused on authentication or detection of species substitution of herbal products. Molecular techniques like RFLP and RAPD were developed for Rang Chuet identification [4, 5]. Both RFLP and RAPD technique showed a potential in discrimination of the two Rang Chuet (T. laurifolia and C. spectabilis) species but the disadvantage of RFLP is not only relatively time consuming but the RFLP also requires a large amount of sample, although RAPD technique is fast but many [1114] show unstable results and sometimes unreproducible.
In the past decade, DNA barcoding (short DNA sequence) is proved to be useful for identifying and categorizing species [15]. To date, several Rang Chuet barcodes from various plastid genome regions including matK, rpl16, rps16, trnL and rbcL were produced [5, 14]. Although DNA barcoding is proven useful for species-level identification of plants [16, 17], there are some limitations to the technique. It is costly and time-consuming, and not easy to apply routinely in developing countries due to financial constraints and limited availability of perishable chemicals and consumables. This leads us in searching for new fast, reliable, less time consuming and inexpensive method for species identification and authenticating of medicinal plants. Here we applied DNA barcoding with high resolution melting (Bar-HRM) analysis for species identification and authentication of ‘Rang Chuet’ products sold on Thai markets. The use of Bar-HRM for taxonomic identification and the detection of adulteration in food and agriculture products has been reported recently [1820]. In this study we evaluate whether the technique is equally useful for species discrimination in constituents of Thai folk medicinal plant.

Materials and methods

Primers used for HRM analysis

Sequences of the plastid DNA regions, matK, rbcL, rpoC and trnL of selected medicinal plants from the family Acanthaceae (Thunbergia spp.) and Fabaceae (Crotalaria spp.) were extracted from GenBank (at the end of September 2013) using the key phrases “the name of locus” and “the name of species” in the annotations. Generally, sequences obtained from public databases, including GenBank, are of low quality with no known associated herbarium vouchers. For this reason, all of the sequences were subjected to critical evaluation and any low-quality sequences were removed. After processing, multiple alignments were made from the selected sequences using MEGA6 [21] and variable characters were calculated for the design of primers to be used for high resolution melting (HRM) analysis. Two main criteria were considered in order to obtain successful results in the HRM analysis: (i) the primer pair should generate a PCR product not exceeding 300 bp, (ii) the primer pairs should cover enough variable sites to enable discrimination among the tested species and any other variation site from sequence of conspecifics.

Plant samples and DNA isolation

Both fresh and dried samples were included in this study (Table 1). Two ‘Rang Chuet’ herb species (T. laurifolia and C. spectabilis) were the main focus of the study. Fresh specimens of these species were collected from areas in Chiang Mai province, Thailand. Dried plant tissues for DNA extraction were kindly provided by Queen Sirikit Botanic Garden (QSBG). The plant material was ground with liquid nitrogen, and then used for DNA extraction with the Nucleospin Plant® II kit (Macherey-Nagel, Germany) following the manufacturer’s instruction. DNA concentrations of all samples were equally adjusted (20 ng/μL). The DNA was stored at−20° C for further use.
Table 1
Plants species and commercial products included in this study
Species/Type
Abbreviation
Source
Sample type
Thunbergia laurifolia
T1
Materia Medica garden
Fresh
  
Faculty of Pharmacy, Chiang Mai University
 
Thunbergia laurifolia
T2
Department of Biology
Fresh
  
Faculty of Science, Chiang Mai University
 
Thunbergia laurifolia
T3
Queen Sirikit Botanical Garden
Dry
  
Mae Rim, Chiang Mai (voucher number 46323)
 
Thunbergia laurifolia
T4
Queen Sirikit Botanical Garden
Dry
  
Mae Rim, Chiang Mai (voucher number 59427)
 
Crotalaria spectabilis
C1
Materia Medica garden
Fresh
  
Faculty of Pharmacy, Chiang Mai University
 
Crotalaria spectabilis
C2
Materia Medica garden
Fresh
  
Faculty of Pharmacy, Chiang Mai University
 
Crotalaria spectabilis
C3
CMU Biology Garden
Fresh
  
Faculty of Science, Chiang Mai University
 
Commercial CN-C
COM1
Chiang Mai
Capsule
Commercial TT-C
COM2
Chiang Mai
Capsule
Commercial HBO-C
COM3
Chiang Mai
Capsule
Commercial HBO-T
COM4
Chiang Mai
Tea bag
Commercial APB-P
COM5
Lamphun
Powder
Commercial NK-L
COM6
Lamphun
Dried leaf
Commercial GT-L
COM7
Pa Yao
Dried leaf
Commercial OTOP-T
COM8
Pa Yao
Tea bag
Commercial RTN-S1
COM9
Pa Yao
Dried bark
Commercial RTN-S2
COM10
Pa Yao
Dried bark

Real-time PCR amplification and high resolution melting (HRM) analysis

To determine the characteristic melting temperature (Tm) for each sample that could be used to distinguish the two different ‘Rang Chuet’ medicinal plants, PCR amplification, DNA melting, and end point fluorescence level acquiring PCR amplifications were performed in a total volume of 20 μL on an Eco™ Real-Time PCR system (Illumina®, San Diego, USA). The reaction mixture contained 10 ng genomic DNA, 10 μL of MeltDoctor™ HRM Master Mix (Applied Biosystems, California, USA), 0.2 μL of 10 mM forward and reverse primers. The four pairs of candidate barcoding primers nucleotide composition are shown in Table 2. The real-time PCR reaction conditions are as following; an initial denaturing step at 95 °C for 5 min followed by 35 cycles of 95 °C for 30 s, 57 °C for 30 s, and 72 °C for 20 s. Subsequently, the PCR amplicons were denatured for HRM at 95 °C for 15 s, and then annealed at 50 °C for 15 s to form random DNA duplexes. Melting curves were generated after the last extension step. The temperature was increased from 60 to 95 °C at 0.1 °C/s. The melting curves were analyzed with the Eco™ software (version 4.0.7.0). After obtaining the suitable primers for the HRM in order to test the sensitivity of the developed method, real-time PCR and barcoding with HRM were carried out on standard samples, prepared by mixing fine powder of T. laurifolia with C. spectabilis in different proportions of 1, 3, 6, 12, 25, and 50 %. Real-time PCR amplification was performed as described earlier.
Table 2
Four primers used for HRM analysis and identification
Primer name
Nucleotide sequence (5’ to 3’)
Ta (°C)
Expected size (bp)
matK _F
CTTCTTATTTACGATTAACATCTTCT
57
160
matK _R
TTTCCTTGATATCGAACATAATG
  
rbcL_F
GGTACATGGACAACTGTGTGGA
57
150
rbcL _R
ACAGAACCTTCTTCAAAAAGGTCTA
  
rpoC_F
CCSATTGTATGGGAAATACTT
57
170
rpoC _R
CTTACAAACTAATGGATGTAA
  
trnL_F
GAATCGACCGTTCAAGTATCC
57
150
trnL _R
TATAGGAAACCCATATTTGATCCAATC
  

Authenticating test of herbal products sold on Thai local markets

Ten herbal products labeled as ‘Rang Chuet’ were purchased for this study. All of the products were acquired in processed forms (Table 1). Total DNA was extracted from each sample and then used in HRM analysis in order to identify the characteristic melting temperature (Tm).

Results and discussion

Data mining and primers used

The amplification of the four selected locus from two ‘Rang Chuet’ medicinal plant species (T. laurifolia and C. spectabilis) was performed using specific primers corresponding to the matK, rbcL, rpoC and trnL barcode region. All sequences of Thunbergia spp. were extracted from GenBank and the variable characters and average %GC content was calculated for all samples (Table 3). Data was present for most markers of the target species, except for rpoC. The total number of sequences retrieved for the respective markers were: matK 11 (7 species); rbcL 6 (6 species), trnL 27 (20 species). The absence of rpoC sequences for the target species was resolved by selecting random rpoC sequences from GenBank, which is supported by the high universality of rpoC [17, 22]. Two sequences of C. spectabilis were retrieved (matK and trnL).
Table 3
Characteristics of sequences and primers for high resolution melting analysis
Regions
mat K
rbc L
rpoC
trn L
Available species
5
6
5
19
Variable characters (%)
30.67
10.07
10.19
8.90
Conserved forward primer/total (%)
15/26 (57.69)
21/22 (95.45)
18/21 (85.71)
19/21 (90.48)
Conserved reverse primer/total (%)
19/23 (82.61)
25/25 (100)
19/21 (90.48)
24/27 (88.89)
Average %GC content
35.20
46.60
44.26
34.50
For matK 5, rbcL 6, rpoC 5 and trnL 19 sequences were deemed useful for further analysis (Table 4). An alignment of all useful sequences was made, and the primers flanking regions of each marker ranging from 150 to 170 bp were analyzed (Table 2). Reed and Wittwer [23] found that suitable length for HRM analysis should be 300 bp or less for optimal results.
Table 4
Sequences of four plastid regions (matK, rbcL, rpoC and trnL) were retrieved from GenBank (NCBI) for each of the species with accession number
Species
Regions
trnL
matK
rbcL
rpoC
Crotalaria spectabilis
HM208335
AB649973
-
-
Thunbergia affinis
AB817377
-
-
-
 
EU315886
Thunbergia alata
AF061820
HQ384512
HQ384878
-
 
EU529130
AF531811
  
EU315887
 
Thunbergia angulata
EU315888
-
-
-
Thunbergia arnhemica
EU315889
-
-
-
Thunbergia atriplicifolia
EU315890
-
-
-
Thunbergia battiscombei
EU315891
-
-
-
Thunbergia capensis
EU315892
AM234783
AM234783
-
Thunbergia coccinea
EU529131
HG004920
KF181493
-
Thunbergia convolvulifolia
EU315894
-
-
-
Thunbergia dregeana
EU315895
-
-
-
Thunbergia erecta
AF061821
AB649972
-
-
 
JQ764614
 
EU529132
EU315896
Thunbergia fragrans
U315897
-
-
-
Thunbergia galpinii
EU315898
-
-
-
Thunbergia grandiflora
EU315899
AB649971
JQ590086
-
  
JQ586429
 
JQ586428
JQ586427
Thunbergia gregoryi
EU315901
-
-
-
Thunbergia guerkeana
EU315901
-
-
-
Thunbergia kirkii
EU315902
-
-
-
Thunbergia laurifolia
-
AB649970
-
-
Thunbergia mysorensis
-
-
AY008828
-
Thunbergia petersiana
EU315904
-
-
-
Thunbergia pondoensis
EU315905
-
-
-
Thunbergia togoensis
EU315906
-
-
-
Thunbergia usambarica
-
-
L12596
-
Both the sequence length and the nucleotide variation within sequences influence the dissociation energy of the base pairs and result in different Tm values. The matK amplicon sequences were observed to have higher nucleotide variation than the amplicons of the other regions, at 30.67%. The relative nucleotide variation within amplicons was found to be as follows: matK > rpoC > trnL > rbcL (Table 3). The forward and reverse matK primers matched the consensus sequence of the target species at the binding sites in only 15 out of 26 sites (57.69%) and 19 out 23 of sites (82.61%), respectively (Table 3). High universality at the initial bases of the primer site is crucial for primer annealing and subsequent elongation initiation by the DNA polymerase. The matK locus is one of the most variable plastid coding regions and has high interspecific divergence and good discriminatory power. However, it can be difficult to amplify with the standard barcoding primers due to high substitution rates at the primer sites [24, 25]. The rbcL, rpoC and trnL primer pairs were expected to be a suitable primer for HRM analysis for discrimination between the tested plant species. These primers were nearly identical in base similarity to the mined consensus sequence (Table 3).
The average %GC content of amplicons was calculated in order to predict variation in melting curves for the different markers. trnL had the lowest average %GC content, with 34.50%, followed by matK, rpoC and rbcL, with 35.20, 41.85, 44.26 and 46.60% respectively (Table 3).

Finding suitable primer pairs for discrimination between T. laurifolia and C. spectabilis

The four primers sets were used for the amplification of DNA-fragments from all seven samples (two ‘Rang Chuet’ species), and the amplicons were analyzed using HRM to define Tm. (Table 5). The expected length of amplified products from matK, rbcL, rpoC, and trnL are 160 bp, 150 bp, 170 bp, and 150 bp, respectively. The melting profiles of all amplicons are illustrated in Fig. 1a-1d. The analysis is presented by means of conventional derivative plots, which show that the Tm value of each species is represented by a peak. The samples of the two different species could be easily distinguished using HRM analysis with all four primer pairs. The melting profiles of seven samples of the two ‘Rang Chuet’ species (T. laurifolia and C. spectabilis) can be divided into two groups. All T. laurifolia samples (T1-T4) are grouped together and the other group contains all C. spectabilis samples (C1-C3). Although the four primer pairs tested could be used to discriminate T. laurifolia from C. spectabilis, the rpoC region was chosen for further analysis as it would help in demonstrating that Bar-HRM could work well as a sequencing-free method for plant identification. In addition, the rpoC region was used as an analytical target in HRM analysis has been shown to be effective for the detection and quantification of Lens culinaris and Lathyrus clymenum adulterations [18, 22].
Table 5
The values of melting temperature (°C) with standard deviations gaining form high resolution melting (HRM) analysis using matK, rbcL, rpoC and trnL primers of T. laurifolia and C. spectabilis species
Species
Abbreviation
Tm (oC)
mat K
rbc L
rpo C
trn L
T. laurifolia
T1
-
82.5 ± 0.07
80.2 ± 0.12
78.8 ± 0.07
T. laurifolia
T2
-
82.4 ± 0.14
80.1 ± 0.15
78.9 ± 0.07
T. laurifolia
T3
77.9 ± 0.35
82.3 ± 0.14
80.2 ± 0.00
78.8 ± 0.00
T. laurifolia
T4
-
82.4 ± 0.07
80.2 ± 0.07
78.8 ± 0.14
C. spectabilis
C1
75.6 ± 0.21
81.6 ± 0.00
80.9 ± 0.06
78.4 ± 0.14
C. spectabilis
C2
75.3 ± 0.07
81.6 ± 0.07
80.9 ± 0.06
-
C. spectabilis
C3
75.4 ± 0.21
81.5 ± 0.00
80.8 ± 0.00
78.2 ± 0.00
(-) No amplicons were generated

Quantitative detection of T. laurifolia adulterants with Bar-HRM analysis

Detecting limit of adulteration in T. laurifolia products using the developed method with rpoC primers was tested. Figure 2a shows the results of the validation method with T. laurifolia spiked with C. spectabilis in different proportions. These results depict the analysis for one experiment as all three experiments gave similar results thus showing very good reproducibility. The process of the T. laurifolia amplicon dissociation reveals the level of contamination resulting from adulteration as the presence of increasing quantity of C. spectabilis into the T. laurifolia DNA alters the shape and shifts proportionally the melting curve, compared to the curve of pure T. laurifolia DNA. By applying this approach, we were able to detect adulterations as low as 1 % (Fig. 2a).

Identification of herbal species in commercial products

Constituent species in herbal products bought from markets in Thailand were investigated to assess the reliability of information regarding their ingredients, as the herbal products are often sold in processed forms. Ten herbal products labeled as ‘Rang Chuet’ were purchased and examined (Table 1). The HRM analysis using rpoC primers was then performed to identify the species in the products.
The examination of the HRM difference curve of all tested samples using T. laurifolia curve as baseline revealed that seven out of ten samples (COM3-7 and 9–10) produce curves in which the same as T. laurifolia’s with a 90% confidence interval, suggesting that the products contain T. laurifolia (Fig. 2b). The melting curve of one tested sample (COM8) was found between T. laurifolia and C. spectabilis lines, it could be indicated that the commercial COM8 was probably be admixture of T. laurifolia and C. spectabilis with around 3% of the toxic C. spectabilis in the product as show in Fig. 2b. However, we cannot rule out the possibility of the COM8 may actually not be contaminated with the toxic C. spectabilis but other species. In addition, the results of the analysis also reveal that the two remaining samples (COM1 and COM2) were much likely not contain any of the two ‘Rang Chuet’ species but some other species instead (Fig. 2b). In order to find contaminated or substituted species in COM1 and COM2, DNA barcoding is one of the best solutions. As can be seen from Newmaster et al [26] work, DNA barcoding was performed to detect the adulteration and substitution of herbal drugs and found that herbal products sold on the markets were contaminated or substituted with alternative plant species that are not listed on the labels as they are replaced entirely by powdered rice, wheat and soybean. Thus, DNA sequencing of rbcL region was carried out to identify species in these two products. The blast result showed that COM1 and COM2 have a similarity in their sequences to Moringa oleifera and Andrographis paniculata, respectively (Additional file 1: Table S1). The finding provides evidence that substitution in herbal products sold Thai local market is presented and this substitution could be a serious issue for consumers. Due to the fact that Bar-HRM has allowed us easily determine herbal species in processed products sold on the markets within 2 h. Bar-HRM method developed in this study therefore pose a potential to be a great tool in detection of adulteration and/or substitution in herbal products especially in processed forms.

Conclusions

Several studies have shown that substitution of plant species occurs in herbal medicines, and this in turn poses a challenge to herbal authentication as adverse reactions might be due to substituted ingredients. Bar-HRM has proven to be a cost-effective and reliable method for the identification of species in this study of Thai medicinal plants. The hybrid method of DNA barcoding and High Resolution Melting is dependable, fast, and sensitive enough to distinguish between species. In this study, the tested products were traded as processed powder, which impedes conventional identification. Because of this processing it is almost impossible to identify which herbal species are present in products using morphological characters. The DNA extracted from all products tested yielded a specific amplification product with the designed rpoC Bar-HRM primers. The normalized HRM curves for the amplicons, from the two ‘Rang Chuet’ species (T. laurifolia and the toxic C. spectabilis) and ten herbal products, based on HRM analysis with barcode marker rpoC were easily distinguished, and seven of the ten tested samples were successfully assigned to the T. laurifolia species. However, three products were found to contain other plant species or admixture of the two ‘Rang Chuet’ species. Therefore, the developed method could be easily used for rapid and low-cost authentication of herbal products. Interestingly, designing primer for HRM analysis commonly depends on information in database but here even none of rpoC sequences of Thunbergia could be found on the database, the rpoC primer pair derived from DNA data of other random medicinal plant species is found to be work well in this analysis. It is demonstrated that this method has not only shown the great beneficial value for universality test which might be useful in other medicinal species but also flexibility using DNA region with limited data like rpoC.

Acknowledgements

This research was financially supported by CMU Junior Research Fellowship Program and New Researcher Grant from the Thailand Research Fund (grant number TRG5780027) awarded to MO. We would like to thank Queen Sirikit Botanical Garden in Mae Rim, Chiang Mai Thailand for allowing us accessing dry samples for using in this experiment.
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​4.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

MO planned the study; SS and MO collecting the plant materials, performed the study and conducted the data analysis; MO prepared data for the additional supporting file; SS and MO wrote the manuscript; MO thoroughly revised the manuscript; Both authors discussed the results and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Kunle OF, Egharevba HO, Ahmadu PO. Standardization of herbal medicines - A review. IJBC. 2012;4(3):101–12. Kunle OF, Egharevba HO, Ahmadu PO. Standardization of herbal medicines - A review. IJBC. 2012;4(3):101–12.
2.
3.
Zurück zum Zitat Chan EWC, Lim YY. Antioxidant activity of Thunbergia laurifolia tea. JTFS. 2006;18:130–6. Chan EWC, Lim YY. Antioxidant activity of Thunbergia laurifolia tea. JTFS. 2006;18:130–6.
4.
Zurück zum Zitat Suwanchaikasem P, Chaichantipyuth C, Amnuoypol S, Sukrong S. Random amplified polymorphic DNA analysis of Thunbergia laurifolia Lindl. and its related species. JMPR. 2012;6:2955–61. Suwanchaikasem P, Chaichantipyuth C, Amnuoypol S, Sukrong S. Random amplified polymorphic DNA analysis of Thunbergia laurifolia Lindl. and its related species. JMPR. 2012;6:2955–61.
5.
Zurück zum Zitat Suwanchaikasem P, Phadungcharoen T, Sukrong S. Authentication of the Thai medicinal plants sharing the same common name ‘Rang Chuet’: Thunber gia laurifolia, Crotalaria spectabilis, and Curcuma aff. amada by combined techniques of TLC, PCR-RFLP fingerprints, and antioxidant activities. ScienceAsia. 2013;39:124–33.CrossRef Suwanchaikasem P, Phadungcharoen T, Sukrong S. Authentication of the Thai medicinal plants sharing the same common name ‘Rang Chuet’: Thunber gia laurifolia, Crotalaria spectabilis, and Curcuma aff. amada by combined techniques of TLC, PCR-RFLP fingerprints, and antioxidant activities. ScienceAsia. 2013;39:124–33.CrossRef
6.
Zurück zum Zitat Chan EWC, Eng SY, Tan YP, Wong ZC. Phytochemistry and pharmacological properties of Thunbergia laurifolia: A Review. Phcogj. 2011;3:1–6.CrossRef Chan EWC, Eng SY, Tan YP, Wong ZC. Phytochemistry and pharmacological properties of Thunbergia laurifolia: A Review. Phcogj. 2011;3:1–6.CrossRef
7.
Zurück zum Zitat Flores AS, de Azevedo Tozzi AMG, Trigo JR. Pyrrolizidine alkaloid profiles in Crotalaria species from Brazil: Chemotaxonomic significance. Biochem Syst Ecol. 2009;37:459–69.CrossRef Flores AS, de Azevedo Tozzi AMG, Trigo JR. Pyrrolizidine alkaloid profiles in Crotalaria species from Brazil: Chemotaxonomic significance. Biochem Syst Ecol. 2009;37:459–69.CrossRef
8.
Zurück zum Zitat Leverett LD, Woods M. The Genus Crotalaria (Fabaceae) in Alabama. Castanea. 2012;77:364–74.CrossRef Leverett LD, Woods M. The Genus Crotalaria (Fabaceae) in Alabama. Castanea. 2012;77:364–74.CrossRef
9.
Zurück zum Zitat Schultze AE, Roth RA. Chronic pulmonary hypertension-the monocrotaline model and involvement of the hemostatic system. J Toxicol Environ Health B Crit Rev. 1998;1:271–346.CrossRefPubMed Schultze AE, Roth RA. Chronic pulmonary hypertension-the monocrotaline model and involvement of the hemostatic system. J Toxicol Environ Health B Crit Rev. 1998;1:271–346.CrossRefPubMed
10.
Zurück zum Zitat Wonkchalee O, Boonmars T, Aromdee C, Laummaunwai C, Khunkitti W, Vaeteewoottacharn K, Sriraj P, Aukkanimart R, Loilome W, Chamgramol Y, Pairojkul C, Wu Z, Juasook A, Sudsarn P. Anti-inflammatory, antioxidant and hepato protective effects of Thunbergia laurifolia Linn. on experimental opisthor chiasis. Parasitol Res. 2012;111:353–9.CrossRefPubMed Wonkchalee O, Boonmars T, Aromdee C, Laummaunwai C, Khunkitti W, Vaeteewoottacharn K, Sriraj P, Aukkanimart R, Loilome W, Chamgramol Y, Pairojkul C, Wu Z, Juasook A, Sudsarn P. Anti-inflammatory, antioxidant and hepato protective effects of Thunbergia laurifolia Linn. on experimental opisthor chiasis. Parasitol Res. 2012;111:353–9.CrossRefPubMed
11.
Zurück zum Zitat Prenner GA, Bush A, Wise R, Kim W, Dommier L, Kasha K, Laroche A, Scoles G, Molnar SJ, Fedak G. Reproducibility of random amplified polymorphic DNA (RAPD) analysis among laboratories. Genome Res. 1993;2:341–5.CrossRef Prenner GA, Bush A, Wise R, Kim W, Dommier L, Kasha K, Laroche A, Scoles G, Molnar SJ, Fedak G. Reproducibility of random amplified polymorphic DNA (RAPD) analysis among laboratories. Genome Res. 1993;2:341–5.CrossRef
12.
Zurück zum Zitat Yang X, Quiros C. Identification and classification of celery cultivars with RAPD markers. Theor Appl Genet. 1993;86:205–12.PubMed Yang X, Quiros C. Identification and classification of celery cultivars with RAPD markers. Theor Appl Genet. 1993;86:205–12.PubMed
13.
Zurück zum Zitat Qiu JJ, Li YP. Random amplified polymorphic DNA analysis of eel genome. Cell Res. 1999;9:217–23.CrossRef Qiu JJ, Li YP. Random amplified polymorphic DNA analysis of eel genome. Cell Res. 1999;9:217–23.CrossRef
14.
Zurück zum Zitat Carvalho VP, Ruas CF, Ferreira JM, Moreira RMP, Ruas PM. Genetic diversity among maize (Zea mays L.) landraces assessed by RAPD Markers. Genet Mol Biol. 2004;27:228–36. Carvalho VP, Ruas CF, Ferreira JM, Moreira RMP, Ruas PM. Genetic diversity among maize (Zea mays L.) landraces assessed by RAPD Markers. Genet Mol Biol. 2004;27:228–36.
15.
Zurück zum Zitat Techen N, Parveen I, Pan Z, Khan IA. DNA barcoding of medicinal plant material for identification. Current Opinion In Biotech. 2014;25:103–10.CrossRef Techen N, Parveen I, Pan Z, Khan IA. DNA barcoding of medicinal plant material for identification. Current Opinion In Biotech. 2014;25:103–10.CrossRef
16.
Zurück zum Zitat von Crautlein M, Korpelainen H, Pietilainen M, Rikkinen J. DNA barcoding: a tool for improved taxon identification and detection of species diversity. Biodivers Conserv. 2011;20:373–89.CrossRef von Crautlein M, Korpelainen H, Pietilainen M, Rikkinen J. DNA barcoding: a tool for improved taxon identification and detection of species diversity. Biodivers Conserv. 2011;20:373–89.CrossRef
17.
18.
Zurück zum Zitat Ganopoulos I, Madesis P, Darzentas N, Argiriou A, Tsaftaris A. Barcode High Resolution Melting (Bar-HRM) analysis for detection and quantification of PDO “Fava Santorinis” (Lathyrus clymenum) adulterants. Food Chem. 2012;133:505–12.CrossRefPubMed Ganopoulos I, Madesis P, Darzentas N, Argiriou A, Tsaftaris A. Barcode High Resolution Melting (Bar-HRM) analysis for detection and quantification of PDO “Fava Santorinis” (Lathyrus clymenum) adulterants. Food Chem. 2012;133:505–12.CrossRefPubMed
19.
Zurück zum Zitat Jaakola L, Suokas M, Haggman H. Novel approaches based on DNA barcoding and high-resolution melting of amplicons for authenticity analyses of berry species. Food Chem. 2010;123:494–500.CrossRef Jaakola L, Suokas M, Haggman H. Novel approaches based on DNA barcoding and high-resolution melting of amplicons for authenticity analyses of berry species. Food Chem. 2010;123:494–500.CrossRef
20.
Zurück zum Zitat Sakaridis I, Ganopoulos I, Argiriou A, Tsaftaris A. A fast and accurate method for controlling the correct labeling of products containing buffalo meat using High Resolution Melting (HRM) analysis. Meat Sci. 2013;94:84–8.CrossRefPubMed Sakaridis I, Ganopoulos I, Argiriou A, Tsaftaris A. A fast and accurate method for controlling the correct labeling of products containing buffalo meat using High Resolution Melting (HRM) analysis. Meat Sci. 2013;94:84–8.CrossRefPubMed
21.
Zurück zum Zitat Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol. 2013;30:2725–9.CrossRefPubMedPubMedCentral Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol. 2013;30:2725–9.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Kool M, Korshunov A, Remke M, Jones DTW, Schlanstein M, Northcott PA, Cho YJ, Koster J, Schouten-van Meeteren A, van Vuurden D, Clifford SC, Pietsch T, von Bueren AO, Rutkowski S, McCabe M, Collins VP, Backlund ML, Haberler C, Bourdeaut F, Delattre O, Doz F, Ellison DW, Gilbertson RJ, Pomeroy SL, Taylor MD, Lichter P, Pfister SM. Molecular subgroups of medulloblastoma: an international meta-analysis of transcriptome, genetic aberrations, and clinical data of WNT, SHH, Group 3, and Group 4 medulloblastomas. Acta Neuropathol. 2012;123:473–84.CrossRefPubMedPubMedCentral Kool M, Korshunov A, Remke M, Jones DTW, Schlanstein M, Northcott PA, Cho YJ, Koster J, Schouten-van Meeteren A, van Vuurden D, Clifford SC, Pietsch T, von Bueren AO, Rutkowski S, McCabe M, Collins VP, Backlund ML, Haberler C, Bourdeaut F, Delattre O, Doz F, Ellison DW, Gilbertson RJ, Pomeroy SL, Taylor MD, Lichter P, Pfister SM. Molecular subgroups of medulloblastoma: an international meta-analysis of transcriptome, genetic aberrations, and clinical data of WNT, SHH, Group 3, and Group 4 medulloblastomas. Acta Neuropathol. 2012;123:473–84.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Bosmali I, Ganopoulos I, Madesis P, Tsaftaris A. Microsatellite and DNA-barcode regions typing combined with high resolution melting (HRM) analysis for food forensic uses: a case study on lentils (Lens culinaris). Food Res Int. 2012;46:141–7.CrossRef Bosmali I, Ganopoulos I, Madesis P, Tsaftaris A. Microsatellite and DNA-barcode regions typing combined with high resolution melting (HRM) analysis for food forensic uses: a case study on lentils (Lens culinaris). Food Res Int. 2012;46:141–7.CrossRef
26.
Zurück zum Zitat Newmaster SG, Grguric M, Shanmughanandhan D, Ramalingam S, Ragupathy S. DNA barcoding detects contamination and substitution in North American herbal products. BMC Med. 2013;11:222.CrossRefPubMedPubMedCentral Newmaster SG, Grguric M, Shanmughanandhan D, Ramalingam S, Ragupathy S. DNA barcoding detects contamination and substitution in North American herbal products. BMC Med. 2013;11:222.CrossRefPubMedPubMedCentral
Metadaten
Titel
Fast and reliable detection of toxic Crotalaria spectabilis Roth. in Thunbergia laurifolia Lindl. herbal products using DNA barcoding coupled with HRM analysis
verfasst von
Sahachat Singtonat
Maslin Osathanunkul
Publikationsdatum
01.12.2015
Verlag
BioMed Central
Erschienen in
BMC Complementary Medicine and Therapies / Ausgabe 1/2015
Elektronische ISSN: 2662-7671
DOI
https://doi.org/10.1186/s12906-015-0692-6

Weitere Artikel der Ausgabe 1/2015

BMC Complementary Medicine and Therapies 1/2015 Zur Ausgabe