Background
Results
Patients and clinical isolates of E. faecalis
Antimicrobial resistance patterns among E. faecalis strains
Antibiotics | Urine samples N = 63 (%) | Fecal samples N = 63 (%) | ||||
---|---|---|---|---|---|---|
R | I | S | R | I | S | |
Ampicillin (10 µg) | 0 (0%) | – | 63 (100%) | 0 (0%) | – | 63 (100%) |
Penicillin G (10 units) | 0 (0%) | – | 63 (100%) | 0 (0%) | – | 63 (100%) |
Vancomycin (30 µg) | 0 (0%) | – | 63 (100%) | 0 (0%) | – | 63 (100%) |
Linezolide (30 µg) | 0 (0%) | – | 63 (100%) | 0 (0%) | – | 63 (100%) |
Nitrofurantoin (300 µg) | 0 (0%) | – | 63 (100%) | 0 (0%) | – | 63 (100%) |
Gatifloxacin (5 µg) | 8 (12.7%) | – | 55 (87.3%) | 4 (6.3%) | – | 59 (93.7%) |
Levofloxacin (5 µg) | 9 (14.3%) | – | 54 (85.7%) | 4 (6.3%) | – | 59 (93.7%) |
Ciprofloxacin (5 µg) | 13 (20.6%) | – | 50 (79.4%) | 8 (12.7%) | – | 55 (87.3%) |
Gentamycin (120 µg) | 18 (28.6%) | – | 45 (71.4%) | 10 (15.9%) | – | 53 (84.1%) |
Minocycline (30 µg) | 55 (87.3%) | – | 8 (12.7%) | 45 (71.4%) | – | 18 (28.6%) |
Tetracycline (30 µg) | 56 (88.9%) | – | 7 (11.1%) | 48 (76.2%) | – | 15 (23.8%) |
Daptomycin | 0 (0%) | – | 63 (100%) | 0 (0%) | – | 63 (100%) |
Antibiotic resistance patternsa | Urine samples N = 63 (%) | Fecal samples N = 63 (%) | Same resistance patternsb |
---|---|---|---|
TET, MIN, GM120, CP, LEV, GAT | 5 (7.9%) | 2 (3.1%) | 2 |
TET, MN, GM120, CP | 2 (3.1%) | 0 (0%) | 0 |
TET, MN, GM120 | 10 (15.8%) | 8 (12.6%) | 7 |
TET, MN, CP, LEV, GAT | 3 (4.7%) | 0 (0%) | 0 |
TET, MN, CP, GAT | 0 (0%) | 1 (1.5%) | 0 |
TET, MN, CP, LEV | 0 (0%) | 1 (1.5%) | 0 |
TET, CP, LEV, GAT | 0 (0%) | 1 (1.5%) | 0 |
TET, MN, CP | 2 (3.1%) | 2 (3.1%) | 1 |
TET, MN | 33 (52.3%) | 31 (49.2%) | 25 |
CP, LEV | 1 (1.5%) | 0 (0%) | 0 |
TET | 1 (1.5%) | 2 (3.1%) | 1 |
GM120 | 1 (1.5%) | 0 (0%) | 0 |
No resistance | 4 (6.3%) | 15 (23.8%) | 3 |
Prevalence of virulence determinants in urine and fecal specimens
Genotype patterns | Urine samples N = 63 (%) | Fecal samples N = 63 (%) |
---|---|---|
esp+, efbA+, asa+, ace+, cyl+, gelE+ | 25 (39.6%) | 23 (36.5%) |
esp+, efbA+, asa+, ace+, cyl+ | 6 (9.5%) | 1 (1.5%) |
esp+, efbA+, asa+, ace+, gelE+ | 9 (14.2%) | 7 (11.1%) |
esp+, efbA+, ace+, cyl+, gelE+ | 1 (1.5%) | 3 (4.7%) |
efbA+, asa+, ace+, cyl+, gelE+ | 2 (3.1%) | 0 (0%) |
esp+, efbA+, asa+, cyl+, gelE+ | 0 (0%) | 1 (1.5%) |
efbA+, asa+, ace+, gelE+ | 8 (12.6%) | 9 (14.2%) |
esp+, efbA+, ace+, gelE+ | 7 (11.1%) | 10 (15.8%) |
efbA+, ace+, cyl+, gelE+ | 1 (1.5%) | 1 (1.5%) |
efbA+, ace+, gelE+ | 4 (6.3%) | 4 (6.3%) |
esp+, efbA+, gelE+ | 1 (1.5%) | 1 (1.5%) |
esp+, efbA+, ace+ | 0 (0%) | 1 (1.5%) |
ace+, gelE+ | 0 (0%) | 1 (1.5%) |
Association of antibiotic resistance patterns and virulence determinants among E. feacalis isolates
DNA fingerprinting analysis techniques
RAPD-PCR
Genotypic patterns | Endogenous UTIs n = 17 | Exogenous UTIs n = 46 | Total | p value |
---|---|---|---|---|
esp+, efbA+, asa+, ace+, cyl+, gelE+ | 11 (64.7%) | 14 (30.4%) | 25 | 0.02 |
esp+, efbA+, asa+, ace+, cyl+ | 0 (0%) | 6 (13%) | 6 | 0.17 |
esp+, efbA+, asa+, ace+, gelE+ | 1 (5.8%) | 9 (19.5%) | 10 | 0.26 |
esp+, efbA+, ace+, cyl+, gelE+ | 0 (0%) | 1 (2.1%) | 1 | 1 |
efbA+, asa+, ace+, cyl+, gelE+ | 0 (0%) | 2 (4.3%) | 2 | 1 |
efbA+, asa+, ace+, gelE+ | 2 (11.7%) | 6 (13%) | 8 | 1 |
esp+, efbA+, ace+, gelE+ | 3 (17.6%) | 4 (8.6%) | 7 | 0.39 |
efbA+, ace+, gelE+ | 0 (0%) | 4 (8.6%) | 4 | 0.56 |
esp+, efbA+, gelE+ | 0 (0%) | 1 (2.1%) | 1 | 1 |
PFGE
Antibiotic resistance patterns | Virulence determinant patterns | Pulsotype | No. of patients | ||
---|---|---|---|---|---|
Urine | Feces | Urine | Feces | ||
TET/MN | TET/MN | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | Identical | 6 |
TET/MN/GM(120)/CP/GAT/LEV | TET/MN/GM(120)CP/GAT/LEV | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | Identical | 1 |
TET/MN/GM(120)/CP/GAT/LEV | TET/MN/GM(120)/CP/GAT/LEV | efbA+ ,asa+, ace+, gelE+ | efbA+, asa+,ace+, gelE+ | Identical | 1 |
Sensitive to all antibiotics | Sensitive to all antibiotics | efbA+, asa+, ace+, gelE+ | efbA+, asa+, ace+, gelE+ | Identical | 1 |
TET | TET | esp+, efbA+, ace+, gelE+ | esp+, efbA+, asa+, ace+, gelE+ | Identical | 1 |
Antibiotic resistance patterns | Virulence determinant patterns | No. of patients | ||
---|---|---|---|---|
Urine | Feces | Urine | Feces | |
TET/MN | TET/MN | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 7 |
TET/MN/GM(120) | TET/MN/GM(120) | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 2 |
TET/MN/GM(120) | TET/MN/CP | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 1 |
TET/MN | TET/MN/CP/GAT/LEV | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 1 |
TET/MN/GM(120)/CP | CP | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 1 |
TET/MN | TET/MN | esp+, efbA+, ace+, gelE+ | esp+, efbA+, ace+, gelE+ | 1 |
TET/MN/GM(120)/CP/GAT/LEV | TET/MN | esp+, efbA+, ace+, gelE+ | esp+, efbA+, ace+, gelE+ | 1 |
TET/MN | Sensitive to all antibiotics | esp+, efbA+, ace+, gelE+ | esp+, efbA+, ace+, gelE+ | 1 |
TET/MN/CP | TET/MN/CP | esp+, efbA+, ace+, gelE+ | esp+, efbA+, ace+, gelE+ | 1 |
TET/MN/CP/GAT/LEV | TET/MN | efbA+,asa+,ace+, gelE+ | efbA+, asa+,ace+, gelE+ | 1 |
TET/MN | TET/MN | efbA+,asa+,ace+, gelE+ | efbA+,asa+,ace+, gelE+ | 1 |
Sensitive to all antibiotics | Sensitive to all antibiotics | efbA+,asa+,ace+, gelE+ | efbA+,asa+,ace+, gelE+ | 1 |
TET/MN/GM(120)/CP | TET/MN/GM(120) | esp+, efbA+, asa+, ace+, cyl+ | esp+, efbA+, asa+, ace+, gelE+ | 1 |
TET/MN | TET/MN | esp+, efbA+, asa+, ace+, gelE+ | esp+, efbA+, asa+, ace+, gelE+ | 1 |
TET/MN/CP | TET/MN | esp+, efbA+, asa+, ace+, gelE+ | esp+, efbA+, asa+, ace+, gelE+ | 1 |
Sensitive to all antibiotics | TET | esp+, efbA+, asa+, ace+, gelE+ | esp+, efbA+, asa+, ace+, gelE+ | 1 |
TET/MN/GM(120) | TET/MN/GM(120) | esp+, efbA+, asa+, ace+, cyl+ | esp+, efbA+, asa+, ace+, cyl+ | 1 |
TET/MN/CP/GAT/LEV | Sensitive to all antibiotics | esp+, efbA+, asa+, ace+, gelE+ | esp+, efbA+, ace+, gelE+ | 1 |
TET/MN/GM(120) | TET/MN/GM(120) | esp+, efbA+, asa+, ace+, gelE+ | esp+, efbA+, asa+, ace+, gelE+ | 1 |
TET/MN/GM(120) | Sensitive to all antibiotics | efbA+, asa+, ace+, cyl+, gelE+ | efbA+, ace+, gelE+ | 1 |
TET/MN | TET/MN | efbA+, asa+, ace+, cyl+, gelE+ | efbA+, ace+, gelE+ | 1 |
TET/MN | TET/MN | esp+, efbA+, ace+, gelE+ | efbA+, asa+, ace+, gelE+ | 1 |
TET/MN/GM(120) | TET/MN | esp+, efbA+, ace+, gelE+ | efbA+, asa+, ace+, gelE+ | 1 |
TET/MN | Sensitive to all antibiotics | esp+, efbA+, ace+, gelE+ | efbA+, asa+, ace+, gelE+ | 1 |
TET/MN | TET/MN | esp+, efbA+, asa+, ace+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 1 |
TET/MN/GM(120) | TET/MN/GM(120) | esp+, efbA+, asa+, ace+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 1 |
TET/MN | TET/MN | esp+, efbA+, asa+, ace+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 1 |
TET/MN | TET/MN | esp+, efbA+, asa+, ace+, cyl+ | esp+, efbA+, ace+ | 1 |
TET/MN | TET/MN | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, ace+, cyl+, gelE+ | 1 |
TET/MN | Sensitive to all antibiotics | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, ace+, cyl+, gelE+ | 1 |
TET/MN | TET/MN | esp+, efbA+, ace+, cyl+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 1 |
TET/MN | TET/MN/GM(120) | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, asa+, ace+, gelE+ | 1 |
TET/MN | TET/MN | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, ace+, gelE+ | 1 |
TET/MN/GM(120) | TET/MN/GM(120) | esp+, efbA+, asa+, ace+, cyl+, gelE+ | esp+, efbA+, ace+, gelE+ | 1 |
CP/GAT/LEV | TET/MN/CP/GAT/LEV | efbA+, ace+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 1 |
TET/MN | Sensitive to all antibiotics | esp+, efbA+, asa+, ace+, cyl+, gelE+ | efbA+, ace+, gelE+ | 1 |
TET/MN/GM(120) | TET/MN | esp+, efbA+, asa+, ace+, cyl+, gelE+ | efbA+, asa+, ace+, gelE+ | 1 |
TET/MN | Sensitive to all antibiotics | efbA+, ace+, gelE+ | esp+, efbA+, asa+, ace+, cyl+, gelE+ | 1 |
TET/MN | TET/MN | esp+, efbA+, asa+, ace+, gelE+ | esp+, efbA+, ace+, cyl+, gelE+ | 1 |
TET/MN/GM(120)/CP/GAT/LEV | Sensitive to all antibiotics | esp+, efbA+, asa+, ace+, cyl+ | esp+, efbA+, ace+, gelE+ | 1 |
GM(120) | Sensitive to all antibiotics | esp+, efbA+, asa+, ace+, gelE+ | ace+ | 1 |
TET/MN | Sensitive to all antibiotics | efbA+, ace+, gelE+ | esp+, efbA+, asa+, cyl+, gelE+ | 1 |
TET/MN/GM(120)/CP/GAT/LEV | Sensitive to all antibiotics | efbA+, asa+, ace+, gelE+ | ace+, gelE+ | 1 |
Sensitive to all antibiotics | TET/MN | efbA+, asa+, ace+, gelE+ | esp+, efbA+, ace+, gelE+ | 1 |
TET/MN/CP/GAT/LEV | TET/MN/CP/GAT/LEV | efbA+, asa+, ace+, gelE+ | efbA+, ace+, gelE+ | 1 |
Sensitive to all antibiotics | Sensitive to all antibiotics | efbA+, ace+, gelE+ | efbA+, ace+, cyl+, gelE+ | 1 |
Discussion
Conclusions
Methods
Patients and bacterial strains
Molecular examinations
Antimicrobial susceptibility testing
DNA extraction
Molecular characterization and virulence genotype determination of E. faecalis strains
Gene | Primer sequence (5′-3′) | Annealing temperature | Amplicon size (bp) | References |
---|---|---|---|---|
ddlE.faecalis | ATCAAGTACAGTTAGTCTTTATTAG ACGATTCAAAGCTAACTGAATCAGT | 49 | 941 | [19] |
Esp | AGATTTCATCTTTGATTCTTGG AATTGATTCTTAGCATCTGG | 48 | 510 | [19] |
asa1 | TAGGAGTTGTAGGATTAGCTAC TGTTGTATTCMGCSACTTC | 47 | 677 | This study |
Ace | GGAATGACCGAGAACGATGGC GCTTGATGTTGGCCTGCTTCCG | 58 | 616 | [12] |
cyl | ACTCGGGGATTGATAGGC GCTGCTAAAGCTGCGCTT | 52 | 688 | [2] |
gelE | TATGACAATGCTTTTTGGGAT AGATGCACCCGAAATAATATA | 58 | 213 | [2] |
efbA | GCACAAGTCCCAAAAGGAGC AAGTGCGGCTTCAGTAAGGG | 58 | 510 | This study |