Skip to main content
Erschienen in: Respiratory Research 1/2018

Open Access 01.12.2018 | Research

FK506-binding protein 10 (FKBP10) regulates lung fibroblast migration via collagen VI synthesis

verfasst von: Larissa Knüppel, Katharina Heinzelmann, Michael Lindner, Rudolf Hatz, Jürgen Behr, Oliver Eickelberg, Claudia A. Staab-Weijnitz

Erschienen in: Respiratory Research | Ausgabe 1/2018

Abstract

Background

In idiopathic pulmonary fibrosis (IPF), fibroblasts gain a more migratory phenotype and excessively secrete extracellular matrix (ECM), ultimately leading to alveolar scarring and progressive dyspnea. Here, we analyzed the effects of deficiency of FK506-binding protein 10 (FKBP10), a potential IPF drug target, on primary human lung fibroblast (phLF) adhesion and migration.

Methods

Using siRNA, FKBP10 expression was inhibited in phLF in absence or presence of 2ng/ml transforming growth factor-β1 (TGF-β1) and 0.1mM 2-phosphoascorbate. Effects on cell adhesion and migration were monitored by an immunofluorescence (IF)-based attachment assay, a conventional scratch assay, and single cell tracking by time-lapse microscopy. Effects on expression of key players in adhesion dynamics and migration were analyzed by qPCR and Western Blot. Colocalization was evaluated by IF microscopy and by proximity ligation assays.

Results

FKBP10 knockdown significantly attenuated adhesion and migration of phLF. Expression of collagen VI was decreased, while expression of key components of the focal adhesion complex was mostly upregulated. The effects on migration were 2-phosphoascorbate-dependent, suggesting collagen synthesis as the underlying mechanism. FKBP10 colocalized with collagen VI and coating culture dishes with collagen VI, and to a lesser extent with collagen I, abolished the effect of FKBP10 deficiency on migration.

Conclusions

These findings show, to our knowledge for the first time, that FKBP10 interacts with collagen VI and that deficiency of FKBP10 reduces phLF migration mainly by downregulation of collagen VI synthesis. The results strengthen FKBP10 as an important intracellular regulator of ECM remodeling and support the concept of FKBP10 as drug target in IPF.
Abkürzungen
FKBP10
FK506-binding Protein 10
IPF
Idiopathic Pulmonary Fibrosis
ECM
Extracellular matrix
phLF
Primary Human Lung Fibroblast
TGF-β1
Transforming Growth Factor-β1
IF
Immunofluorescence
FAK
Focal Adhesion Kinase
FA
Focal Adhesions
Src
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase
ERK
Extracellular Signaling Related Kinase
MAP
Mitogen-activated Protein
FN
Fibronectin
ER
Endoplasmic Reticulum
α-SMA
α-smooth muscle actin
ACTB
β-actin
CAPNS1
Calpain-4
CAV1
Caveolin-1
COL6A1
Collagen VI α1
COL6A3
Collagen VI α3
CORO1C
Coronin 1C
ERp57
ER protein 57 (Protein disulfide-isomerase A3)
FBLN1
Fibulin-1
ITGB1
Integrin-β1
TLN1
Talin 1
COL6A1
Collagen VI alpha 1
COL6A2
Collagen VI alpha 2
COL6A3
Collagen VI alpha 3
PTM
Post-translational Modification
sc
scrambled
kd
knockdown

Background

Patients suffering from idiopathic pulmonary fibrosis (IPF), a highly progressive interstitial lung disease, have a median survival prognosis of 2-5 years after diagnosis [1]. The pathogenic processes are not completely understood. It is currently believed that the fibrotic response is caused by repeated micro-injuries of the respiratory epithelium [2] which leads to the release of profibrotic mediators like transforming growth factor β1 (TGF-β1), followed by myofibroblast differentiation, increased fibroblast migration, and, ultimately, excessive deposition of extracellular matrix (ECM) in the alveolar region [36]. More recent evidence suggests that the composition of the ECM strongly affects fibroblast phenotypes and therefore plays a crucial role in disease progression [4, 7, 8].
Aberrant fibroblast adhesion and migration are common features of fibrosis [911] and targeting fibroblast migration, e.g. by inhibition of focal adhesion kinase (FAK) or of integrins, has been proposed as a treatment strategy [12, 13]. For instance, myofibroblasts possess an increased ability to adhere to the ECM, which is mediated by focal adhesions (FA) attaching the actin cytoskeleton to the matrix [14]. Cell attachment to the ECM via clustering of integrins leads to the recruitment of numerous FA proteins with adapter, structural, and enzymatic functions [15, 16]. For instance, structural proteins like talin, vinculin and α-actinin facilitate the connection between integrins and actin fibers and provide the basis for the transmission of mechanical forces between cell and ECM [17]. To enable cell migration, turnover of FA is necessary. Several factors are involved in FA disassembly, like actin dynamics, FAK and Src phosphorylation, and ERK/MAP kinase-mediated activation of calpain-2, a calcium-dependent protease [15].
Finally, migration is strongly influenced by topology and composition of the ECM including integrin ligands like collagen, fibronectin (FN), and laminin [7]. Collagen type VI appears to play a particularly important role in this context, as several studies indicate a central, albeit context-dependent and tissue-specific role of collagen VI for migration and adhesion [1820].
FK506-binding protein 10 (FKBP10, also termed FKBP65), a member of the family of immunophilins, is an endoplasmic reticulum (ER) -resident peptidyl prolyl isomerase and a collagen I chaperone [21]. We have previously reported upregulation of FKBP10 in experimental lung fibrosis and IPF, where it is mainly expressed by (myo)fibroblasts [22]. Deficiency of FKBP10 by siRNA-mediated knockdown in primary human lung fibroblasts (phLF) reduced the expression of profibrotic markers like α-smooth muscle actin (α-SMA), FN and collagen I, and suppressed collagen secretion [22].
As properties of the ECM play an important role in adhesion dynamics and FKBP10 has been identified previously as a regulator of collagen biosynthesis in phLF, the aim of this study was to assess the effect of FKBP10 deficiency on adhesion and migration in phLF. To elucidate the underlying mechanisms, we analyzed the effect of siRNA-mediated knockdown of FKBP10 on intracellular and membrane-spanning components of the FA complex, on regulatory events of FA turnover, on proteins involved in actin dynamics, and, finally, on a selection of ECM proteins with important emerging functions in migration.

Methods

Material

Primers were obtained from MWG Eurofins (Ebersberg, Germany) and are shown in Table 1. Table 2 contains used primary antibodies. HRP-linked and fluorescent labeled secondary antibodies were purchased from GE Healthcare Life Sciences (Freiburg, Germany).
Table 1
Primer table for Real-Time Quantitative Reverse-Transcriptase PCR (qRT-PCR). Primers were synthesized by MWG Eurofins (Ebersberg, Germany).
Target
Species
Forward primer (5′-3′)
Reverse primer (5′-3′)
CAPNS1
human
GACGCTACTCAGATGAAAGT
TCTTTGTCAAGAGATTTGAAG
CAV1
human
TCACTGTGACGAAATACTG
CGTAGATGGAATAGACACG
COL6A1
human
GACGCACTCAAAAGCA
ATCAGGTACTTATTCTCCTTCA
COL6A2
human
AGAAAGGAGAGCCTGCGGAT
AGGTCTCCCTCACGTAGGTC
COL6A3
human
CTCTACCGAGCCCAGGTGTT
ATGAGGGTGCGAACGTACTG
CORO1C
human
GTTAACAAATGTGAGATTGC
TGGAAAAGGTCAGACTTC
DHX8
human
TGACCCAGAGAAGTGGGAGA
ATCTCAAGGTCCTCATCTTCTTCA
ERK1
human
TTCGAACATCAGACCTACT
AGGTCCTGCACAATGTAG
FBLN1C
human
GCCCTGAGAACTACCG
GAGAGGTGGTAGTAGGTTATTC
FKBP10
human
CGACACCAGCTACAGTAAG
TAATCTTCCTTCTCTCTCCA
ITGB1
human
TTACAAGGAGCTGAAAAACT
AAAATGACTTCTGAGGAAAG
TLN1
human
GCTCTTTCTGTCAGATGAT
CATAGTGTCCCCATTTC
Table 2
Primary antibodies used in Western Blot analysis, Immunofluorescence and Proximity Ligation Assays
Target
Abbreviation
Antibody
Provider
Application
β-actin
ACTB
HRP-conjugated anti-ACTB antibody
Sigma Aldrich, St. Louis, USA
WB
Calpain-4
CAPNS1
mouse monoclonal anti-Calpain-4
Abnova, Taipei City, Taiwan
WB, IF, PLA
Caveolin-1
CAV1
rabbit monoclonal anti-Caveolin-1 antibody
Cell Signaling, Boston, USA
WB
Collagen VI α1
COL6A1
mouse monoclonal anti-Collagen VI A1 antibody
Santa Cruz, Dallas, USA
WB, IF, PLA
Collagen VI α3
COL6A3
mouse monoclonal anti-Collagen VI A3 antibody
Santa Cruz, Dallas, USA
IF, PLA
Coronin 1C
CORO1C
mouse monoclonal anti-CORO1C antibody
Santa Cruz, Dallas, USA
WB, IF, PLA
Extracellular Signaling Related Kinase 1
ERK1
mouse monoclonal anti-ERK1 antibody
BD Biosciences, New Jersey, USA
WB
ER protein 57 (Protein disulfide-isomerase A3)
ERp57
mouse monoclonal anti-ERp57
Abcam, Cambridge, UK
PLA
Fibulin-1
FBLN1
mouse monoclonal anti-FBLN1 antibody
Santa Cruz, Dallas, USA
WB, IF, PLA
FK506-binding protein 10
FKBP10
rabbit polyclonal anti-FKBP10 antibody
ATLAS, Stockholm, Sweden
WB, IF, PLA
Focal Adhesion Kinase
FAK
rabbit polyclonal anti-FAK antibody
Santa Cruz, Dallas, USA
WB
Golgin97
CDF4
mouse monoclonal anti-Golgin97 antibody
Invitrogen, Carlsbad, USA
PLA
mouse IgG (neg. ctrl)
mouse IgG
mouse IgG1κ isotype control
eBioscience, San Diego, USA
PLA
Integrin-β1
ITGB1
mouse monoclonal anti-ITGB1 antibody
Abcam, Cambridge, UK
WB
Phosphorylated Extracellular Signaling Related Kinase 1/2
p-ERK1/2
rabbit monoclonal anti-pERK1/2 (Thr202/Tyr204)
Cell Signaling, Boston, USA
WB
Phosphorylated Focal Adhesion Kinase
p-FAK Y397
rabbit monoclonal anti-pFAK (Tyr397)
Cell Signaling, Boston, USA
WB
Phosphorylated Focal Adhesion Kinase
p-FAK Y566/577
rabbit monoclonal anti-pFAK (Tyr576/Tyr577)
Biomol, Hamburg, Germany
WB
Phosphorylated SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase
p-Src
rabbit polyclonal anti-pSrc (Tyr416)
Cell Signaling, Boston, USA
WB
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase
Src
mouse monoclonal anti-Src
Cell Signaling, Boston, USA
WB
Talin 1
TLN1
mouse monoclonal anti-TLN1
Sigma Aldrich, Dt. Louis, USA
WB, IF, PLA
Secondary HRP-linked antibodies and secondary antibodies (Alexa Fluor 488 goat anti-mouse IgG, Alexa Fluor 568 goat anti-rabbit IgG) for IF were purchased from GE Healthcare Life Sciences (Freiburg, Germany). 4',6-Diamidino-2-phenylindole (DAPI) was used for nuclear staining (Sigma-Aldrich, St. Louis, USA)

Statistical Analysis

Statistical analysis was performed in GraphPadPrism 5 (GraphPad Software, San Diego, CA, USA). Results are shown as mean ± SEM. Paired t-test was used for statistical analysis. Notably, analysis using a Wilcoxon signed rank test yielded very similar results except for the scratch assays shown in Fig. 5a where results just failed significance (not shown). Significance is indicated as follows: *p<0.05, **p<0.01, ***p<0.001.

Human Lung Material, Isolation and Culture of phLF

Primary human lung fibroblasts (phLF) were isolated from human lung tissue and derived from in total eight different patients. The tissue derived from human lung explant material of IPF patients or histologically normal regions adjacent to resected lung tumors was obtained from the BioArchive CPC-M for lung diseases at the Comprehensive Pneumology Center (CPC Munich, Germany). The study was approved by the local ethics committee of the Ludwig-Maximilians University of Munich, Germany, and all participants gave written informed consent. Isolation and culture of phLF was performed as described previously [22, 23]. Notably, in previous studies, we have never seen consistent expression differences between control and IPF fibroblasts, neither in terms of basal and TGF-β1-induced gene expression of collagens and collagen biosynthetic enzymes, nor in terms of collagen secretion [22, 23].

Transfection of phLF and TGF-β1 Treatment

Cells were seeded at a density of 20.000–25.000 cells/cm2. Reverse transfection was carried out with human small interfering RNA of FKBP10 (siRNA) (s34171; Life Technologies, Carlsbad, CA) or negative control siRNA. Twenty-four hours later starvation for another 24 hours in Dulbecco’s modified Eagle medium/F-12 including 0.5% fetal bovine serum and 0.1 mM 2-phospho-L-ascorbic acid was performed. Then, cells were treated with 2 ng/ml TGF-β1 (R&D Systems, Minneapolis, MN) in starvation medium for another 24 - 48 h, followed by harvesting for RNA and protein analysis. Unless stated otherwise, all data is derived from eight independent knockdown experiments in at least three and maximally in eight different human primary fibroblast lines. For fibroblast lines that had been used for more than one knockdown experiment in different passages, typically a mean was formed for these experiments prior to statistical analysis to avoid overrepresentation of one biological replicate in the data.

RNA Isolation and Real-Time Quantitative Reverse-Transcriptase PCR (qRT-PCR) Analysis

RNA isolation and qRT-PCR analysis were performed as described previously [22, 23].

Protein Isolation and Western Blot analysis

Protein isolation and Western Blot analysis were performed as described previously [22, 23].

Cell Fixation and Immunofluorescent Stainings

Cells were seeded on FN-coated coverslips (6 μg/mL, Sigma-Aldrich, St. Louis, USA), followed by serum starvation and TGF-β1 treatment for 48h as described above. The fixation method was chosen accordingly to the used antibodies. For methanol fixation, cells were washed once in 1x phosphate-buffered saline (PBS), followed by fixation with 100% methanol for 2 minutes on ice and three additional washing steps with 1x PBS to remove the residual methanol.
For para-formaldehyde (PFA) fixation, cells were washed once with 1x PBS and 4% PFA was added to the cells followed by incubation at room temperature for 20 minutes. Residual PFA was removed by three washing steps with 1x PBS. Staining of the cover slips was performed as described before [22]. Immunofluorescence (IF) was examined by acquiring z-stack images with an Axio Imager M2 Microscope (Carl Zeiss, Jena, Germany) and analysed by AxioVision 4.8 software.

Proximity Ligation Assay (PLA)

Cells were seeded, treated with TGF-β1 for 48h, and methanol-fixed as described above. The Duolink® PLA Kit (Sigma Aldrich, St. Louis, USA) was used and carried out according to the manufacturer’s protocol. Interaction of FKBP10 with target proteins was visualized using an Axio Imager M2 Microscope (Carl Zeiss, Jena, Germany).

Cell Adhesion Assay

For analysis of cell attachment in FKBP10-deficient phLF, cells were seeded and treated as described above. After 48h of TGF-β1 treatment and 96h of siRNA knockdown, cells were trypsinized and counted. Per condition, four replicates with 100.000 cells per 48-well were seeded and incubated for 1 hour at 37°C, 5% CO2. Wells were carefully washed once with 1 x PBS to remove non-adherent cells and attached cells were fixed with 4% PFA as described before. Cells were stained with 4′,6-Diamidin-2-phenylindol (DAPI) and Phalloidin, labeled with Alexa Fluor 568 (Invitrogen) followed by imaging using an LSM T-PMT microscope (Carl Zeiss, Jena, Germany). Attached cells were counted using IMARIS Software 9.0. Results were normalized to non-treated control and visualized as percentage of attached cells.

Scratch Assay

Cells were seeded at a density of 35.000 cells/cm2 and siRNA-mediated knockdown of FKBP10 was performed as described above. To reach 100% confluency, cells were grown for 48h followed by starvation for 24h. A scratch was executed using a 1000 μL pipette tip and TGF-β1 was added. Images were taken at time point 0h using an inverse microscope (Primovert, Carl Zeiss, Jena, Germany) and the section was marked by a black dot. After 24h, additional images were taken to compare wound closure between control and FKBP10 deficient cells. Results are given in percent of wound closure normalized to untreated control.

Single Cell Migration Assay Using Time Lapse Microscopy

Cells were seeded at a density of 5.500 cells/cm2 on uncoated, collagen I-coated (~50 μg/mL, Sigma-Aldrich, St. Louis, USA), or collagen VI-coated (10 μg/mL, Abcam, Cambridge, UK) wells. Knockdown by siRNA of FKBP10 was performed as described above. After 24h, cells were serum-starved for another 24h followed by TGF-β1 treatment (2 ng/mL) for 24h. Movies were generated over a period of 12h - 24h using Axio Observer Z1 microscope equipped with an AxioCam camera (Carl Zeiss, Jena, Germany) and images were taken in 20 min intervals. Single cell movement was analyzed using the cell tracking tool of the AxioVision 4.8 software (Carl Zeiss, Jena, Germany).

Results

Deficiency of FKBP10 attenuates migration and adhesion of primary human lung fibroblasts

SiRNA-mediated knockdown of FKBP10 expression in phLF was highly efficient on both protein and mRNA level (Fig. 1a, b, knockdown efficiency 86% ± 5%). Wound closure in a conventional scratch assay was significantly reduced in FKBP10-deficient cells compared to control in absence of TGF-β1. A similar trend was observed in presence of TGF-β1, which just failed significance (Fig. 1c, d). These results were confirmed with an independent and more accurate method, namely a single cell migration assay using time-lapse microscopy to track individual cells. In this assay, FKBP10-deficient cells showed a highly significant reduction of mean velocity both in absence and presence of TGF-β1 (Fig. 1e).
Next, we investigated the effect of siRNA-mediated knockdown of FKBP10 on adhesion of phLF using an IF-based attachment assay. In presence of TGF-β1, FKBP10 deficiency significantly reduced the ability of phLF to adhere to the cell culture dish surface (Fig. 1f).
While TGF-β1 had no significant effect on migration, neither in the scratch nor in the single cell tracking assay, TGF-β1 significantly increased fibroblast adhesion.

Deficiency of FKBP10 upregulates expression of key molecules of adhesion and migration in primary human lung fibroblasts, but does not alter the activation of focal adhesion kinase and downstream pathways

To gain a better understanding of the effect of FKBP10 deficiency on adhesion and migration, we analyzed several selected proteins with key functions in these processes. In terms of altered gene expression of focal adhesion and ECM components, we only observed marginal differences between fibroblasts isolated from normal histology control or from IPF lung tissue and therefore decided to pool the data. Deficiency of FKBP10 in phLF led to induction of the focal adhesion component talin-1 (TLN1) on protein and mRNA level in absence and presence of TGF- β1 (Fig. 2a, b). Next, we investigated the effect of FKBP10 knockdown on calpain-4 (CAPNS1), the small regulatory subunit of calpain-1 and calpain-2, which is indispensable for formation and strengthening of adhesions and for mechanosensing during fibroblast migration [24]. Similar to TLN1, CAPNS1 expression was significantly upregulated in absence and presence of TGF-β1 on transcript level (Fig. 2c, d); this effect, however, translated to the protein level only in absence of TGF-β1. Moreover, FKBP10 knockdown also increased protein levels of the transmembrane collagen receptor integrin-β1 (ITGB1), particularly in presence of TGF-β1 (Fig. 2e), while transcript levels were not significantly changed (Fig. 2f). Finally, two modulators of cytoskeleton dynamics, caveolin-1 (CAV1) and coronin-1C (CORO1C), were regulated in opposite directions: Whereas CAV1 expression (protein and mRNA) was downregulated upon FKBP10 knockdown in presence of TGF-β1 (Fig. 2g, h), CORO1C protein levels were upregulated (Fig. 2i, j).
FAK activation by either integrins or growth factors leads to autophosphorylation of Tyr 397 in FAK, creating a motif which results in binding and conformational activation of proto-oncogene tyrosine-protein kinase Src. Active Src triggers further FAK phosphorylation on Tyr sites like Tyr 576/577, starting the ras-raf-MEK-ERK signal transduction cascade which is implicated in many processes including cell adhesion and migration. MEK1/2 catalyzes ERK1/2 phosphorylation on specific Tyr and Thr residues essential for enzyme activity [25, 26].
Deficiency of FKBP10 slightly upregulated total FAK levels (Fig. 3a); however, there was no significant effect on the phosphorylation on Tyr 397 or Tyr 576/577 of FAK (Fig. 3b, c). Similarly, none of the assessed downstream signaling pathways appeared affected: Neither levels of total Src and phospho-Src nor levels of total ERK1 and phosphorylated ERK1/2 changed upon FKBP10 knockdown (Fig. 3d-g).

FKBP10 interacts with type VI collagen and fibulin-1 and regulates their expression

As changes in expression of focal adhesion complex components and in events during FAK signaling did not explain the observed attenuated migration upon FKBP10 knockdown, we reasoned that changes in ECM composition could be the main cause of reduced migration velocity. Besides the ECM proteins collagen I and FN, which we reported to be downregulated upon FKBP10 knockdown previously [22], collagen VI and fibulin-1 also have been described to maintain important roles in the process of cell migration [18, 27]. Here, we found that collagen VI and fibulin-1 expression were regulated in different directions in response to FKBP10 knockdown. Collagen 6A1 was significantly reduced on protein level in FKBP10 deficient phLF with and without TGF-β1, whereas COL6A1 transcript was only reduced in presence of TGF-β1 (Fig. 4a, b). Interestingly, mRNA levels of COL6A2 and COL6A3 chains were not influenced by FKBP10 deficiency (Fig. 4c, d). In contrast, fibulin-1 protein expression was increased in response to FKBP10 knockdown in absence and presence of TGF-β1; transcript levels of FBLN1C were significantly upregulated under basal conditions upon FKBP10 knockdown (Fig. 4e, f).
Co-localization of FKBP10 with both, collagen VI (COL6A1 and COL6A3) (Fig. 4g, h) and fibulin-1 (Fig. 4i) was examined by IF stainings and PLA (Fig. 4j). Negative controls (mouse IgG and Golgin97) did not show any interaction with FKBP10. Endoplasmic Reticulum Protein 57 (ERp57), previously reported by IF to co-localize with FKBP10 [22] was used as positive control and showed proximity to FKBP10. Positive signals were also observed for COL6A1, COL6A3 and FBLN1, indicating interaction with or proximity to FKBP10.

The effects of FKBP10 deficiency on migration and adhesion depend on 2-phosphoascorbate and are abolished by coating cell culture dishes with collagen VI

Post-translational modifications (PTM) like proline and lysine hydroxylation of collagens (including collagen VI) are crucial steps in collagen biosynthesis and catalyzed by ascorbate-dependent prolyl and lysyl hydroxylases [2830]. In contrast, FBLN1 biosynthesis is not dependent on ascorbate [31]. Therefore, we reasoned that exclusion of ascorbate from the culture medium would give us a first indication whether decreased biosynthesis of collagen or increased biosynthesis of fibulin may underlie the observed effects of FKBP10 deficiency on migration and adhesion. Notably, in absence of 2-phosphoascorbate the effect of FKBP10 deficiency in phLF on adhesion and migration was lost, in comparison to the results in presence of 2-phosphoascorbate (Fig. 5), pointing towards a collagen-dependent mechanism.
As both collagen I and collagen VI are downregulated upon FKBP10 deficiency [22], we coated dishes with either collagen I or collagen VI and analyzed migration in a single-cell migration approach. Notably, the effect of FKBP10 deficiency in phLFs on migration was completely lost when culture dishes were coated with collagen VI (Fig. 6b) when compared to uncoated dishes (Fig. 6a). Some compensation was also visible in collagen I-coated dishes, albeit not that pronounced (Fig. 6c).

Discussion

In this study we demonstrated that FKBP10 deficiency inhibited phLF adhesion and migration. This effect could neither be explained by changes in expression or activation of components of the FA complex, nor by changes in FAK downstream signaling events, nor by changes in regulators of actin dynamics. Instead, we found that the effect of FKBP10 deficiency on migration and adhesion depended on 2-phosphoascorbate, pointing towards a central role of collagen biosynthesis in this context. Loss of FKBP10 downregulated the expression of collagen VI, a collagen type increasingly recognized as a central player in migration, and coating culture dishes with collagen VI completely abolished the effect of FKBP10 deficiency on phLF migration.
Next to excessive ECM deposition by interstitial fibroblasts, aberrant fibroblast adhesion and increased migration are also important features of IPF [6, 911]. Here we show that loss of the collagen chaperone FKBP10, which we previously identified as potential IPF drug target due to its role in ECM synthesis and secretion [22], inhibited wound closure and reduced the mean velocity and adhesion capacity of phLF (Fig. 1). This observation is in line with the very recent report by Liang et al., showing that siRNA-mediated knockdown of FKBP10 led to reduced migration in human hypertrophic scar fibroblasts [32]. Collectively, these studies are confirmative of our concept of FKBP10 as potential drug target in fibrotic disease.
We assessed fibroblast migration both in a conventional scratch assay as well as by tracking individual cells with videomicroscopy in time-lapse experiments, a more accurate approach. Overall, both assays consistently showed reduced migration under conditions of FKBP10 deficiency, even if the scratch assay results in presence of TGF-β1 failed significance (p=0.06). We believe that this minor discrepancy reflects the well-known disadvantages of the scratch assay, most importantly variations in gap width due to the manually applied and therefore often uneven scratch, the fact that ECM substrate is equally scraped off together with the cells, and also the mechanical cell damage which may introduce artifacts. These technical drawbacks may explain the greater variations observed in this assay, leading to results that just fail significance.
Our finding that TGF-β1 did not affect fibroblast migration is in agreement with previous studies by others [3335]. Increased fibroblast adhesion in presence of TGF-β1 may in part reflect increased expression of β1-integrin (this work, cf. Fig. 2e, f, scr ctrl vs. scr TGF-β1, p=0.0642) and/or β3-integrins [36].
Initially, we sought to assess the effect of FKBP10 deficiency on several regulatory levels of FA turnover to elucidate the mechanism underlying attenuated migration. Cell migration is a complex cyclic process starting with the extension of membrane protusions (lamellipodia) at the leading edge followed by their adhesion to the ECM and retraction of the cell tail [37]. During cell migration assembly and disassembly of FA is dynamically regulated. The process of cell attachment to the ECM is initiated by clustering of integrins on the cell surface, heterodimeric transmembrane receptors consisting of α and β subunits. The intracellular domains of the clustered integrins serve as a platform for FA protein recruitment and ultimately link the ECM via FA to actin stress fibers [38]. In this context, TLN1 mediates the initiation of FA assembly by interacting with the cytoplasmic domain of the integrin β subunit on the one hand and with actin and actin-binding proteins on the other [15]. Another initial event upon integrin clustering is activation of FAK including autophosphorylation of Tyr 397 and Src-mediated phosphorylation of additional tyrosine residues within FAK (e.g. Y 566 and 577), which are essential for full FAK activity. Active FAK interacts with multiple signalling molecules including Grb7, PI3K, paxillin, MLCK and ERK, activating signalling pathways which result in protrusion extension, increased FA turnover, and therefore, ultimately, in increased cell motility [15, 3942]. The protease calpain 2, a heterodimer consisting of a catalytic subunit and a regulatory subunit (calpain-4, CAPNS1) plays a central role in this context as it, when recruited by FAK and activated by ERK/MAP kinase, mediates amongst others proteolysis of TLN1 and FAK, considered the rate-limiting step in FA turnover [15, 38, 39, 43, 44]. Finally, directional cell migration is strongly dependent on polarized actin dynamics. Rho-like GTPases like RhoA and Rac1 control cytoskeleton contractility, polymerization, and protrusion. The integral membrane protein caveolin-1 (Cav-1), activated by small kinases like Src, is a central regulator of Rho-like GTPase signaling in this context [45, 46]. Another regulator of actin filament turnover in the lamellipodia during cell migration is the actin binding protein coronin 1C (CORO1C) [47].
FKBP10 deficiency led to several significant changes in expression of FA components on all levels assessed, i.e. upregulation of ITGB1, TLN1, CAPNS1, FAK, CORO1C and downregulation of CAV1 (Fig. 2). Upregulation of ITGB1 may associate with reduced FA turnover and slow migration [4850] but impaired migration and adhesion has also been reported as a result of ITGB1 deficiency [51]. Collectively, these findings suggest that manipulation of ITGB1 protein levels in general is unfavorable to cell motility, regardless of direction of regulation. As ITGB1 functions as an adapter protein between the ECM and intracellular FA complexes, it is conceivable that its expression levels must be tightly regulated to allow for functional intermolecular interactions between different interacting partners.
The same may apply to TLN1, an adapter protein linking the cytoskeleton to ITGB1, where reports in the literature are also seemingly controversial: Upregulation of TLN1, but also suppression of TLN1 has been reported to reduce migration and adhesion [5254]. Interestingly, downregulation of TLN1 has also been associated with increased migration [52, 55], which is in support of its function as a regulator of FA turnover together with its protease calpain-2 [15, 38, 39, 43, 44]. In our system, however, the simultaneous increase of the regulatory calpain 2 subunit CAPNS1, argues for overall little change in FA turnover, at least in absence of TGF-β1 (Fig. 2c, d). This is consistent with our observation that phosphorylation levels of FAK, Src, and ERK (Fig. 3), central signaling events in the process of FA turnover [39, 5658] remained unchanged.
At first, observing inhibition of adhesion and migration in the absence of changes in activation of FAK and related signaling pathways seemed contradictory to us. However, similarly, Asano and colleagues have reported that siRNA-mediated knockdown of α-smooth muscle actin (α-SMA) in phLF led to inhibition of migration without affecting the FAK signaling pathway [59]. This observation suggested that changes in actin dynamics may underlie the observed inhibition of migration and, indeed, from our previous studies, we know that FKBP10 deficiency reduces α-SMA expression in phLF [22]. Also, deficiency of the actin binding protein CORO1C typically results in inhibition of migration; however, here, we observed a moderate increase of CORO1C protein rather than downregulation (Fig. 2i) [60, 61]. Expression of CAV1, deficiency of which typically results in decreased migratory speed in variable cell types [6264], was only moderately downregulated in presence of TGF-β1 (Fig. 2g, h). Collectively, these observations do not argue for altered actin dynamics as a major mechanism underlying inhibition of migration in response to FKBP10 deficiency.
Importantly, cell migration is influenced by properties of the ECM, like density of adhesion ligands (collagen, FN), ECM composition, and stiffness [7, 65]. Previously, we have observed downregulation of expression and secretion of type I collagen and FN, both major components of the fibroblast ECM, in response to FKBP10 knockdown [22]. Here we extended this analysis and assessed additional ECM components with important roles in cell migration, namely type VI collagen and FBLN1. Both proteins colocalized with FKBP10 in phLF, as assessed by both immunofluorescence colocalization analysis and proximity ligation assay (Fig. 4g-j), indicating direct interaction with FKBP10 in the ER. Interestingly, we found that loss of FKBP10 significantly increased FBLN1 expression (Fig. 4e, f), but decreased protein levels of COL6A1 (Fig. 4a, b). Notably, COL6A1 deficiency is sufficient to inhibit collagen VI deposition in the ECM, as no triple helical molecules can be formed without the α1(VI)-chain [66]. These results suggest opposing functions of FKBP10 in FBLN1 and collagen VI biosynthesis in phLF. It is tempting to speculate, for instance, that FKBP10 acts as a FBLN1 chaperone, sequestering FBLN1 in the ER, prohibiting packing in vesicles for secretion or targeting FBLN1 for ER-associated protein degradation, while at the same time FKBP10 is likely required for efficient collagen VI triple helix formation, similar to collagen I and III [21, 67, 68]. These aspects will be interesting to explore in future studies.
As to function of these proteins in migration, reduced attachment and decreased migratory speed has been reported for a human breast cancer cell line (MDA MB231) in response to FBLN1 overexpression [27] and siRNA mediated knockdown of FBLN1 in corneal fibroblasts upregulated cell migration [69]. Therefore, taken together, it was plausible that increased FBLN1 levels may underlie the observed inhibition of migration under conditions of FKBP10 deficiency.
While collagen VI begins to emerge as an important regulator of cell migration, reports on its direction of effect, inhibiting or promoting migration, are controversial [1820]. For instance, collagen VI-deficient tendon fibroblasts show delayed wound closure, i.e. lower migration speed, in a scratch assay [18], while human dermal fibroblasts displayed higher migration speed on matrices derived from collagen VI-deficient cells [20]. These discrepancies may be a result of the divergent approaches in the mentioned studies (assessment of newly formed ECM versus assessment of ECM deposited within 10 days, respectively), different collagen VI chains assessed (COL6A1 versus COL6A2), but also of the different cell origins, thus possibly reflecting time-, chain-, and cell-specific effects of collagen VI.
Ascorbic acid is a cofactor necessary for proline and lysine hydroxylation during collagen synthesis [68] including collagen VI [30, 70], but not required for FBLN1 synthesis. Therefore, to differentiate between increased FBLN1 or decreased type VI collagen as the underlying mechanism of decreased adhesion and migration, we compared effects of FKBP10 knockdown on adhesion and migration in absence and presence of 2-phosphoascorbate, a stable analogue of ascorbic acid. Notably, neither migration nor adhesion were changed upon loss of FKBP10 when the cell culture medium was ascorbate-deficient (Fig. 5a, b). These results strongly indicated that the effect of FKBP10 deficiency on adhesion and migration was collagen-dependent. While coating with collagen VI abolished the effect of FKBP10 knockdown on migration completely, coating with collagen I only did so marginally (Fig. 6). Overall, this indicated that FKBP10 knockdown inhibits lung fibroblast migration by reduced collagen VI biosynthesis rather than reduced collagen I biosynthesis, an effect of FKBP10 deficiency which we have reported previously [22].

Conclusion

Collagen VI is an important regulator of the ECM organizing the three-dimensional meshwork of collagen and FN fibers [71, 72] and the topography of the fibrillar ECM network guides directional cell migration [73]. Therefore, our observations suggest that loss of FKBP10 results in reduced biosynthesis of collagen VI and, possibly in combination with decreased extracellular collagen I levels, leads to a disorganized ECM with changed adhesion ligand density, stiffness and composition, which may not provide sites for integrin clustering and does not favor directional cell migration. Upregulation of ITGB1, TLN1, CAPNS1, total FAK, and CORO1C may ultimately reflect an attempt of the cells to overcome decreased migration by overcompensation, increasing expression of ECM receptors or components of the FA turnover machinery.
Interestingly, FKBP10 mediates dimerization with collagen lysyl hydroxylase 2 and thus contributes to the generation of collagen hydroxylysines, which act as substrates for extracellular lysyl-oxidase-mediated collagen crosslinking [7476]. Extracellular collagen lacking proper crosslinks is prone to proteolytic degradation and may not be able to contribute to the higher ordered organization of the ECM anymore [7780]. Therefore, downregulation of FKBP10 may also contribute to disorganization of the ECM by providing less crosslinking sites in type I and type VI collagen.
In summary, we found that loss of FKBP10 in phLF results in decreased adhesion and migration. We found that the main underlying mechanism was reduced collagen VI biosynthesis, as both ascorbate deficiency and coating of cell culture dishes with collagen VI abolished the effect of FKBP10 knockdown on migration. As increased fibroblast migration is a characteristic of IPF, the results are in support of our concept of FKBP10 as a potential drug target for IPF.

Acknowledgements

We thank Elisabeth Hennen for excellent technical assistance, and Gerald Burgstaller for his support with single cell migration assays. Human samples for derivation of phLF were kindly provided by the CPC-M BioArchive.

Funding

This work was supported by the Friedrich-Baur-Stiftung (grant to CASW, 51/16), the Helmholtz Association, and the German Center for Lung Research (DZL).

Availability of data and materials

The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.
The study was approved by the local ethics committee of the Ludwig-Maximilians University of Munich, Germany (333-10), and all participants gave written informed consent.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
2.
Zurück zum Zitat Fernandez IE, Eickelberg O. New cellular and molecular mechanisms of lung injury and fibrosis in idiopathic pulmonary fibrosis. Lancet. 2012;380:680–8.CrossRefPubMed Fernandez IE, Eickelberg O. New cellular and molecular mechanisms of lung injury and fibrosis in idiopathic pulmonary fibrosis. Lancet. 2012;380:680–8.CrossRefPubMed
4.
Zurück zum Zitat Hinz B, Phan SH, Thannickal VJ, Galli A, Bochaton-Piallat ML, Gabbiani G. The myofibroblast: one function, multiple origins. Am J Pathol. 2007;170:1807–16.CrossRefPubMedPubMedCentral Hinz B, Phan SH, Thannickal VJ, Galli A, Bochaton-Piallat ML, Gabbiani G. The myofibroblast: one function, multiple origins. Am J Pathol. 2007;170:1807–16.CrossRefPubMedPubMedCentral
5.
Zurück zum Zitat Rock JR, Barkauskas CE, Cronce MJ, Xue Y, Harris JR, Liang J, Noble PW, Hogan BL. Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition. Proc Natl Acad Sci U S A. 2011;108:E1475–83.CrossRefPubMedPubMedCentral Rock JR, Barkauskas CE, Cronce MJ, Xue Y, Harris JR, Liang J, Noble PW, Hogan BL. Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition. Proc Natl Acad Sci U S A. 2011;108:E1475–83.CrossRefPubMedPubMedCentral
6.
7.
Zurück zum Zitat Burgess JK, Mauad T, Tjin G, Karlsson JC, Westergren-Thorsson G. The extracellular matrix - the under-recognized element in lung disease? J Pathol. 2016;240:397–409.CrossRefPubMedPubMedCentral Burgess JK, Mauad T, Tjin G, Karlsson JC, Westergren-Thorsson G. The extracellular matrix - the under-recognized element in lung disease? J Pathol. 2016;240:397–409.CrossRefPubMedPubMedCentral
8.
Zurück zum Zitat Parker MW, Rossi D, Peterson M, Smith K, Sikstrom K, White ES, Connett JE, Henke CA, Larsson O, Bitterman PB. Fibrotic extracellular matrix activates a profibrotic positive feedback loop. J Clin Invest. 2014;124:1622–35.CrossRefPubMedPubMedCentral Parker MW, Rossi D, Peterson M, Smith K, Sikstrom K, White ES, Connett JE, Henke CA, Larsson O, Bitterman PB. Fibrotic extracellular matrix activates a profibrotic positive feedback loop. J Clin Invest. 2014;124:1622–35.CrossRefPubMedPubMedCentral
9.
Zurück zum Zitat Chang YZ, Yang L, Yang CQ. Migration of hepatic stellate cells in fibrotic microenvironment of diseased liver model. Hepatobiliary Pancreat Dis Int. 2008;7:401–5.PubMed Chang YZ, Yang L, Yang CQ. Migration of hepatic stellate cells in fibrotic microenvironment of diseased liver model. Hepatobiliary Pancreat Dis Int. 2008;7:401–5.PubMed
10.
12.
Zurück zum Zitat Lagares D, Busnadiego O, Garcia-Fernandez RA, Kapoor M, Liu S, Carter DE, Abraham D, Shi-Wen X, Carreira P, Fontaine BA, et al. Inhibition of focal adhesion kinase prevents experimental lung fibrosis and myofibroblast formation. Arthritis Rheum. 2012;64:1653–64.CrossRefPubMedPubMedCentral Lagares D, Busnadiego O, Garcia-Fernandez RA, Kapoor M, Liu S, Carter DE, Abraham D, Shi-Wen X, Carreira P, Fontaine BA, et al. Inhibition of focal adhesion kinase prevents experimental lung fibrosis and myofibroblast formation. Arthritis Rheum. 2012;64:1653–64.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Henderson NC, Sheppard D. Integrin-mediated regulation of TGFbeta in fibrosis. Biochim Biophys Acta. 1832;2013:891–6. Henderson NC, Sheppard D. Integrin-mediated regulation of TGFbeta in fibrosis. Biochim Biophys Acta. 1832;2013:891–6.
14.
Zurück zum Zitat Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol. 2002;3:349–63.CrossRefPubMed Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol. 2002;3:349–63.CrossRefPubMed
15.
18.
Zurück zum Zitat Sardone F, Santi S, Tagliavini F, Traina F, Merlini L, Squarzoni S, Cescon M, Wagener R, Maraldi NM, Bonaldo P, et al. Collagen VI-NG2 axis in human tendon fibroblasts under conditions mimicking injury response. Matrix Biol. 2016;55:90–105.CrossRefPubMed Sardone F, Santi S, Tagliavini F, Traina F, Merlini L, Squarzoni S, Cescon M, Wagener R, Maraldi NM, Bonaldo P, et al. Collagen VI-NG2 axis in human tendon fibroblasts under conditions mimicking injury response. Matrix Biol. 2016;55:90–105.CrossRefPubMed
19.
Zurück zum Zitat Soret R, Mennetrey M, Bergeron KF, Dariel A, Neunlist M, Grunder F, Faure C, Silversides DW, Pilon N, Ente-Hirsch Study G. A collagen VI-dependent pathogenic mechanism for Hirschsprung's disease. J Clin Invest. 2015;125:4483–96.CrossRefPubMedPubMedCentral Soret R, Mennetrey M, Bergeron KF, Dariel A, Neunlist M, Grunder F, Faure C, Silversides DW, Pilon N, Ente-Hirsch Study G. A collagen VI-dependent pathogenic mechanism for Hirschsprung's disease. J Clin Invest. 2015;125:4483–96.CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Theocharidis G, Drymoussi Z, Kao AP, Barber AH, Lee DA, Braun KM, Connelly JT. Type VI Collagen Regulates Dermal Matrix Assembly and Fibroblast Motility. J Invest Dermatol. 2016;136:74–83.CrossRefPubMed Theocharidis G, Drymoussi Z, Kao AP, Barber AH, Lee DA, Braun KM, Connelly JT. Type VI Collagen Regulates Dermal Matrix Assembly and Fibroblast Motility. J Invest Dermatol. 2016;136:74–83.CrossRefPubMed
21.
Zurück zum Zitat Ishikawa Y, Vranka J, Wirz J, Nagata K, Bachinger HP. The rough endoplasmic reticulum-resident FK506-binding protein FKBP65 is a molecular chaperone that interacts with collagens. J Biol Chem. 2008;283:31584–90.CrossRefPubMed Ishikawa Y, Vranka J, Wirz J, Nagata K, Bachinger HP. The rough endoplasmic reticulum-resident FK506-binding protein FKBP65 is a molecular chaperone that interacts with collagens. J Biol Chem. 2008;283:31584–90.CrossRefPubMed
22.
Zurück zum Zitat Staab-Weijnitz CA, Fernandez IE, Knuppel L, Maul J, Heinzelmann K, Juan-Guardela BM, Hennen E, Preissler G, Winter H, Neurohr C, et al. FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis. Am J Respir Crit Care Med. 2015;192:455–67.CrossRefPubMedPubMedCentral Staab-Weijnitz CA, Fernandez IE, Knuppel L, Maul J, Heinzelmann K, Juan-Guardela BM, Hennen E, Preissler G, Winter H, Neurohr C, et al. FK506-Binding Protein 10, a Potential Novel Drug Target for Idiopathic Pulmonary Fibrosis. Am J Respir Crit Care Med. 2015;192:455–67.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Knüppel L, Ishikawa Y, Aichler M, Heinzelmann K, Hatz R, Behr J, Walch A, Bachinger HP, Eickelberg O, Staab-Weijnitz CA. A Novel Antifibrotic Mechanism of Nintedanib and Pirfenidone. Inhibition of Collagen Fibril Assembly. Am J Respir Cell Mol Biol. 2017;57:77–90.CrossRefPubMed Knüppel L, Ishikawa Y, Aichler M, Heinzelmann K, Hatz R, Behr J, Walch A, Bachinger HP, Eickelberg O, Staab-Weijnitz CA. A Novel Antifibrotic Mechanism of Nintedanib and Pirfenidone. Inhibition of Collagen Fibril Assembly. Am J Respir Cell Mol Biol. 2017;57:77–90.CrossRefPubMed
24.
Zurück zum Zitat Undyala VV, Dembo M, Cembrola K, Perrin BJ, Huttenlocher A, Elce JS, Greer PA, Wang YL, Beningo KA. The calpain small subunit regulates cell-substrate mechanical interactions during fibroblast migration. J Cell Sci. 2008;121:3581–8.CrossRefPubMedPubMedCentral Undyala VV, Dembo M, Cembrola K, Perrin BJ, Huttenlocher A, Elce JS, Greer PA, Wang YL, Beningo KA. The calpain small subunit regulates cell-substrate mechanical interactions during fibroblast migration. J Cell Sci. 2008;121:3581–8.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Mitra SK, Hanson DA, Schlaepfer DD. Focal adhesion kinase: in command and control of cell motility. Nat Rev Mol Cell Biol. 2005;6:56–68.CrossRefPubMed Mitra SK, Hanson DA, Schlaepfer DD. Focal adhesion kinase: in command and control of cell motility. Nat Rev Mol Cell Biol. 2005;6:56–68.CrossRefPubMed
26.
Zurück zum Zitat Roskoski R Jr. ERK1/2 MAP kinases: structure, function, and regulation. Pharmacol Res. 2012;66:105–43.CrossRefPubMed Roskoski R Jr. ERK1/2 MAP kinases: structure, function, and regulation. Pharmacol Res. 2012;66:105–43.CrossRefPubMed
27.
Zurück zum Zitat Twal WO, Czirok A, Hegedus B, Knaak C, Chintalapudi MR, Okagawa H, Sugi Y, Argraves WS. Fibulin-1 suppression of fibronectin-regulated cell adhesion and motility. J Cell Sci. 2001;114:4587–98.PubMed Twal WO, Czirok A, Hegedus B, Knaak C, Chintalapudi MR, Okagawa H, Sugi Y, Argraves WS. Fibulin-1 suppression of fibronectin-regulated cell adhesion and motility. J Cell Sci. 2001;114:4587–98.PubMed
28.
Zurück zum Zitat Canty EG, Kadler KE. Procollagen trafficking, processing and fibrillogenesis. J Cell Sci. 2005;118:1341–53.CrossRefPubMed Canty EG, Kadler KE. Procollagen trafficking, processing and fibrillogenesis. J Cell Sci. 2005;118:1341–53.CrossRefPubMed
29.
Zurück zum Zitat Timpl R, Engel J: Type VI Collagen. In Biology of extracellular matrix: Structure and function of collagen types. Edited by Mayne R, Burgeson RE. Orlando: Academic Press; 1987: 105-143, 317 p. Timpl R, Engel J: Type VI Collagen. In Biology of extracellular matrix: Structure and function of collagen types. Edited by Mayne R, Burgeson RE. Orlando: Academic Press; 1987: 105-143, 317 p.
30.
Zurück zum Zitat Engvall E, Hessle H, Klier G. Molecular assembly, secretion, and matrix deposition of type VI collagen. J Cell Biol. 1986;102:703–10.CrossRefPubMed Engvall E, Hessle H, Klier G. Molecular assembly, secretion, and matrix deposition of type VI collagen. J Cell Biol. 1986;102:703–10.CrossRefPubMed
31.
Zurück zum Zitat Argraves WS, Tran H, Burgess WH, Dickerson K. Fibulin is an extracellular matrix and plasma glycoprotein with repeated domain structure. J Cell Biol. 1990;111:3155–64.CrossRefPubMed Argraves WS, Tran H, Burgess WH, Dickerson K. Fibulin is an extracellular matrix and plasma glycoprotein with repeated domain structure. J Cell Biol. 1990;111:3155–64.CrossRefPubMed
32.
Zurück zum Zitat Liang X, Chai B, Duan R, Zhou Y, Huang X, Li Q. Inhibition of FKBP10 Attenuates Hypertrophic Scarring through Suppressing Fibroblast Activity and Extracellular Matrix Deposition. J Invest Dermatol. 2017;137:2326–35.CrossRefPubMed Liang X, Chai B, Duan R, Zhou Y, Huang X, Li Q. Inhibition of FKBP10 Attenuates Hypertrophic Scarring through Suppressing Fibroblast Activity and Extracellular Matrix Deposition. J Invest Dermatol. 2017;137:2326–35.CrossRefPubMed
33.
Zurück zum Zitat Osornio-Vargas AR, Kalter VG, Badgett A, Hernandez-Rodriguez N, Aguilar-Delfin I, Brody AR. Early-passage rat lung fibroblasts do not migrate in vitro to transforming growth factor-beta. Am J Respir Cell Mol Biol. 1993;8:468–71.CrossRefPubMed Osornio-Vargas AR, Kalter VG, Badgett A, Hernandez-Rodriguez N, Aguilar-Delfin I, Brody AR. Early-passage rat lung fibroblasts do not migrate in vitro to transforming growth factor-beta. Am J Respir Cell Mol Biol. 1993;8:468–71.CrossRefPubMed
34.
Zurück zum Zitat Oberringer M, Meins C, Bubel M, Pohlemann T. In vitro wounding: effects of hypoxia and transforming growth factor beta1 on proliferation, migration and myofibroblastic differentiation in an endothelial cell-fibroblast co-culture model. J Mol Histol. 2008;39:37–47.CrossRefPubMed Oberringer M, Meins C, Bubel M, Pohlemann T. In vitro wounding: effects of hypoxia and transforming growth factor beta1 on proliferation, migration and myofibroblastic differentiation in an endothelial cell-fibroblast co-culture model. J Mol Histol. 2008;39:37–47.CrossRefPubMed
35.
Zurück zum Zitat Poon R, Nik SA, Ahn J, Slade L, Alman BA. Beta-catenin and transforming growth factor beta have distinct roles regulating fibroblast cell motility and the induction of collagen lattice contraction. BMC Cell Biol. 2009;10:38.CrossRefPubMedPubMedCentral Poon R, Nik SA, Ahn J, Slade L, Alman BA. Beta-catenin and transforming growth factor beta have distinct roles regulating fibroblast cell motility and the induction of collagen lattice contraction. BMC Cell Biol. 2009;10:38.CrossRefPubMedPubMedCentral
36.
Zurück zum Zitat Pechkovsky DV, Scaffidi AK, Hackett TL, Ballard J, Shaheen F, Thompson PJ, Thannickal VJ, Knight DA. Transforming growth factor beta1 induces alphavbeta3 integrin expression in human lung fibroblasts via a beta3 integrin-, c-Src-, and p38 MAPK-dependent pathway. J Biol Chem. 2008;283:12898–908.CrossRefPubMed Pechkovsky DV, Scaffidi AK, Hackett TL, Ballard J, Shaheen F, Thompson PJ, Thannickal VJ, Knight DA. Transforming growth factor beta1 induces alphavbeta3 integrin expression in human lung fibroblasts via a beta3 integrin-, c-Src-, and p38 MAPK-dependent pathway. J Biol Chem. 2008;283:12898–908.CrossRefPubMed
37.
Zurück zum Zitat Le Clainche C, Carlier MF. Regulation of actin assembly associated with protrusion and adhesion in cell migration. Physiol Rev. 2008;88:489–513.CrossRefPubMed Le Clainche C, Carlier MF. Regulation of actin assembly associated with protrusion and adhesion in cell migration. Physiol Rev. 2008;88:489–513.CrossRefPubMed
38.
Zurück zum Zitat Carragher NO, Frame MC. Focal adhesion and actin dynamics: a place where kinases and proteases meet to promote invasion. Trends Cell Biol. 2004;14:241–9.CrossRefPubMed Carragher NO, Frame MC. Focal adhesion and actin dynamics: a place where kinases and proteases meet to promote invasion. Trends Cell Biol. 2004;14:241–9.CrossRefPubMed
39.
Zurück zum Zitat Carragher NO, Westhoff MA, Fincham VJ, Schaller MD, Frame MC. A novel role for FAK as a protease-targeting adaptor protein: Regulation by p42 ERK and Src. Current Biology. 2003;13:1442–50.CrossRefPubMed Carragher NO, Westhoff MA, Fincham VJ, Schaller MD, Frame MC. A novel role for FAK as a protease-targeting adaptor protein: Regulation by p42 ERK and Src. Current Biology. 2003;13:1442–50.CrossRefPubMed
40.
Zurück zum Zitat Hanks SK, Ryzhova L, Shin NY, Brabek J. Focal adhesion kinase signaling activities and their implications in the control of cell survival and motility. Front Biosci. 2003;8:d982–96.CrossRefPubMed Hanks SK, Ryzhova L, Shin NY, Brabek J. Focal adhesion kinase signaling activities and their implications in the control of cell survival and motility. Front Biosci. 2003;8:d982–96.CrossRefPubMed
41.
Zurück zum Zitat Webb DJ, Donais K, Whitmore LA, Thomas SM, Turner CE, Parsons JT, Horwitz AF. FAK-Src signalling through paxillin, ERK and MLCK regulates adhesion disassembly. Nat Cell Biol. 2004;6:154–61.CrossRefPubMed Webb DJ, Donais K, Whitmore LA, Thomas SM, Turner CE, Parsons JT, Horwitz AF. FAK-Src signalling through paxillin, ERK and MLCK regulates adhesion disassembly. Nat Cell Biol. 2004;6:154–61.CrossRefPubMed
42.
Zurück zum Zitat Zhao X, Guan JL. Focal adhesion kinase and its signaling pathways in cell migration and angiogenesis. Adv Drug Deliv Rev. 2011;63:610–5.CrossRefPubMed Zhao X, Guan JL. Focal adhesion kinase and its signaling pathways in cell migration and angiogenesis. Adv Drug Deliv Rev. 2011;63:610–5.CrossRefPubMed
43.
Zurück zum Zitat Franco SJ, Rodgers MA, Perrin BJ, Han J, Bennin DA, Critchley DR, Huttenlocher A. Calpain-mediated proteolysis of talin regulates adhesion dynamics. Nat Cell Biol. 2004;6:977–83.CrossRefPubMed Franco SJ, Rodgers MA, Perrin BJ, Han J, Bennin DA, Critchley DR, Huttenlocher A. Calpain-mediated proteolysis of talin regulates adhesion dynamics. Nat Cell Biol. 2004;6:977–83.CrossRefPubMed
44.
Zurück zum Zitat Chan KT, Bennin DA, Huttenlocher A. Regulation of adhesion dynamics by calpain-mediated proteolysis of focal adhesion kinase (FAK). J Biol Chem. 2010;285:11418–26.CrossRefPubMedPubMedCentral Chan KT, Bennin DA, Huttenlocher A. Regulation of adhesion dynamics by calpain-mediated proteolysis of focal adhesion kinase (FAK). J Biol Chem. 2010;285:11418–26.CrossRefPubMedPubMedCentral
45.
Zurück zum Zitat Gvaramia D, Blaauboer ME, Hanemaaijer R, Everts V. Role of caveolin-1 in fibrotic diseases. Matrix Biol. 2013;32:307–15.CrossRefPubMed Gvaramia D, Blaauboer ME, Hanemaaijer R, Everts V. Role of caveolin-1 in fibrotic diseases. Matrix Biol. 2013;32:307–15.CrossRefPubMed
46.
Zurück zum Zitat Nethe M, Hordijk PL. The role of ubiquitylation and degradation in RhoGTPase signalling. J Cell Sci. 2010;123:4011–8.CrossRefPubMed Nethe M, Hordijk PL. The role of ubiquitylation and degradation in RhoGTPase signalling. J Cell Sci. 2010;123:4011–8.CrossRefPubMed
47.
48.
Zurück zum Zitat Friedl P, Zanker KS, Brocker EB. Cell migration strategies in 3-D extracellular matrix: differences in morphology, cell matrix interactions, and integrin function. Microsc Res Tech. 1998;43:369–78.CrossRefPubMed Friedl P, Zanker KS, Brocker EB. Cell migration strategies in 3-D extracellular matrix: differences in morphology, cell matrix interactions, and integrin function. Microsc Res Tech. 1998;43:369–78.CrossRefPubMed
49.
Zurück zum Zitat Mc Henry KT, Montesano R, Zhu S, Beshir AB, Tang HH, Yeung KC, Fenteany G. Raf kinase inhibitor protein positively regulates cell-substratum adhesion while negatively regulating cell-cell adhesion. J Cell Biochem. 2008;103:972–85.CrossRefPubMed Mc Henry KT, Montesano R, Zhu S, Beshir AB, Tang HH, Yeung KC, Fenteany G. Raf kinase inhibitor protein positively regulates cell-substratum adhesion while negatively regulating cell-cell adhesion. J Cell Biochem. 2008;103:972–85.CrossRefPubMed
50.
Zurück zum Zitat Palecek SP, Loftus JC, Ginsberg MH, Lauffenburger DA, Horwitz AF. Integrin-ligand binding properties govern cell migration speed through cell-substratum adhesiveness. Nature. 1997;385:537–40.CrossRefPubMed Palecek SP, Loftus JC, Ginsberg MH, Lauffenburger DA, Horwitz AF. Integrin-ligand binding properties govern cell migration speed through cell-substratum adhesiveness. Nature. 1997;385:537–40.CrossRefPubMed
51.
Zurück zum Zitat Liu S, Xu SW, Blumbach K, Eastwood M, Denton CP, Eckes B, Krieg T, Abraham DJ, Leask A. Expression of integrin beta1 by fibroblasts is required for tissue repair in vivo. J Cell Sci. 2010;123:3674–82.CrossRefPubMed Liu S, Xu SW, Blumbach K, Eastwood M, Denton CP, Eckes B, Krieg T, Abraham DJ, Leask A. Expression of integrin beta1 by fibroblasts is required for tissue repair in vivo. J Cell Sci. 2010;123:3674–82.CrossRefPubMed
52.
Zurück zum Zitat Fang KP, Zhang JL, Ren YH, Qian YB. Talin-1 correlates with reduced invasion and migration in human hepatocellular carcinoma cells. Asian Pac J Cancer Prev. 2014;15:2655–61.CrossRefPubMed Fang KP, Zhang JL, Ren YH, Qian YB. Talin-1 correlates with reduced invasion and migration in human hepatocellular carcinoma cells. Asian Pac J Cancer Prev. 2014;15:2655–61.CrossRefPubMed
53.
Zurück zum Zitat Nuckolls GH, Romer LH, Burridge K. Microinjection of antibodies against talin inhibits the spreading and migration of fibroblasts. J Cell Sci. 1992;102(Pt 4):753–62.PubMed Nuckolls GH, Romer LH, Burridge K. Microinjection of antibodies against talin inhibits the spreading and migration of fibroblasts. J Cell Sci. 1992;102(Pt 4):753–62.PubMed
54.
Zurück zum Zitat Albiges-Rizo C, Frachet P, Block MR. Down regulation of talin alters cell adhesion and the processing of the alpha 5 beta 1 integrin. J Cell Sci. 1995;108(Pt 10):3317–29.PubMed Albiges-Rizo C, Frachet P, Block MR. Down regulation of talin alters cell adhesion and the processing of the alpha 5 beta 1 integrin. J Cell Sci. 1995;108(Pt 10):3317–29.PubMed
55.
Zurück zum Zitat Wei X, Sun Y, Wu Y, Zhu J, Gao B, Yan H, Zhao Z, Zhou J, Jing Z. Downregulation of Talin-1 expression associates with increased proliferation and migration of vascular smooth muscle cells in aortic dissection. BMC Cardiovasc Disord. 2017;17:162.CrossRefPubMedPubMedCentral Wei X, Sun Y, Wu Y, Zhu J, Gao B, Yan H, Zhao Z, Zhou J, Jing Z. Downregulation of Talin-1 expression associates with increased proliferation and migration of vascular smooth muscle cells in aortic dissection. BMC Cardiovasc Disord. 2017;17:162.CrossRefPubMedPubMedCentral
56.
Zurück zum Zitat Ilic D, Furuta Y, Kanazawa S, Takeda N, Sobue K, Nakatsuji N, Nomura S, Fujimoto J, Okada M, Yamamoto T. Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice. Nature, 544. 1995;377:539. Ilic D, Furuta Y, Kanazawa S, Takeda N, Sobue K, Nakatsuji N, Nomura S, Fujimoto J, Okada M, Yamamoto T. Reduced cell motility and enhanced focal adhesion contact formation in cells from FAK-deficient mice. Nature, 544. 1995;377:539.
57.
Zurück zum Zitat Klinghoffer RA, Sachsenmaier C, Cooper JA, Soriano P. Src family kinases are required for integrin but not PDGFR signal transduction. EMBO J. 1999;18:2459–71.CrossRefPubMedPubMedCentral Klinghoffer RA, Sachsenmaier C, Cooper JA, Soriano P. Src family kinases are required for integrin but not PDGFR signal transduction. EMBO J. 1999;18:2459–71.CrossRefPubMedPubMedCentral
58.
Zurück zum Zitat Westhoff MA, Serrels B, Fincham VJ, Frame MC, Carragher NO. SRC-mediated phosphorylation of focal adhesion kinase couples actin and adhesion dynamics to survival signaling. Mol Cell Biol. 2004;24:8113–33.CrossRefPubMedPubMedCentral Westhoff MA, Serrels B, Fincham VJ, Frame MC, Carragher NO. SRC-mediated phosphorylation of focal adhesion kinase couples actin and adhesion dynamics to survival signaling. Mol Cell Biol. 2004;24:8113–33.CrossRefPubMedPubMedCentral
59.
Zurück zum Zitat Asano S, Ito S, Takahashi K, Furuya K, Kondo M, Sokabe M, Hasegawa Y. Matrix stiffness regulates migration of human lung fibroblasts. Physiol Rep. 2017;5 Asano S, Ito S, Takahashi K, Furuya K, Kondo M, Sokabe M, Hasegawa Y. Matrix stiffness regulates migration of human lung fibroblasts. Physiol Rep. 2017;5
60.
Zurück zum Zitat Rosentreter A, Hofmann A, Xavier CP, Stumpf M, Noegel AA, Clemen CS. Coronin 3 involvement in F-actin-dependent processes at the cell cortex. Exp Cell Res. 2007;313:878–95.CrossRefPubMed Rosentreter A, Hofmann A, Xavier CP, Stumpf M, Noegel AA, Clemen CS. Coronin 3 involvement in F-actin-dependent processes at the cell cortex. Exp Cell Res. 2007;313:878–95.CrossRefPubMed
61.
Zurück zum Zitat Behrens J, Solga R, Ziemann A, Rastetter RH, Berwanger C, Herrmann H, Noegel AA, Clemen CS. Coronin 1C-free primary mouse fibroblasts exhibit robust rearrangements in the orientation of actin filaments, microtubules and intermediate filaments. Eur J Cell Biol. 2016;95:239–51.CrossRefPubMed Behrens J, Solga R, Ziemann A, Rastetter RH, Berwanger C, Herrmann H, Noegel AA, Clemen CS. Coronin 1C-free primary mouse fibroblasts exhibit robust rearrangements in the orientation of actin filaments, microtubules and intermediate filaments. Eur J Cell Biol. 2016;95:239–51.CrossRefPubMed
62.
Zurück zum Zitat Galvez BG, Matias-Roman S, Yanez-Mo M, Vicente-Manzanares M, Sanchez-Madrid F, Arroyo AG. Caveolae are a novel pathway for membrane-type 1 matrix metalloproteinase traffic in human endothelial cells. Mol Biol Cell. 2004;15:678–87.CrossRefPubMedPubMedCentral Galvez BG, Matias-Roman S, Yanez-Mo M, Vicente-Manzanares M, Sanchez-Madrid F, Arroyo AG. Caveolae are a novel pathway for membrane-type 1 matrix metalloproteinase traffic in human endothelial cells. Mol Biol Cell. 2004;15:678–87.CrossRefPubMedPubMedCentral
63.
Zurück zum Zitat Ge S, Pachter JS. Caveolin-1 knockdown by small interfering RNA suppresses responses to the chemokine monocyte chemoattractant protein-1 by human astrocytes. J Biol Chem. 2004;279:6688–95.CrossRefPubMed Ge S, Pachter JS. Caveolin-1 knockdown by small interfering RNA suppresses responses to the chemokine monocyte chemoattractant protein-1 by human astrocytes. J Biol Chem. 2004;279:6688–95.CrossRefPubMed
64.
Zurück zum Zitat Grande-Garcia A, Echarri A, de Rooij J, Alderson NB, Waterman-Storer CM, Valdivielso JM, del Pozo MA. Caveolin-1 regulates cell polarization and directional migration through Src kinase and Rho GTPases. Journal of Cell Biology. 2007;177:683–94.CrossRefPubMedPubMedCentral Grande-Garcia A, Echarri A, de Rooij J, Alderson NB, Waterman-Storer CM, Valdivielso JM, del Pozo MA. Caveolin-1 regulates cell polarization and directional migration through Src kinase and Rho GTPases. Journal of Cell Biology. 2007;177:683–94.CrossRefPubMedPubMedCentral
65.
Zurück zum Zitat Charras G, Sahai E. Physical influences of the extracellular environment on cell migration. Nat Rev Mol Cell Biol. 2014;15:813–24.CrossRefPubMed Charras G, Sahai E. Physical influences of the extracellular environment on cell migration. Nat Rev Mol Cell Biol. 2014;15:813–24.CrossRefPubMed
66.
Zurück zum Zitat Bonaldo P, Braghetta P, Zanetti M, Piccolo S, Volpin D, Bressan GM. Collagen VI deficiency induces early onset myopathy in the mouse: an animal model for Bethlem myopathy. Hum Mol Genet. 1998;7:2135–40.CrossRefPubMed Bonaldo P, Braghetta P, Zanetti M, Piccolo S, Volpin D, Bressan GM. Collagen VI deficiency induces early onset myopathy in the mouse: an animal model for Bethlem myopathy. Hum Mol Genet. 1998;7:2135–40.CrossRefPubMed
67.
Zurück zum Zitat Ishikawa Y, Mizuno K, Bachinger HP. Ziploc-ing the structure 2.0: Endoplasmic reticulum-resident peptidyl prolyl isomerases show different activities toward hydroxyproline. J Biol Chem. 2017;292:9273–82.CrossRefPubMed Ishikawa Y, Mizuno K, Bachinger HP. Ziploc-ing the structure 2.0: Endoplasmic reticulum-resident peptidyl prolyl isomerases show different activities toward hydroxyproline. J Biol Chem. 2017;292:9273–82.CrossRefPubMed
68.
Zurück zum Zitat Ishikawa Y, Bachinger HP. A molecular ensemble in the rER for procollagen maturation. Biochim Biophys Acta. 1833;2013:2479–91. Ishikawa Y, Bachinger HP. A molecular ensemble in the rER for procollagen maturation. Biochim Biophys Acta. 1833;2013:2479–91.
69.
Zurück zum Zitat Ducros E, Berthaut A, Mirshahi P, Lemarchand S, Soria J, Legeais JM, Mirshahi M. Expression of extracellular matrix proteins fibulin-1 and fibulin-2 by human corneal fibroblasts. Curr Eye Res. 2007;32:481–90.CrossRefPubMed Ducros E, Berthaut A, Mirshahi P, Lemarchand S, Soria J, Legeais JM, Mirshahi M. Expression of extracellular matrix proteins fibulin-1 and fibulin-2 by human corneal fibroblasts. Curr Eye Res. 2007;32:481–90.CrossRefPubMed
70.
Zurück zum Zitat Colombatti A, Bonaldo P. Biosynthesis of chick type VI collagen. II. Processing and secretion in fibroblasts and smooth muscle cells. J Biol Chem. 1987;262:14461–6.PubMed Colombatti A, Bonaldo P. Biosynthesis of chick type VI collagen. II. Processing and secretion in fibroblasts and smooth muscle cells. J Biol Chem. 1987;262:14461–6.PubMed
71.
Zurück zum Zitat Mak KM, Sehgal P, Harris CK. Type VI Collagen: Its Biology and Value as a Biomarker of Hepatic Fibrosis. Austin Biomarkers & Diagnosis. 2014;1:9. Mak KM, Sehgal P, Harris CK. Type VI Collagen: Its Biology and Value as a Biomarker of Hepatic Fibrosis. Austin Biomarkers & Diagnosis. 2014;1:9.
72.
Zurück zum Zitat Everts V, Korper W, Niehof A, Jansen I, Beertsen W. Type VI collagen is phagocytosed by fibroblasts and digested in the lysosomal apparatus: involvement of collagenase, serine proteinases and lysosomal enzymes. Matrix Biol. 1995;14:665–76.CrossRefPubMed Everts V, Korper W, Niehof A, Jansen I, Beertsen W. Type VI collagen is phagocytosed by fibroblasts and digested in the lysosomal apparatus: involvement of collagenase, serine proteinases and lysosomal enzymes. Matrix Biol. 1995;14:665–76.CrossRefPubMed
74.
Zurück zum Zitat Duran I, Martin JH, Weis MA, Krejci P, Konik P, Li B, Alanay Y, Lietman C, Lee B, Eyre D, et al. A Chaperone Complex Formed by HSP47, FKBP65, and BiP Modulates Telopeptide Lysyl Hydroxylation of Type I Procollagen. J Bone Miner Res. 2017;32:1309–19.CrossRefPubMed Duran I, Martin JH, Weis MA, Krejci P, Konik P, Li B, Alanay Y, Lietman C, Lee B, Eyre D, et al. A Chaperone Complex Formed by HSP47, FKBP65, and BiP Modulates Telopeptide Lysyl Hydroxylation of Type I Procollagen. J Bone Miner Res. 2017;32:1309–19.CrossRefPubMed
75.
Zurück zum Zitat Gjaltema RA, van der Stoel MM, Boersema M, Bank RA. Disentangling mechanisms involved in collagen pyridinoline cross-linking: The immunophilin FKBP65 is critical for dimerization of lysyl hydroxylase 2. Proc Natl Acad Sci U S A. 2016;113:7142–7.CrossRefPubMedPubMedCentral Gjaltema RA, van der Stoel MM, Boersema M, Bank RA. Disentangling mechanisms involved in collagen pyridinoline cross-linking: The immunophilin FKBP65 is critical for dimerization of lysyl hydroxylase 2. Proc Natl Acad Sci U S A. 2016;113:7142–7.CrossRefPubMedPubMedCentral
76.
Zurück zum Zitat Schwarze U, Cundy T, Pyott SM, Christiansen HE, Hegde MR, Bank RA, Pals G, Ankala A, Conneely K, Seaver L, et al. Mutations in FKBP10, which result in Bruck syndrome and recessive forms of osteogenesis imperfecta, inhibit the hydroxylation of telopeptide lysines in bone collagen. Hum Mol Genet. 2013;22:1–17.CrossRefPubMed Schwarze U, Cundy T, Pyott SM, Christiansen HE, Hegde MR, Bank RA, Pals G, Ankala A, Conneely K, Seaver L, et al. Mutations in FKBP10, which result in Bruck syndrome and recessive forms of osteogenesis imperfecta, inhibit the hydroxylation of telopeptide lysines in bone collagen. Hum Mol Genet. 2013;22:1–17.CrossRefPubMed
77.
Zurück zum Zitat Chung HJ, Steplewski A, Chung KY, Uitto J, Fertala A. Collagen fibril formation. A new target to limit fibrosis. Journal of Biological Chemistry. 2008;283:25879–86.CrossRefPubMedPubMedCentral Chung HJ, Steplewski A, Chung KY, Uitto J, Fertala A. Collagen fibril formation. A new target to limit fibrosis. Journal of Biological Chemistry. 2008;283:25879–86.CrossRefPubMedPubMedCentral
78.
Zurück zum Zitat Fleischmajer R, Olsen BR, Timpl R, Perlish JS, Lovelace O. Collagen fibril formation during embryogenesis. Proc Natl Acad Sci U S A. 1983;80:3354–8.CrossRefPubMedPubMedCentral Fleischmajer R, Olsen BR, Timpl R, Perlish JS, Lovelace O. Collagen fibril formation during embryogenesis. Proc Natl Acad Sci U S A. 1983;80:3354–8.CrossRefPubMedPubMedCentral
79.
Zurück zum Zitat Fleischmajer R, Timpl R, Tuderman L, Raisher L, Wiestner M, Perlish JS, Graves PN. Ultrastructural identification of extension aminopropeptides of type I and III collagens in human skin. Proc Natl Acad Sci U S A. 1981;78:7360–4.CrossRefPubMedPubMedCentral Fleischmajer R, Timpl R, Tuderman L, Raisher L, Wiestner M, Perlish JS, Graves PN. Ultrastructural identification of extension aminopropeptides of type I and III collagens in human skin. Proc Natl Acad Sci U S A. 1981;78:7360–4.CrossRefPubMedPubMedCentral
80.
Zurück zum Zitat Romanic AM, Adachi E, Kadler KE, Hojima Y, Prockop DJ. Copolymerization of pNcollagen III and collagen I. pNcollagen III decreases the rate of incorporation of collagen I into fibrils, the amount of collagen I incorporated, and the diameter of the fibrils formed. J Biol Chem. 1991;266:12703–9.PubMed Romanic AM, Adachi E, Kadler KE, Hojima Y, Prockop DJ. Copolymerization of pNcollagen III and collagen I. pNcollagen III decreases the rate of incorporation of collagen I into fibrils, the amount of collagen I incorporated, and the diameter of the fibrils formed. J Biol Chem. 1991;266:12703–9.PubMed
Metadaten
Titel
FK506-binding protein 10 (FKBP10) regulates lung fibroblast migration via collagen VI synthesis
verfasst von
Larissa Knüppel
Katharina Heinzelmann
Michael Lindner
Rudolf Hatz
Jürgen Behr
Oliver Eickelberg
Claudia A. Staab-Weijnitz
Publikationsdatum
01.12.2018
Verlag
BioMed Central
Erschienen in
Respiratory Research / Ausgabe 1/2018
Elektronische ISSN: 1465-993X
DOI
https://doi.org/10.1186/s12931-018-0768-1

Weitere Artikel der Ausgabe 1/2018

Respiratory Research 1/2018 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.