High expression of ubiquitin-conjugating enzyme 2C (UBE2C) correlates with nasopharyngeal carcinoma progression

One hundred and fifteen cases of paraffin-embedded clinical samples were obtained from the Affiliated Hospital of the Guangdong Medical College (Zhanjiang City, Guangdong, China) and the People’s Hospital of Zhongshan City (Zhongshan City, Guangdong, China). In total, 91 cases of NPC (n=91) and 24 cases of nasopharyngeal epithelial hyperplasia (NEH) were examined from 69 men (75.8%) and 22 women (24.2%). Clinical stage was classified based on the pathology tumor–node–metastasis (pTNM) system (AJCC⁄UICC 2002), and all NPC samples were determined to be non-keratinizing carcinoma. NPC patients were diagnosed for the first time at an average age of 42.7 years (range, 23–72 years). Additional clinical data are shown in Table 1. The use of human tissues in this study was approved by the Ethics Council of the Affiliated Hospital of the Guangdong Medical College and the People’s Hospital of Zhongshan City for Approval of Research Involving Human Subjects.

The expression and cellular distribution of UBE2C protein was assessed by immunohistochemical analysis. Five micrometer-thick paraffin sections were deparaffinized and re-hydrated according to standard protocols, and heat-induced antigen retrieval was performed in sodium citrate buffer (10 mmol/L, pH6.0). Endogenous peroxidase was inhibited by 0.3% H₂O₂, and non-specific protein binding was blocked with 10% goat serum. Sections were then incubated with primary antibody against UBE2C (1:200 dilution; cat. #A-650, Boston Biochem, MA, USA) at 4°C overnight. Non-immune IgG was used as a negative control, and antigenic sites were localized using a SP9000 Polymer Detection System and a 3,3′- diaminobenzidine (DAB) kit (ZSGB-BIO, Beijing, China). The immunoreactive score (IRS) of UBE2C was described previously [20]. Briefly, the staining intensity was determined as 0, negative; 1, weak; 2, moderate; and 3, strong. The percentage of UBE2C-positive cells was scored as 0, no cellular staining; 1, <1% cellular staining; 2, 1–10% cellular staining; 3, 10–33% cellular staining; 4, 33–66% cellular staining; and 5, >66% cellular staining. Samples with a total IRS of <6 were deemed as having low UBE2C expression, and samples with a sum IRS of ≥6 were determined as high UBE2C expression. The scoring of UBE2C was evaluated individually and independently by two pathologists who were double-blinded to the clinical data.

CNE1, CNE2Z and C666-1 cell lines representing well-, poorly- and undifferentiated NPC, respectively, were grown in Dulbecco’s modified Eagle’s medium (DMEM; Hyclone) supplemented with 10% fetal bovine serum (FBS; Hyclone) and 100 U/ml penicillin and streptomycin (100 μg/ml), as described previously [21]. The immortalized nasopharyngeal epithelial cell line NP-69 (obtained from the lab of Prof. Yao K.T., Cancer Research Institute, Southern Medical University, Guangzhou, China) was cultured in defined keratinocyte serum-free medium (cat. #10744-019, Invitrogen) containing 100 U/ml penicillin, 100 μg/ml streptomycin, 0.2 ng/ml recombinant epidermal growth factor and 5% FBS. All cell lines were cultured at 37°C in a humidified atmosphere with 5% CO₂.

siRNAs were purchased from RiboBio Co., Ltd. (Guangzhou, China). For RNA interference (RNAi) experiments, the following double-stranded oligo RNAs specific for the UBE2C coding region (si-UBE2C) were used: forward, 5′-GGACACCCAGGGUAACAUAdTdT-3′, reverse, 5′-UAUGUUACCCUGGGUGUCCdTdT-3′. A corresponding scrambled sequence (si-Control, Cat.siB05815) was used as a negative control. One day before transfection, equal numbers of CNE1, CNE2Z, C666-1 and NP-69 cells (5.0×10⁵/ml) were seeded in 6-, 24- and 96-well plates supplemented with complete medium without antibodies. When cells had reached 60–70% confluency, they were transfected with siRNAs using Lipofectamine 2000 (Invitrogen) in Opti-MEM I medium (Invitrogen). Cells were incubated at 37°C in a humidified atmosphere of 5% CO₂ for 6 h followed by replacement of complete medium. The efficiency of transfection was verified by observation of the fluorescence emitted by the Cy3-conjugated si-Control using fluorescence microscopy.

Indirect immunofluorescence was performed on NPC cells cultured on glass coverslips. After overnight incubation with primary antibody against UBE2C (1/100) at 4°C, the antigenic sites were detected using TRITC-conjugated goat anti-rabbit IgG (1/100, Protein Tech Group, Inc., Chicago, IL, USA). Images of the antigenic sites were captured with a laser scanning confocal microscope (TCS SP5 II; Leica, Germany).

Total proteins were extracted using RIPA lysis buffer (Cat. # P0013C, Beyotime Institute of Biotechnology, Jiangsu, China). 30 μg total proteins were subjected to SDS-PAGE, and then proteins were transferred to the PVDF membranes. After twice washed with TBST, the membranes were incubated with 5% skimmed milk in TBST at 37°C for 30 min, then the membrane were incubated with the primary antibodies (UBE2C, 1:500, Boston Biochem; β-actin, 1:1000, Santa Cruz, Texas, USA) at 4°C overnight, After twice washed by TBST, the membranes were incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 hour at 37°C. Bands were visualized using enhanced chemiluminescence (ECL) reagents (Thermo Fisher, Rockford, IL, USA) and analyzed with gel analysis system (BIO-RAD VersDoc TM5000MP System, Guangzhou, China). The expression of β-actin was used as loading control.

Total RNA was extracted with TaKaRa RNAiso plus reagent (Takara Biotechnology (Dalian) Co., Ltd.). Next, 1 μg of total RNA was used as a template to generate the first strand cDNA by oligo(dT₁₈) using the Promega RT System. Pairs of primers (5′–3′) synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) were as follows: UBE2C forward: tgatgtctggcgataaagggatt, UBE2C reverse: gtgatagcagggcgtgaggaa. β-actin forward, tgacgtggacatccgcaaag, β-actin reverse, ctggaaggtggacagcgagg. PCR was conducted using the LightCycler480 II instrument (Roche (China) Ltd., Shanghai, China). The total reaction volume of 10 μl consisted of 5 μl SYBR Green I PCR Master Mix (Toyobo, Osaka, Japan), 0.4 μl forward primer (10 μM), 0.4 μl reverse primer (10 μM), 1 μl cDNA and 3.2 μl ddH₂O. The PCR amplification protocol was as follows: denaturation was performed at 95°C for 1 min, followed by 45 PCR cycles of 95°C for 15 s, and 60°C for 60 s. The relative abundance of target mRNAs were determined from the C_T values and plotted as the fold change compared with the control group.

Proliferation rates were determined by Cell Counting Kit-8 (CCK-8) assays, as described previously [21]. Briefly, 4×10³ cells were seeded in 96-well plates at either 24 and 48 h after transfection with or without siRNAs, then 10 μl CCK-8 reagent (Beyotime Institute of Biotechnology, Jiangsu, China) plus 100 μl basal DMEM medium was added per well, and the absorbance of the samples was measured. Each independent experiment was performed three times.

NPC cell lines were seeded in 6-well plates and were successfully transfected in triplicate for each set of experimental conditions with the siRNAs described above. Forty-eight hours later, harvested cells were stained with propidium iodide (PI) and subjected to flow cytometric analysis (BD FACSCanto II, MA, USA).

First, we investigated the expression of UBE2C in NEH and NPC. Immunohistochemical staining revealed that the majority of NEH cases displayed no or low levels of UBE2C protein expression (IRS <6, 24/24); however, 56% of NPCs (51/91) exhibited strong nuclear and cytoplasmic UBE2C immunoreactivity (IRS ≥6) (P<0.001 when compared with NEH), indicating a crucial role of UBE2C expression in the pathogenesis of NPC (Table 1 and Figure 1).

The relationships between clinicopathological parameters and UBE2C protein expression levels in NPCs are detailed in Table 2. There was no significant association of high UBE2C protein expression levels with age, sex, smoking and clinical stage (I–II vs. III–IV) in 91 NPC cases. However, we observed that the level of UBE2C protein expression was positively correlated with tumor size (T classification) (T1–T2 vs. T3–T4, P=0.017), lymph node metastasis (N classification) (N0 vs. N1–N3) (P=0.016) and distant metastasis (M classification) (M0 vs. M1, P=0.015) in NPC patients (Table 2). These data indicated that UBE2C overexpression may be associated with the clinical progression of NPC.

CNE1, CNE-2Z and C666-1 cells were used to further examine the expression profiles of UBE2C in NPC cell lines in the present study. As shown in Figure 2, variable expression of UBE2C was observed at both the mRNA and protein levels in various NPC cell lines. In general, lower expression of UBE2C was detected in highly differentiated CNE1 cells, while increasing expression levels of UBE2C were observed in CNE2Z cells (poorly differentiated NPC) and C666-1 cells (undifferentiated NPC). Low level of UBE2C expression was also observed in immortalized NP-69 cells (Figures 2 and 3). These results indicated that UBE2C was universally expressed in the NPC cell lines, and its expression levels were inversely associated with differentiation status. Finally, immunofluorescent staining showed that UBE2C protein was cytoplasmic in immortalized NP-69 cells, but localized to the cytoplasm and nuclei of NPC cell lines (Figure 3).

Forced UBE2C expression in NIH 3T3 cells has been shown to promote cell proliferation [4]. Thus, we examined the role of UBE2C in NPC cell proliferation. Three pairs of RNA oligos targeting different regions of the UBE2C gene coding region were designed to knockdown UBE2C expression (data not shown). We found that the double-stranded oligos targeting the sequence GGACACCCAGGGTAACATA (401–420nt of CDS of UBE2C) displayed the most powerful inhibitory effects (>75%). As shown in Figure 4A, si-UBE2C attenuated UBE2C expression both at the mRNA and protein levels in high UBE2C-expressing C666-1 cells, indicating these siRNA oligos function well. Therefore, these double-stranded RNA oligos were used in the subsequent experiments. And the results of western blotting further confirmed that transfection this siRNAs to NPC cells led to a significant decrease of UBE2C protein expression (Figure 4B). Then the cell proliferation was examined by CCK-8 assays post transfection these 4 cell line with UBE2C specific siRNA. As shown in Figure 4C, transfection of the NPC cell lines with this siRNA led to significantly damaged cell viability in CNE2Z and C666-1 cells, but not the CNE1 and NP-69 cells. Together, these results suggest that overexpression of UBE2C plays a crucial role in NPC cell proliferation.

UBE2C is involved in many points of cell cycle control [5]. In the present study, treatment of the NPC cell lines with si-UBE2C decreased the distribution of cells in G1 phase but increased the proportion in S and G2/M phase. As shown in Figure 5, the increases in the proportion of NP-69, CNE1, CNE2Z and C666-1 cells in S phase was 35.7%, 30.9%, 79.9% and 141.6%, respectively. Furthermore, the increase in the proportion of NP-69, CNE1, CNE2Z and C666-1 cells in G2/M phase was 26.4%, 21.1% 92.8% and 110.3%, respectively. These results suggested that inhibition of UBE2C expression in UBE2C highly-expressing NPC cells led to a significant re-distribution in the cell cycle.