Background
Arachidonic acid can be converted to leukotrienes which mediate inflammatory and immunological reactions [
1]. The key enzyme in leukotriene biosynthesis is 5-lipoxygenase (5-LO), which upon activation and interaction with 5-LO activating protein (FLAP) converts arachidonic acid, via a two step process, to leukotriene (LT) A
4. This compound can easily be transformed into LTB
4, through the action of LTA
4 hydrolase, or into LTC
4, catalyzed by LTC
4 synthase [
1]. Leukotriene C
4 can be further converted to LTD
4 and LTE
4. The biological effects of leukotrienes are dependent on receptor interaction [
1‐
5]. Leukotriene B
4 is a potent chemotactic mediator for granulocytes and T lymphocytes [
6‐
9]. Several reports have demonstrated a function of LTB
4 in the immune system as a stimulator of monocytes, T lymphocytes and B lymphocytes [
10‐
12].
Biosynthesis of leukotrienes is restricted to a few cell types in the human body. Myeloid cells are the main source of leukotriene formation but B lymphocytes have also the capacity to produce LTB
4. The activation of leukotriene synthesis in B cells is quite different in comparison to myeloid cells. Neutrophils and monocytes readily produce leukotrienes upon stimulation with calcium ionophore A23187. B cells, however, do not produce LTB
4 after challenge with calcium ionophore only but the cells can produce similar amounts of LTB
4 as myeloid cells after changing the cellular oxidative status [
13‐
15]. The 5-LO activity in B cells appears to be latent and the mechanism of activation of the enzyme under physiological conditions is not yet known. Endogenously produced LTB
4, however, plays a pivotal role in CD40-dependent activation of chronic B lymphocytic leukaemia cells (B-CLL) [
16].
In resting neutrophils, 5-LO is localized in the cytoplasm but upon cell activation the enzyme translocates to the nucleus and nuclear membranes [
17,
18]. It has been proposed that this translocation allows for 5-LO to interact with FLAP on the nuclear membrane, thus enabling leukotriene synthesis [
1]. The localization of 5-LO seems, however, to differ between different types of myeloid cells [
17‐
19]. Phosphorylation of 5-LO appears to influence the nuclear import of 5-LO [
20]. In B cell lines and isolated B cells
in vitro, both cytoplasmic and nuclear localisation of 5-LO have been reported [
14,
21].
Mantle cell lymphoma (MCL) constitutes 5% of non-Hodgkin lymphomas. Most MCL carry the t(11;14)(q13;q32) translocation by which cyclin D1 becomes overexpressed [
22,
23]. Most MCL have unmutated immunoglobulin genes [
24] and the current hypothesis is that the tumour cells are derived from the mantle or marginal zone of the B cell follicles. Microarray data of MCL have revealed high expression of 5-LO in these cells in comparison to control lymphoid tissue [
25].
The enzyme 5-LO has been reported to be expressed in precursor B cells, B cell populations from the peripheral blood, tonsils and various types of malignant B cells [
13,
14,
26]. However, it is not known which particular subsets of B lymphocytes from the tonsils which can express 5-LO and produce LTB
4. Therefore, in order to define the function of the leukotriene pathway in B cells, we investigated the cellular expression of 5-LO in different tonsillary subsets of B lymphocytes and the corresponding type of malignant B cell lymphoma.
Discussion
The activation mechanisms and biological functions of 5-LO in human B lymphocytes are unclear although the overall capacity of B cells to produce LTB
4 is similar to myeloid cells [
30]. We purified various subpopulations of tonsillary B cells and investigated the expression of enzymes involved in the leukotriene pathway. RT-PCR and western blot analysis of B cells from tonsils separated by flow cytometry showed high expression of 5-LO, in particular mantle zone B cells but also memory B cells (Figures
1 and
2), while germinal centre cells and plasma cells showed low or no expression of 5-LO, respectively. This analysis also demonstrated that FLAP and LTA
4 hydrolase were expressed in these various B cell populations (Figure
1). In order to further investigate the expression of the 5-LO protein, immunofluorescence analyses of tonsillary tissue B cells were performed. A distinct expression of 5-LO was seen in IgD
+ B cells in the mantle zone, while only a weak expression was found in germinal centre B cells and virtually no expression in plasma cells (Figure
3).
To verify if the expression of 5-LO was preserved in malignant B cells we investigated MCL and FL. Mantle cell lymphomas have a lower somatic mutation rate in immunoglobulin genes than follicular lymphomas and approximately 60–75% of mantle cell lymphomas have immunoglobulin genes in germ-line configuration. Therefore, it has been hypothesized that mantle cell lymphomas are derived from naïve cells, similar to normal mantle zone B cells [
31]. Immunohistochemical analysis of biopsies from MCL patients showed high expression of 5-LO in virtually all cells (Figure
4B). Follicular lymphomas, on the other hand, have a high rate of somatic mutations in immunoglobulin genes and clearly originate from germinal centre B cells [
31]. There were no or low expression of 5-LO in follicular lymphoma cells and this concur with the results of normal germinal centre B cells (Figures
2,
3,
4A,
4C and Table
1).
There are conflicting data about the expression of 5-LO in T cells. We have previously reported that T cells express FLAP but not 5-LO [
13], whereas, one other report indicates the formation of LTB
4 by human T cells [
32]. We found no evidence for the expression of 5-LO protein in CD3 positive tonsillar T cells (Figure
4F).
Since the numbers of tonsillary mantle zone B cells that can be obtained by flow cytometry cell sorting is limited, we investigated the capacity to produce LTB
4 in primary B-PLL cells and cell lines derived from patients with MCL. Three different MCL cell lines were used in this study and all were found to express 5-LO and to have the capacity to produce LTB
4 (Figures
5 and
6). Also, primary B-PLL cells produced LTB
4 in amounts similar to that of myeloid cells. Primary MCL/B-PLL cells and MCL cell lines produced LTB
4 after being challenged with calcium ionophore plus arachidonic acid and Diamide but not after stimulation with calcium ionophore only, showing that the mechanism of activation of the leukotriene pathway in MCL cells is similar to other investigated B cells [
16,
26,
33].
This study and earlier reports demonstrate that 5-LO is expressed in peripheral B cells, IgD
+ B cells in the mantle zone, memory B cells and in various malignant B cells, e.g. CD10
+ acute pre-B-lymphocytic cells, chronic B-lymphocytic leukaemia, B-PLL and MCL [
13,
14,
26]. Investigated B lymphocytes that do not express 5-LO are germinal centre derived B cells, plasma cells and CD10
- acute pre-B-lymphocytic cells. The question if and under which conditions B lymphocytes can release LTB
4 in vivo, is still unclear. In fact, it is possible that the role of the 5-LO pathway is quite different in B cells than in myeloid cells, and that the pathway has only an endogenous function in B cells which do not release and export LTB
4. Thus, in B cells, 5-LO and LTB
4 might only have a role at the level of the nucleus. However, the physiological conditions required for activation of the 5-LO pathway in B cells and biosynthesis of LTB
4 have not yet been uncovered. In this regard, the cellular oxidative status of the cells seems to be of importance [
13‐
15]. Our finding that the enzyme is highly expressed in mantle zone B cells and less expressed in germinal centre B cells and not expressed in plasma cells could indicate that the enzyme might be activated in the lymph node to attract activated T cells. It is known that activated T cells express BLT1, the LTB
4 receptor, and that LTB
4 is a potent chemotactic agent for T cells [
7‐
9]. Therefore, we will now study the effect of T- and B lymphocyte interaction on the activity and expression of 5-LO.
Methods
Reagents and cell lines
The calcium ionophore A23187 was purchased from Calbiochem-Behring (La Jolla, CA, USA). HPLC solvents were obtained from Rathburn chemicals (Walkerburn, U.K.) and the synthetic standards of LTB
4 and prostaglandin (PG) B
1 were from Biomol (Plymouth, PA, USA). Azodicarboxylic acid bisdimethylamide (Diamide) was from Sigma-Aldrich (Stockholm, Sweden) and arachidonic acid (AA) from NU-CHEK PREP Inc. (MN, USA). The well-characterized MCL cell lines Granta 519 and JEKO-1 were purchased from Deutsche Sammlung von Microorganismen und Zellkulturen (DSMZ) (Braunschweig, Germany). The MCL cell line Rec1 [
34] was a generous gift from Dr. Christian Bastard (Ronan, France). Cell lines were maintained in RPMI 1640 medium (Invitrogen Life Technologies, Stockholm, Sweden) supplemented with 2 mM L-glutamine and 10% fetal calf serum (FCS) and 50 μg/mL gentamicin (Invitrogen) under standard conditions (humidified atmosphere, 95% air, 5% CO
2, 37°C). JEKO-1 was maintained as described above but with a final concentration of 20% FCS.
Isolation of subpopulations of B cells
Tonsils were obtained from patients undergoing tonsillectomies (HELIOS Klinikum, Erfurt, Germany). Isolated cells from tonsils were incubated with CD19 micro beads (Miltenyi, Germany) and loaded in a magnetic field on a MACS separation column LS (Miltenyi). Cells were washed three times with PBS/EDTA (2 mM)/FCS (5%), subsequently the column was removed from the magnetic field and CD19 positive cells were eluted with 4–6 mL PBS/EDTA/FCS. Isolated cells were concentrated to 10
7 cells/50 μL and incubated with anti-CD38-PE (Pharmingen, Germany) and anti-IgD-FITC (Pharmingen) for 20 min at 4°C. Cells were washed twice, set to 2 × 10
6 cell/mL in PBS/EDTA/FCS and sorted with a FACSVantage SE cell sorting instrument (Beckton Dickinson, Germany). B cells were classified according to the scheme described by Grammer et al. 1999 [
35], mantle zone B cells (CD19
+, IgD
+, CD38
+), germinal centre B cells (CD19
+, IgD
-, CD38
++), memory B cells (CD19
+, IgD
-, CD38
+) and plasma cells (CD19
+, IgD
-, CD38
+++). Only cell populations that were > 95% pure were used in further experiments.
Isolation of total RNA and RT-PCR
Total RNA was separated according to the manufacturer's protocol with an RNeasy mini kit (Qiagen, Germany). Concentration and quality of RNA was determined with a Bioanalyzer2100 (Agilent, Germany). The reversed transcription reaction was performed on 1.8 μg of total RNA in a RT-PCR mixture (1× RT buffer, 167 μM dNTP, 0.7 U/μL RNasin, 0.1 μg/μL BSA, 0.35 U/μL AMV reverse transcriptase (Roche, Germany)).
PCR
PCR was performed with 60 ng of cDNA for each reaction. The PCR reaction mixture contained; PCR buffer, dNTP mix (0.2 mM each), BSA (0.1 μg/μL), SybrGreen (1:50) (Roche), MgCl
2 (1.8 mM), Platinum Taq DNA polymerase (1.5 U) (Invitrogen, Germany) and primer mix (0.2 μM each). Primers that were used are described in table
2.
Table 2
List of primers that were used in the RT-PCR experiment
5-LO | 72°C | 486 bp | 5'ACCATTGAGCAGATCGTGGACACGC 3'GCAGTCCTGCTCTGTGTAGAATGGG |
FLAP | 71°C | 352 bp | 5'GGCCATCGTCACCCTCATCAGCG 3'GCCAGCAACGGACATGAGGAACAGG |
LTA4H | 72°C | 464 bp | 5'GCAGTCACGGGATGCATGCTTGCT 3'GCCTGGCTCTACTCTCCTGGACTG |
LTC4S | 68°C | 252 bp | 5'TGCCACCACACCGACGGTACCATG 3'CCCTTCATGAAAGAAGATGCCGG |
Western blot
Tonsillary B cell samples were washed in PBS (2×) and re-suspended to 4 × 10
4 cells/μL in 5× sample buffer (250 mM Tris/HCl pH 6.8, 30% Glycerol (v/v), 10% SDS (w/v), 5% β-mercaptoethanol (v/v), 0.02% Bromphenolblue (w/v), complete mini protease inhibitor (Roche)). The suspension was heated to 95°C (5–10 min) and run on a regular 10% SDS-PAGE with SDS running buffer (25 mM Tris/HCl; 190 mM Glycine; 0.1% SDS (w/v)). HybondC nitrocellulose membrane (GE Healthcare, Germany) and semi-dry blotting apparatus (LMS labortechnik, Germany) was used for western blot transfer. The detection was performed with ECL kit (GE Healthcare, Germany). Primary antibody used for the immunoblot detection was anti-5-LO polyclonal rabbit antiserum [
36] and secondary antibody was an anti-rabbit-IgG coupled with HRP (GE Healthcare, Germany).
MCL cell lines were washed in PBS (w/o calcium and magnesium) and suspended in PBS (w/o calcium and magnesium) supplemented with complete mini protease inhibitor (Roche, Sweden). Cells were sonicated on ice (3 × 5 seconds) (Sonics Vibra cell, 40% amplitude, CiAB, Sweden) and centrifuged (1 × 105 × g, 60 min, 4°C). Supernatant was collected and protein concentration was determined with Bradford. Protein (7 μg) was loaded and separated on a 7% tris-acetate gel. PVDF membrane (GE Healthcare, Sweden) and semi-dry blotting apparatus (GE Healthcare, Sweden) was used in the western blot transfer.
Immunofluorescence analysis of tonsillary B cells
Confocal laser scan microscopy was performed with 7 μm cryostat sections embedded in Tissue Tec (Sakura, Japan). Specimens were placed on glass slides and fixed with acetone for 15 min at 4°C. After rehydration in PBS supplemented with BSA (2%) for 30 min at 20°C, specimens were incubated for 1 h at room temperature with rabbit anti-5-LO antiserum and for double immunofluorescence analyses with unlabeled primary antibodies against IgD and CD38 (Pharmingen), CD19 (Coulter Immunotec) or CD138 (Serotec). Nuclei were counterstained with DAPI. Secondary antibodies (goat anti-mouse-IgG F(ab')2-Cy2 and donkey anti-rabbit-IgG F(ab')2-Cy3; Dianova) were applied for 1 h at room temperature. Sheets were mounted on coverslips with Permafluor (Beckman, Munich, Germany) and viewed on a Zeiss Axiovert 200 M microscope equipped with a confocal laser scanning head (LSM510). Pictures were taken and analyzed using LSM510 Image Examiner software (Zeiss, Jena, Germany).
Immunohistochemistry on Tissue Microarray (TMA)
Formalin-fixed, paraffin-embedded tumor (lymph nodes) tissue samples and hyperplastic tonsils were obtained from the Department of Pathology, Karolinska University Hospital Huddinge. Before constructing a TMA block, serial 5 μm sections were cut from each donor block. One of these sections was stained with H&E for marking morphologically representative areas of the tumor. One representative area was targeted. Using Beecher Instruments Tissue Arrayer (Silver Springs, MD, USA), tissue cylinders with a diameter of 1.0 mm were punched from the targeted area in each donor block and deposited into a recipient TMA block. The cores of each TMA included duplicate cores from all cases and two cores of normal human heart muscles as a control for orientation of the sections.
Multiple serial 5 μm-thick TMA sections containing samples were cut de-paraffinized in xylene and hydrated in a series of graded alcohols. Enzyme digested antigen retrieval was carried out with Protease (Sigma P-5147, Sweden) at 20°C for 10 min. Anti-5-LO antibody (LO-32, Merck Frosst, Canada) was used at a dilution of 1:300 and anti-CD3 antibody was used at a dilution of 1:100 (DAKO). All staining were semiautomatic and performed on a TechMate 500 plus (DAKO, Glostrup, Denmark) by using the Dako REAL™ Detection System, PeroxidaseDAB, RabbitMouse kit as recommended by the manufacturer.
The results of the staining were evaluated by three persons (XW, BC and BS). Images of immunohistologic staining were acquired using an Olympus BX45 microscope (Olympus, Stockholm, Sweden) and Sony digital camera (DXC-S500, Sony, Stockholm, Sweden). Digitized images were processed using Picsara 8.9 Rev 5 software (Bildanalyssytem AB, Stockholm, Sweden).
Incubation of B-PLL cells and MCL cell lines
Intact cells (10 × 106) were suspended in 1 mL phosphate buffered saline (PBS) and pre-incubated for two min with azodicarboxylic acid bisdimethylamide (Diamide) (100 μM) prior to stimulation with arachidonic acid (40 μM) and calcium ionophore A23187 (1 μM). The cells were stimulated for five min and the reaction was terminated with 1 mL methanol. The A23187 incubation was performed as described above but without any addition of Diamide and arachidonic acid. Alternatively, cells (10 × 106) were re-suspended in 1 mL calcium free PBS including EDTA (2 mM) and sonicated for 3 × 5 seconds. The cells were pre-incubated for two min at 37°C in the presence of ATP (1 mM) prior addition of calcium chloride (2 mM) and arachidonic acid (40 μM). The reaction was terminated after five min of incubation with 1 mL methanol.
Analysis of leukotrienes
After addition of PBS (0.5 mL) and the internal standard PGB1 (50 pmol), the samples were centrifuged (1250 × g, 5 min). The supernatants were subsequently subjected to solid phase extraction on Oasis HLB Extraction Cartridges (10 mg, Waters, Sweden). The methanol fractions were analyzed on a Waters Alliance 2695 reverse phase HPLC and detected with Waters PDA 996. Methanol:water:trifluoroacetic acid (70:30:0.007, v/v) was used as mobile phase at a flow rate of 1.2 mL/min. Qualitative analysis was performed by comparison of retention times of synthetic standards and quantitative determinations were performed by computerized integration of the area of eluted peaks. Mean and standard deviation was calculated.
Ethical perspective
This study was approved by the local ethic committee of Friedrich-Schiller-University of Jena, Germany, and Karolinska University Hospital, Stockholm, Sweden.
Authors' contributions
YM carried out the 5-LO activity experiments and western blot, participated in designing the experiments and drafted the manuscript. MRL performed RT-PCR, western blot and immunofluorescence experiments, participated in designing the experiments and helped to form the final manuscript. XW performed the TMA experiments, participated in designing experiments and helped to draft the manuscript. RS participated in the design and evaluation of the experiments and helped to form the final manuscript. JF participated in designing and evaluation of the experiments. BC participated in designing and evaluation of the experiments. MB participated in the evaluation of the experiments and helped to form the final manuscript. BS participated in designing and evaluation of the experiments and wrote parts of the manuscript. AJRH conceived of part of the study, and participated in its design and helped to draft the manuscript. HEC conceived of part of the study, and participated in its design and drafted the manuscript. All authors have read and approved the final manuscript.