Background
Human milk contains numerous proteins with properties beyond nutritional function[
1]. Caseins are a main protein constituent of human milk and casein fragments exert a number of biological effects including the modulation of leukocyte adhesion[
2], chemotactic properties[
3‐
6], and inhibition of cell growth[
7,
8] for instance. More recently, a member of the casein family, casein alpha s1 (CSN1S1), was shown to be expressed outside the mammary gland: overexpression was noted in lymph nodes of encephalomyelitic mice and blood of multiple sclerosis patients[
9]. Furthermore, independent studies reported overexpression of CSN1S1 in synovial tissue of patients with osteoarthritis and rheumatoid arthritis[
10‐
12]. Consequently, a potential function of CSN1S1 was further characterized by the finding of proinflammatory effects on monocytic cells, like for instance increased expression of IL-1β[
13]. Thus, the concept of CSN1S1 as a multifunctional protein with both nutritional and immunomodulatory functions is evolving. Initial events in many inflammatory conditions crucially involve macrophages[
14]. Macrophages usually originate from monocytes that are produced in the bone marrow and reach target tissues via systemic circulation[
15]. In the present study, we therefore investigated the effect of CSN1S1 on monocytes and possible effects on cellular differentiation
in vitro.
Methods
Blood donors and monocyte isolation
Cells were isolated from 40–60 ml peripheral blood of healthy donors, collected into EDTA tubes (BD Bioscience, Plymouth, UK) by magnetic cell sorting with beaded CD14 antibodies (Miltenyi Biotec, Bergisch Gladbach, Germany). The number of experiments is indicated in the figure legends. Donors had to be free of any medication including over-the-counter drugs, without record of any chronic illness, and currently free of any acute illness such as infections. Cells were seeded out at 1 × 106/ml except for Western Blotting for extracellular signal-regulated kinase (ERK) and c-jun N-terminal kinase (JNK) experiments, cells were seeded out at 3 × 106/ml. The experiments were conducted with the understanding and the consent of each participant. The study was approved by the ethics committee of the medical faculty of Heinrich-Heine-University.
Cell culture and stimulation experiments
Monocytes were cultured in RPMI 1640 + GlutaMAX™ supplemented with 10% heat inactivated fetal bovine serum, 50 IU/ml penicillin, and 50 μg/ml streptomycin (Invitrogen, Karlsruhe, Germany). 30 μg/ml polymyxin (Sigma-Aldrich, Munich, Germany) was added to experiments to exclude any LPS effects (Sigma-Aldrich)[
13], except for the assessment of cellular morphology of living cells, where 200 ng/ml LPS was added in a control experiment. Recombinant human casein alpha S1 (CSN1S1) (Calbiochem, Darmstadt, Germany) was added to cultured cells in indicated concentrations for 24 or 120 h. The following compounds were used to induce
in vitro differentiation of monocytes as control experiments: M-CSF (R&D Systems, Wiesbaden, Germany) 50 ng/ml, GM-CSF 50 ng/ml, IL-4 20 ng/ml, IFNγ 10 ng/ml (all CellGenix, Freiburg, Germany). For inhibition of casein effects, 20 μmol/l mouse anti human M-CSF antibody (R&D Systems) or cell permeable inhibitors were added as described[
13] (all from Calbiochem): briefly, p38 mitogen-activated protein kinase (MAPK)-inhibitor ML3403 was used at 400 nM, ERK 1/2-inhibitor PD98059 was used at 50 μM, JNK-inhibitor (JNK-inhibitor II) was used at 20 μM. Viability of cells was assessed by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium-assay (Promega, Mannheim, Germany) according to the manufacturer’s instructions.
Phagocytosis assay
Primary human monocytes were seeded out at 1 × 106/ml and stimulated for 24 h with 1 μg/ml CSN1S1 in the presence of 30 μg/ml Px in order to exclude any LPS effects. The uptake of fluorescent labelled zymosan particles was assessed with the colorimetric Cytoselect Phagocytosis Assay (Cell Biolabs, San Diego, CA, USA) according to the manufacturer’s instructions after 24 and 48 h. As a control, cells were cultured in medium including Px only.
Microscopy
Living cells were photographed at a scale of 400× magnification with Nikon Eclipse TE300 and Nikon Digital Camera DXM 1200 (Nikon, Düsseldorf, Germany) or cells were cultured in chamber slides (Nunc, Rochester, NY, USA), May-Grünwald-Giemsa stained (Merck, Darmstadt, Germany) and photographed at a scale of 200 and 400× magnification with Axioskop 2 Plus (Zeiss, Jena, Germany) and Nikon Digital CameraDS-2Mv (Nikon).
Flow cytometry
Antibodies were purchased from BD Bioscience (CD14-FITC, CD64-PE, CD83-FITC, CD1a-PE), R&D (CD115-PE), and Biolegend (San Diego, CA, USA: CD116-FITC). After stimulation, cells were incubated with the above antibodies at optimized concentrations. For the assessment of CSN1S1 effects on DC differentiation, primary human monocytes were incubated with 50 ng/ml GM-CSF or 50 ng/ml GM-CSF plus 20 ng/ml IL-4 in the absence or presence of 10 μg/ml CSN1S1. Surface-marker expression was analyzed with FACSort (BD Biosience). Depending on the mean fluorescence intensity, the expression of markers is defined as “low” at < 100 and as “high” at > 100[
15].
Polymerase-chain-reaction (PCR)
RNA was isolated with Rneasy® Mini Kit (Qiagen, Hilden, Germany), and reverse transcription was performed using QantiTect® Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions. PCR with real time measurement of fluorescence was carried out on the StepOnePlus Real-time PCR system (Applied Biosystems, Foster City, CA, USA) with 0.3 μM gene-specific, exon-spanning primers for IL-1b [GenBank: NM_000576.2] (Fw: GGGCCTCAAGGAAAAGAATC, Rv: TTCTGCTTGAGAGGTGCTGA) in triplicates using Qantitect® SYBR Green PCR Kit (Qiagen). Results were relatively quantified using glyceraldehyde-3-phosphate dehydrogenase GAPDH [GenBank NM_002046.3] (Fw: CCAGCCGAGCCACATCGCTC, Rv: ATGAGCCCCAGCCTTCTCCAT) as internal and reference RNA (Stratagene, La Jolla, CA, USA) as external standard according to the –ΔΔCT-method.
Enzyme-linked immunosorbent assay
Quantikine® Human M-CSF-, IL-6- and IL-1-ELISA (R&D Systems) were applied for measuring proteins in the supernatants of cell cultures according to the manufacturer‘s instructions. Determinations were carried out in duplicates. Absorbance was measured at 450 nm using the Anthos 2001 ELISA reader (Anthos Mikrosysteme, Krefeld, Germany).
Western blot
Western blot was carried out as described before for detection of p38[
16], and JNK or ERK[
17]. Briefly, after stimulating primary human monocytes for 24h with 10 μg/ml CSN1S1 total cell proteins were prepared for SDS-PAGE on a 12.5% gel. Electroblotting was carried out onto a polyvinyldifluoride membrane (Porablot; Macherey-Nagel, Düren, Germany). Membranes including the same samples were incubated with either p38-MAP kinase antibody (GeneTex, Eching, Germany) or phosphorylated p38-MAP kinase antibody, JNK or phosphorylated JNK antibody, and ERK or phosphorylated ERK antibody (all Antibodies-online, Aachen, Germany) at optimized concentrations over night at 4°C. After appropriate washing procedures, the membranes were incubated with a 1:10,000 dilution of horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (Sigma). Proteins were visualized via enhanced chemiluminescence (ECL) substrate (Santa Cruz Biotechnology, Santa Cruz, California) and detection by CCD camera (Intas Chemilux ECL Imager).
Data presentation
Data is presented as error-bars representing mean and standard deviation, representative FACS histograms, or representative photographs of microscopy slides and immunoblots. Data comparison was carried out by two-sided T-test with Bonferroni correction for multiple testing for comparison of surface markers after stimulation with CSN1S1 only, or by one way ANOVA with Bonferroni correction for multiple testing in experiments with inhibitors, antibodies, or when CSN1S1 stimulation was compared to GM-CSF/IL4 or M-CSF/IFNγ stimulation. P < .05 was considered significant.
Discussion
In the present study, we demonstrate that exposure of primary human monocytes to CSN1S1
in vitro consistently skews cellular differentiation towards macrophages, including morphological changes, distinct surface marker expression, and functional properties such as increased phagocytic activity. Additionally, CSN1S1 induces the expression of proinflammatory cytokines[
13]. Besides these functions, the most obvious role of human CSN1S1 is to provide an amino acid source to the new-born. However, the acquisition of additional functionality in an evolutionary context is an increasingly recognized phenomenon, also referred to as protein promiscuity[
23,
24]. In accordance with this notion, caseins are considered to have arisen from innate immune genes, and that their nutritive functions are a consequence of a more recent evolutionary development[
25]. This assumption is based on the conserved organization of the casein genes in a cluster of innate immune genes that also includes the histatin/statherin-family[
25]. The hypothesis that CSN1S1 is a multifunctional protein is further supported by its state as a disordered protein with multiple potential tertiary conformations[
26]. This last point has to be regarded with caution however, since – to the best of our knowledge – crystallographic analyses of the human CSN1S1 structures currently do not exist. Since CSN1S1 is not only an endogenous produced protein, but is also a component of milk, the question arises, which potential functions CSN1S1-induced IL-1β expression could have in the offspring. Intestinal exposure to antigens and milk constitutes an important trigger for the development of a competent immune system in the new-born[
27]. It is therefore interesting to speculate that CSN1S1 in mother milk may contribute to the development of a patent immune system by triggering immune responses to potential pathogens by activation of innate immune responses like for instance IL-1β secretion. Moreover, CSN1S1 by itself gives rise to sustained specific IgG antibody production in nursed individuals[
28]. Early infantile autoantibody production in turn is speculated to confer protection to pathogens[
29]. On the other hand, there are several mechanisms which could potentially prevent overwhelming inflammation triggered by exposure to CSN1S1 in milk: CSN1S1 is only a minor component of human milk and constitutes approximately 5% of the casein-fraction[
30]. Moreover, CSN1S1 may be degraded by proteases in the healthy gut, thereby preventing IL-1β induction. Further research is clearly warranted to clarify these exciting new hypotheses and to explore, if variations in CSN1S1 exposure or extra-mammary expression may contribute to defective immune reactions. The recent findings of CSN1S1 overexpression in the autoimmune diseases multiple sclerosis and rheumatoid arthritis[
9,
10,
12] may be considered supportive of this hypothesis.
In the present experiments, the effect on all aspects of cellular differentiation, i.e. change of morphology, surface marker expression and increased phagocytosis, were observed rapidly, within 24 h of stimulation. Furthermore, CSN1S1 was able to reverse early GM-CSF-induced monocyte differentiation into DC, resulting in a macrophage like phenotype.
In vitro differentiation of monocytes towards macrophages or DC is most commonly carried out over 5 days, although more rapid differentiation in the course of several hours is recognized depending on the stimulus used[
20]. In accordance with this notion, characteristic differences between
in vitro differentiation towards macrophages (using M-CSF/IFNγ) or DC (using GM-CSF/IL-4) were observed after 120, but not 24 h. Of note, surface markers were strikingly similar between M-CSF/IFNγ and CSN1S1 treated cells. However, CSN1S1 failed to reverse
in vitro generation of early DC by a combination of GM-CSF and IL-4. This may be due to the more potent effect on
in vitro DC generation by the combined cytokines compared to GM-CSF alone[
15,
21,
31].
We were consequently interested to explore potential mechanisms employed by CSN1S1 to induce monocyte differentiation and cytokine expression. It was previously reported that primary human monocytes secrete GM-CSF in response to CSN1S1[
13]. This was somewhat puzzling, because GM-CSF is known to influence the differentiation of monocytes towards a DC phenotype[
21]. On the other hand, according to the present data, CSN1S1 does also increase the secretion of M-CSF into culture supernatants. However, addition of a neutralizing M-CSF antibody to stimulated monocytes did not abrogate CSN1S1-effects. Importantly, there were also no changes in expression of the GM-CSF- or M-CSF-receptors (CD115 or CD116, respectively). Thus, CSN1S1 likely induces its effects on monocyte differentiation by a mechanism independent from M-CSF signalling. Concerning intracellular messengers, CSN1S1, like other proinflammatory cytokines such as IL-32 for example, employs p38 MAPK to induce proinflammatory cytokine expression[
13,
19]. Inhibition of another member of the MAPK family, ERK1/2, a well-known regulator of cellular differentiation[
32], but not p38 or JNK led to a decrease in CSN1S1 induced upregulation of CD14 in the present experiments. This effect may be specific for CSN1S1 rather than attributable to the process of differentiation of monocytes towards macrophages in general, because M-CSF induced upregulation of CD14 was inhibited by JNK exclusively. Furthermore, in contrast to differentiation, the secretion of proinflammatory cytokines (i.e. IL-6 and IL-1b) was influenced by the inhibition of JNK and/or p38, but not by ERK1/2. It cannot be excluded that other second messengers are employed for CSN1S1 induced cellular differentiation as well, especially because CD64 was not significantly affected by ERK1/2 inhibition. In conclusion, the data suggest that MAPK may be differentially involved in mediating CSN1S1 induced effects on cellular differentiation or cytokine expression. Further research in this direction is warranted however, before firm conclusions can be drawn.
A limitation to the study consists in the fact that the concentration of CSN1S1 in potentially relevant tissues for monocyte differentiation such as e.g. inflamed nerves, joints, or even the gastrointestinal tract is unknown. In order to simulate physiologic conditions, the concentrations of CSN1S1 used in the present experiments was determined based on previous observations: While
in vitro-experiments suggest that ectopic CSN1S1 secretion by monocytes is in the range of ng/ml[
9,
13], human milk contains 2.4 mg/ml total casein[
33], approximately 5% of which is made up of CSN1S1[
30]. This results in a concentration of 120 μg/ml CSN1S1. Although proteins contained in milk are exposed to proteases within the digestive tract, they may be absorbed in an intact form which is even favoured by immature digestive functions of infants and protease inhibitors within milk[
34]. Thus, concentrations used in the present experiments may reflect local conditions
in vivo.
Competing interests
SV, AB, IA, EB, JJ, MS report no conflict of interests.
Authors’ contributions
Conceived the study: SV, JJ, MS. Data acquisition: SV, AB, IA, EB. Data analysis and manuscript preparation: SV, JJ, MS. All authors read and approved the final manuscript.