Introduction
Asthma and allergic diseases are rapidly becoming the most common chronic diseases in the developed world. Current asthma therapy treats symptoms of the disease, however it is ineffective in up to 25% of patients [
1]. Asthma and allergic diseases are complex disorders caused by the interaction of various genetic and environmental factors [
2‐
4].
Genome-wide association studies (GWAS) have been used to identify genes that may be involved in asthma pathogenesis [
5]. Moffatt and colleagues first reported that multiple single nucleotide polymorphisms (SNPs) on chromosome 17q21 linked
ORMDL3 (orosomucoid 1-like 3) to the risk of developing childhood asthma [
6]. This association has since been reproduced in multiple independent studies [
7‐
14]. However, little work has been done to elucidate the biological and functional relevance of this gene in asthma. The disadvantage of these association studies is that they cannot differentiate between true causal SNPs and non-causal variants simply in linkage disequilibrium with disease-causing genes. It is therefore imperative to validate GWAS data through functional studies that confirm the biological relevance of a gene in disease.
SNP variants have also linked
ORMDL3 to inflammatory bowel disease (IBD) and Type I diabetes, suggesting that
ORMDL3 may be involved in dysregulation of the immune system [
15,
16]. Association of
ORMDL3 in both asthma and IBD is of interest because the lung and gut are composed of similar mucosal surface cells and these tissues are exposed to many potentially harmful antigens and allergens requiring tight regulation of the mucosal immune system [
17]. This unique system is responsible for maintaining a delicate equilibrium between antigen responsiveness and tolerance and is therefore responsible for preventing hyper-reactivity [
17]. Inappropriate immune responses to foreign components or commensal bacteria can lead to inflammation characteristic of asthma and IBD. Furthermore, the polymorphisms may be involved in regulation of mRNA expression of 17q21 locus genes, including
ORMDL3[
6]
. The expression of
ORMDL3 was recently associated with elevated levels of IL-17 secretion [
18] and
ORMDL3 was expressed at higher levels in the peripheral blood of patients with recurrent wheeze compared to controls [
19]. This correlation further supports the hypothesis that
ORMDL3 is involved in immunity.
The
ORMDL3 gene is a member of a family of conserved endoplasmic reticulum (ER)-localized transmembrane proteins [
20]. The functions of the
ORMDL proteins are currently unknown, but a recent study suggested that ORMDL3 is involved in ER-mediated Ca
2+ homeostasis and activation of the unfolded protein response (UPR) – ORMDL3 may inhibit sarco/endoplasmic reticulum Ca
2+ ATPase (SERCA) activity [
21,
22]. Disruptions to ER Ca
2+ concentrations can cause protein misfolding, and accumulation of these unfolded proteins can lead to ER stress [
23,
24]. UPR signaling cascades are initiated in response to this stress and have been shown to activate the JNK-AP-1 and NF-κB-IKK pathways [
25‐
27]. The ER stress response and UPR, caused by changes in
ORMDL3 expression, can initiate inflammation through induction of cytokine production. This mechanism may explain the role of
ORMDL3 in asthma pathogenesis. Indeed, Miller
et al. have shown that in mice
ORMDL3 is an allergen and cytokine (IL-4 or IL-13) inducible ER gene expressed predominantly in airway epithelial cells, and that it activates the ATF6 pathway of the ER localized UPR regulating expression of metalloprotease, chemokine, and oligoadenylate synthetase genes [
28].
Although the symptoms of asthma are largely driven by dysregulated T helper type 2 (T
H2) responses, innate immune responses are also involved in asthma pathogenesis [
29,
30]. Airway epithelia are central to host defense and immune regulation. These cells are among the first to encounter environmental insults and play an important role in shaping downstream immune responses. Any dysregulation of the innate immune response can result in hypersensitivity to environmental factors, leading to asthma symptoms.
Given the multiple lines of evidence suggesting that ORMDL3 is involved in immunity, we investigated the role of the gene in innate immune responses of airway cells. We hypothesized that elevated ORMDL3 levels result in heightened inflammatory responses that are associated with the asthmatic phenotype. Increased levels of ORMDL3 protein may in turn disrupt ER homeostasis, leading to ER overload and activation of the UPR, initiating inflammatory responses. Using an in vitro model, we manipulated ORMDL3 expression in airway cells to determine whether a difference in basal ORMDL3 expression affected inflammatory responses or activation of the UPR before and after stimulation.
Materials and methods
Cell culture
1HAEo¯ (1HAE) cells (SV40-transformed normal human airway epithelial cells) were cultured in DMEM-high glucose medium with 10% fetal calf serum (FCS), 2 mM L-glutamine, and 1 mM sodium pyruvate (HyClone). A549 cells (adenocarcinomic human alveolar basal epithelial cells) were cultured in F-12K medium supplemented with 10% fetal calf serum (FCS), 2 mM L-glutamine, and 1 mM sodium pyruvate (HyClone). Cells were incubated in a 37°C, 5% CO2 incubator. All cells were cultured under non-polarizing conditions.
Cloning ORMDL3 cDNA into pEGFP-N1 vector
The ORMDL3 gene was amplified from cDNA using forward primer 5′-CTAAGAATTCATGAATGTGGGCACAGCGCAC-3′ and reverse primer 5′-TACTGGTACCCCGTACTTATTGATTCCAAAAATCCGGACT-3′, introducing Eco RI and Kpn I restriction endonuclease sites, respectively. The ORMDL3 PCR product was then inserted into a pEGFP-N1 eukaryotic expression vector (Clontech). ORMDL3 and eGFP are in frame and produce a fusion protein with eGFP expressed at the C-terminus of ORMDL3. The construct was verified by sequencing and is denoted as pEGFP-ORMDL3. Protein is denoted as ORMDL3-eGFP.
Cell transfection
A549 and 1HAE cell lines were transfected with pEGFP-ORMDL3, scramble (non-specific) or ORMDL3-specific siRNA (pre-designed by Qiagen) using Amaxa® Cell Line Nucleofector® Kit T (Lonza). Two ORMDL3-specific siRNAs were used. Concentrations used for transfection represent pooled siRNA concentration. Cells were seeded into a 24-well plate (BD Biosciences) at a density of 2x105 cells/well for A549 cells or 1x105 cells/well for 1HAE cells.
Cell stimulation and immune response quantification
Twenty-four hours post-transfection, cells were stimulated with TNF-α (200 ng/ml) (eBioscience),
E. coli K12 LPS (100 μg/ml) (InvivoGen),
S. typhimurium flagellin (10-200 ng/ml) (InvivoGen), or IL-1β (200 ng/ml) (eBioscience). Stimulants and their concentrations were chosen based on published literature or past experiments [
31‐
34]. Cells were stimulated for 24 hours. Supernatants were collected and analyzed for cytokine secretion. Pro-inflammatory cytokines, IL-6 and IL-8, were detected and quantified using Human IL-6 and IL-8 Ready-Set-Go!
® ELISA kits (eBioscience). Experiments were repeated three times (n = 3).
ER stress induction and UPR activation
Cells were stimulated with tunicamycin (200 μg/mL) (Calbiochem) or thapsigargin (10 μM) (Sigma) for 2 or 4 hours to activate the UPR. For ORMDL3 knockdown cells, stimulation was performed 24 hours post-transfection. RNA was extracted and expression of genes XBP-1u, XBP-1s, and CHOP were then quantified as markers of UPR activation. For measurement of p-eIF2α levels by Western blot, lysates from unstimulated cells with ORMDL3 knockdown were collected 24 hours post-transfection. Experiments were repeated three times (n = 3).
RNA isolation and reverse transcription
RNA was extracted from lysates using E.Z.N.A.® Total RNA Kit (Omega Bio-Tek) according to the manufacturer’s protocol. Extracted RNA was reverse transcribed into cDNA using the SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen). Complement DNA was diluted to 200 ng/μl prior to quantification of gene expression by qPCR. This method was followed for all samples, unless otherwise stated (see PCR Array).
Quantification of ORMDL3 mRNA expression
Gene expression was calculated relative to
GAPDH or
PPIA (encoding cyclophilin A) and was quantified by SYBR Green chemistry (PerfeCTa™ qPCR SuperMix, Quanta Biosciences) using a 7300 Real Time PCR System (Applied Biosystems). Reactions were performed in triplicate using the following cycling conditions: 50°C for 2 mins, 95°C for 10 mins, [95°C for 15 s, 60°C for 1 min] x 40. The relative expression of the measured gene was calculated by the Pfaffl method [
35]. The primers used are listed in Table
1.
Table 1
Quantitative PCR primer sequences
GAPDH
| NM_002046.4 | GCACCGTCAAGGCTGAGAACGG | CGACGTACTCAGCGCCAGCATC | c.173-286 | 114 |
PPIA
| NM_021130 | TAAAGCATACGGGTCCTGGCATCT | ATCCAACCACTCAGTCTTGGCAGT | c.269-369 | 101 |
ACTB
| NM_001101.3 | GTTGCGTTACACCCTTTCTT | ACCTTCACCGTTCCAGTTT | c.*16-*162 | 147 |
DDIT3
| NM_001195053.1 | GAAATGAAGAGGAAGAATCA | TTCTCCTTCATGCGCT | c.197-437 | 241 |
XBP-1s
| NM_001079539.1 | ATGGATGCCCTGGTTGCTGAAGA | TGCACCTGCTGCGGACTCA | c.415-504 | 90 |
XBP-1u
| NM_005080.3 | AGCACTCAGACTACGTGCACCTCT | CCAGAATGCCCAACAGGATATCAG | c.495-624 | 130 |
ORMDL1
| NM_016467.4 | AATGGCTGGTCCTTCAAGTGCT | ACCCTCACTGTGATGCCCTTTA | c.*121-*269 | 149 |
ORMDL2
| NM_014182.4 | ACACACTGGGAGCAAATGGACT | AGTGCGCAGCATCATACTTGGT | c.250-370 | 121 |
ORMDL3
| NM_139280.2 | TCAGGCAGCCAAAGCACTTTAACC | ACCCATCCCACACTTGCTTCCATA | c.*358-*496 | 139 |
BCL6
| NM_001706.4 | ACAATCCCAGAAGAGGCACGAAGT | GCTCGAAATGCAGGGCAATCTCAT | c.790-952 | 163 |
CCL2
| NM_002982.3 | TCGCTCAGCCAGATGCAATCAATG | TGGAATCCTGAACCCACTTCTGCT | c.65-259 | 195 |
CCL5
| NM_002985.2 | TGCCTGTTTCTGCTTGCTCTTGTC | TGTGGTAGAATCTGGGCCCTTCAA | c.*36-*127 | 92 |
CSF2
| NM_000758.3 | AAATGTTTGACCTCCAGGAGCCGA | GGTGATAATCTGGGTTGCACAGGA | c.185-357 | 173 |
IL12A
| NM_000882.3 | ATGATGGCCCTGTGCCTTAGTAGT | AGGGCCTGCATCAGCTCATCAATA | c.457-611 | 155 |
IL13RA1
| NM_001560.2 | GTCCCAGTGTAGCACCAATGA | CAGTCACAGCAGACTCAGGAT | c.297-391 | 95 |
ADRB2
| NM_000024.5 | TCATCATGGGCACTTTCACCCTCT | AGCTCCTGGAAGGCAATCCTGAAA | c.830-1016 | 187 |
VEGFA
| NM_001025366.2 | TTCAGGACATTGCTGTGCTTTGGG | TGGGCTGCTTCTTCCAACAATGTG | c.*778-*969 | 192 |
IL23A
| NM_016584.2 | TCGGTGAACAACTGAGGGAACCAA | TGGAATCTCTGCCCACTTCCACTT | c.-140- -54 | 87 |
Western blot analysis
Cells were lysed in 50 μl RIPA Buffer + 1x HALT™ protease inhibitor (Thermo Scientific). Cell debris were removed by centrifugation: 18,000 x g for 10 min at 4°C. Proteins were analyzed by standard Western blotting protocols where they were transferred onto Immobilon®-FL transfer membrane (Millipore). Antibodies used for Western blot analysis were: monoclonal anti-GFP antibody 1:10,000 (Clontech), anti-ACTB antibody 1:6,000 (Cell Signaling), anti-p-eIF2α 1:500 (Cell Signaling) and IRDye® 680 or 800 secondary antibodies 1:8000 (Li-cor). Western blots were visualized using an Odyssey Infrared Imaging System (Li-cor).
PCR array
1HAE cells co-transfected with pEGFP-ORMDL3 and ORMDL3 siRNA (low ORMDL3 expression) were compared to cells co-transfected with pEGFP-ORMDL3 and scramble siRNA (high ORMDL3 expression) at two time-points (2 and 24 hours) after TNF-α stimulation. Extracted RNA was reverse transcribed into first strand cDNA using the RT2 First Strand Kit (SABiosciences, Qiagen). Protocol as described by the manufacturer was followed.
Two RT
2 Profiler PCR arrays (SABiosciences, Qiagen), profiling expression of 84 genes each, were used: Human Cytokines & Chemokines and Allergy & Asthma (see Additional file
1 for complete list). Complementary DNA template was mixed with RT
2 SYBR
® Green qPCR Mastermix (SABiosciences, Qiagen) as follows: 1350 μL SYBR Green Master Mix, 1248 μL nuclease-free H
2O, and 102 μL cDNA (~200 ng/μL). Note: these volumes were used as recommended by the manufacturer for use with a 7300 Real Time PCR System (Applied Biosystems). Template was then aliquoted into PCR plates containing pre-dispensed primers. Cycler program as provided by the manufacturer was used. Results were analyzed using the PCR Array Data Analysis Web Portal.
Statistical analysis
Data are shown as mean ± SEM of three separate experiments. Results were analyzed using one-way ANOVA with Bonferroni post-test. Statistical analysis was performed using GraphPad Prism5 (GraphPad Software, Inc.). Differences with p < 0.05 were considered significant.
Discussion
Asthma is a complex disease affecting many individuals in the developed world. Genome-wide association studies have recently been used to identify genetic causes for such complex diseases. One particular gene,
ORMDL3, is of interest because of its association with asthma, IBD, and Type I diabetes – all of which are caused by immune-mediated pathology [
6,
10,
22,
38,
39]. The gene
ORMDL3 is an ER-membrane protein and is potentially involved in Ca
2+-signaling in the ER and sphingolipid synthesis [
20,
21,
40]. It has also been correlated to activation of the UPR, though the mechanisms remain unclear [
21]. Activation of the UPR may be biologically relevant, as ER stress, the UPR, and inflammation have all been linked [
23]. However, the functional role
ORMDL3 in the pathogenesis of asthma has yet to be elucidated.
Airway epithelial cells play an important role in innate immunity and in the development of asthma. Current findings in literature indicate that
ORMDL3 is involved in immunity and that asthmatics have higher expression of the gene than non-asthmatics [
18,
21,
22]. A recent study by Miller
et al. also investigated the role of
ORMDL3 in airway epithelial cells. They reported that
in vitro overexpression of
ORMDL3 activated the ATF6 pathway of the UPR and induced expression of several genes with potential importance in the pathogenesis of asthma [
28]. Our investigation, in contrast, focuses on the effect of variation of
ORMDL3 expression levels, at baseline, on the innate immune responsiveness of airway epithelial cells. By manipulating
ORMDL3 expression
in vitro to mimic differences in gene expression established between asthmatics and healthy individuals, we aimed to understand the role of
ORMDL3 on the innate immune response and UPR activation status in airway epithelial cells. This method ensured control and the confidence that any effect on the innate immune response was in fact correlated with a change in
ORMDL3 expression levels. If the same experiments were performed on
ex vivo airway cells of patients, genetic and other differences between individuals could have affected the results.
After knockdown of
ORMDL3 in vitro, cells were stimulated with cytokines (TNF-α, IL-1β) or common microbial components (LPS, flagellin). We monitored production of interleukin-6 (IL-6) and interleukin-8 (IL-8) (alias CXCL8), two pro-inflammatory cytokines produced by airway cells that are relevant in asthma pathogenesis. Specifically, IL-6 is elevated in individuals with asthma [
41] and is also regulated by ATF6 during activation of the UPR [
42]. Similarly, transfection of ORMDL3 into human airway epithelial cells triggers ATF6 activation and IL-8 secretion [
28]. However, in our experimental system, variation in
ORMDL3 expression levels did not affect NF-κB-induced innate immune production of IL-6 and IL-8 in airway epithelial cells.
We next explored the effects of
ORMDL3 expression on activation of the UPR. UPR signaling cascades are initiated in response to ER stress, and restoration of homeostasis is achieved by attenuating translation, restoring protein folding, or degrading misfolded proteins [
24]. Although often associated with abnormal physiological conditions, the UPR plays a central beneficial role in normal physiology; as illustrated by the role of the UPR in terminal B cell differentiation which requires a massive increase in the biosynthetic capacity to synthesize antibodies in response to infection [
43]. However, the ER stress response and UPR can also initiate inflammation through induction of cytokine production or activation of transcriptional regulators of inflammatory genes. Cytokines IL-6 and IL-8 are examples of genes that may be induced by UPR activation [
23]. ER stress and the UPR have been implicated in many immune-related diseases including IBD, diabetes, chronic obstructive pulmonary disease (COPD), arthritis, and neurodegenerative inflammatory diseases [
44]. It is poorly understood whether ER stress is an underlying cause of disease or if its induction is a result of chronic inflammation. Indeed, it is possible that environment factors such as infection or inhalation of smoke particles can activate the UPR, triggering the onset of lung disease in genetically predisposed individuals [
45]. However, it is also possible that ER stress is exacerbated by inflammation and contributes to the perpetuation of the disease.
Cantero-Recasens
et al. previously reported that
ORMDL3 overexpression activated the PERK pathway, but did not affect the IRE1 pathway of the UPR [
21]. In contrast, Miller
et al. reported that
ORMDL3 overexpression activated the ATF6 pathway, but not the PERK or IRE1 pathways [
28]. In our study, we chose four markers of UPR activation:
XBP-1u, XBP-1s,
CHOP, and p-eIF2α. With activation of the UPR, we expect downregulation of
XBP-1u and upregulation of
XBP-1s and
CHOP. However, our results demonstrate that knockdown of
ORMDL3 does not activate the UPR, in either unstimulated or stimulated cells. Immunoblot analysis also showed no change in p-eIF2α levels with
ORMDL3 knockdown. Furthermore, downstream markers of UPR activation, IL-6 and IL-8 cytokines, were produced at similar levels in unstimulated cells with varying
ORMDL3 levels. This further supports our results that
ORMDL3 does not activate the UPR. Differences in our results compared to previous work might be due to the different types of cells, conditions, or markers used. It is possible that the effects of variation in
ORMDL3 expression are a cell type-dependent phenomenon. While no effect on the inflammatory response was detected in airway cells, other cells types such as dendritic cells or T cells may be affected by altered
ORMDL3 expression. Observations made by Lluis
et al. suggest that the 17q21 locus may potentially play a role in T-cell development [
18].
Taking a broader approach, PCR arrays looking at expression of 168 common immunity genes were performed. We reasoned that although
ORMDL3 levels may not affect the production of IL-6 or IL-8 cytokines, perhaps they were impacting gene expression of other important immune genes, such as
IL-33,
IL-25 and
TSLP, which have all been implicated in asthma pathogenesis [
46]. Verification of differential expression of these genes at a transcript level, however, did not show any significant changes between the
ORMDL3 knockdown conditions. This suggests that altering
ORMDL3 expression does not have a profound effect on the expression of innate immune genes upon stimulation in the airway epithelia. However, there may be other genes that are affected that were not investigated in this study. Pfeifer
et al. recently showed that IL-17C cytokine is expressed by human bronchial epithelial cells and is induced by bacterial infection [
47]. It may be worthwhile in future experiments to investigate a broader range of immune-related genes. Interestingly, we did not observe changes to expression of the genes reported by Miller
et al., MMP-9, CCL-20, CXCL-10, CXCL-11, or
IL-8. This variance may be explained by differences in experimental conditions. Our study examined outcomes in gene expression after stimulation of cells co-transfected with
ORMDL3 and
ORMDL3- specific siRNA, while the other study used a different experimental approach.
Although this study focused exclusively on the potential role of
ORMDL3 in asthma pathogenesis, it is possible that neighboring genes such as
GSDML contribute to disease susceptibility at this locus. Many groups consider
ORMDL3 as an ‘asthma gene’; however, it should be acknowledged that the identified SNPs associating this gene to asthma susceptibility are not located in the gene itself. Even so, these polymorphisms have been consistently correlated with increased odds of asthma risk, highlighting the importance of this locus in disease susceptibility [
6‐
11,
13,
14].
Our data show that variation in ORMDL3 expression is not correlated with differential innate immune responses to stimuli or activation of the UPR in vitro in airway epithelial cells. Taken together, our results are biologically relevant because they suggest that normal human variation of ORMDL3 expression is not likely an important factor in increasing the innate immune response of airway cells we observe in asthmatics. Despite these results, this gene remains an important candidate for asthma susceptibility. More research is required to elucidate its role in asthma pathogenesis and its potential role as an initial trigger of inflammation. By increasing our understanding of the mechanisms responsible for allergic and atopic disease development, new treatments can then be developed. Thus, we can reduce inflammatory responses by targeting the potential triggers, rather than the symptoms, of the disease. In doing so, we will ultimately reduce the morbidity, mortality, and socio-economic burden of asthma and related allergic diseases.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
KJH performed the research. All authors designed the research, analyzed the data, and drafted the manuscript. Both authors read and approved the final manuscript.