Introduction
The first hematopoietic and vascular cells develop from extra-embryonic mesoderm in the murine yolk sac at day 7.5 of gestation [
1,
2]. Once formed, these early progenitors organize into blood islands that consist of primitive erythroblasts surrounded by a layer of endothelial cells [
3]. Close association of these two lineages led us to the hypothesis that they must arise from a common endothelio-hematopoietic precursor called hemangioblast [
4‐
6]. During embryonic life, next waves of hematopoiesis occur in the aorta-gonad-mesonephros region (AGM), fetal liver, and finally in the bone marrow. However, the possibility of primitive hematopoiesis in other embryonic sites has been suspected for a long time. Sequeira Lopez et al. demonstrated that multiple regions within the embryo are capable of forming blood before and during organogenesis [
7]. Therefore, there seems to be a widespread occurrence of hemo-vasculogenesis, the formation of blood vessels accompanied by the simultaneous generation of red blood cells [
1,
7‐
9]. When a vascular lumen forms, the erythroblasts "bud" from endothelial cells into the forming vessel [
7,
8]. Understanding the intrinsic ability of tissues to manufacture their own blood cells and vessels has the potential to advance the field of organogenesis, regeneration medicine and tissue engineering [
10].
Subsequently, several investigators have identified human embryonic stem (hES) cell-derived populations that display both hematopoietic and endothelial potential [
11‐
14]. Hemangioblast was identified as the cell which gave rise to colonies of blast-like cells (BLCs) [
12]. These BLCs expressed KDR and represented a transient population that preceded development of primitive erythroid lineage. Similarly, progenitor comparable to the BLCs has been identified in the early gastrulating mouse embryo [
15]. Mapping studies revealed that the embryo hemangioblasts exist in highest numbers in the posterior region of the primitive streak. This observation further supported the notion that hematopoietic commitment is initiated prior to the formation of yolk sac and blood islands.
It is well known how the immune system responds to conventional cell, tissue and organ transplants. However, the immune response to ES cell-derived grafts is difficult to predict due to the lack of donor-type vasculature, endothelial cells and professional antigen-presenting cells (APCs) in cellular transplants. The specific rejection of transplanted organs and tissues is primarily mediated by T cells and occurs mostly because of allelic differences between graft and recipient at their polymorphic major histocompatibility complex (MHC) molecules called human leukocyte antigen (HLA) in humans. Two types of MHC molecules exist, class I and II, and their function is to present antigenic peptides to CD8+ and CD4+ T cells, respectively. While the MHC class II antigens are normally present only on macrophages, dendritic cells, B cells and thymic epithelial cells, the MHC class I molecules are constitutively expressed at various levels on the surface of all adult nucleated cells [
16]. Up to 1% of peripheral T cells in each individual can cross-react with allogeneic MHC antigens on transplanted cells [
17], and that is why T cell-mediated allorejection is a rapid and vigorous process, which is mostly supported by preexisting memory T cells that have less stringent requirements for activation. Data on immunological properties of human and murine ES cells and their differentiated derivatives are controversial, ranging from those claiming unique immune-privileged properties for ES cells to those, which contradict these conclusions. This indicates that much more research is required to definitively understand the immunological features of ES cell derived progenitors. In this study, we examined the expression profile of HLA molecules on the surface of human ES cells, EB cells and blast-like cells. We demonstrated extremely low levels of HLA-A2 expression in the undifferentiated H9 human ES cell line, somewhat elevated HLA expression on the EB cells, and a moderately elevated HLA expression on the surface of combined blast colonies cells, as well as on cells derived from individual blast colonies. Therefore, this study represents an important attempt to define the HLA antigen expression and the graft rejection issue of human ES cells and their progenitors at different levels of differentiation.
In context of the increasing focus on regenerative medicine and the potential for development of stem cell based therapies for human diseases, the characterization and functional analysis of early mesodermal cell populations and their immediate progeny-hemangioblast-is of particular interest [
18]. Therefore, we hypothesized that dual endothelio-hematopoietic progenitor can be obtained from hES cell-derived mesodermal progenitors early in the embryonal development. We expected that these blast cells would be able to form colonies of functional cells with dual hematopoietic/endothelial potential. Low expression of MHC class I molecules would allow their engraftment against histocompatibility barriers, and thus future clinical applications.
Methods
hES cell culture and differentiation
The hES cell line H9 (registered as WA09 by the US National Institutes of Health) was purchased from WiCell Research Institute (WI, USA). Cells have been cultured on the feeder layer of mouse embryonic fibroblasts (MEFs, Global Stem Cell Technologies, USA) in the culture medium consisting of DMEM-F12 with Knockout Serum Replacement (20%), L-Glutamine (0.8 mM), 2-Mercaptoethanol (119 μM), Non-Essential Amino Acid Solution (1%), and human recombinant bFGF (10 ng/ml) (all from Invitrogen, CA, USA) in standard cell culture condition (37°C, 5% CO2) and split mechanically every 3rd day. When the hES culture reached 75% confluence, cells were used for differentiation studies in embryoid body (EB) system. The hES cells have been detached mechanically and small clumps of cells were resuspended in serum-free Stemline II Hematopoietic Stem Cell Expansion Medium (Sigma) containing BMP-4 and VEGF (50 ng/ml of each) (Invitrogen, CA, US). After 48 hours of incubation, half of the culture media was replaced with the Stemline II media containing BMP-4 and VEGF (both at 50 ng/ml), SCF, Tpo, and FLT3 ligand (all at 40 ng/ml) (Invitrogen, CA, US). When EB culture was performed for longer than 3 days, half of the medium was replaced every 48 hours with fresh medium containing BMP-4, VEGF, SCF, Tpo, and FLT3 ligand at concentrations described above. In the majority of experiments, EBs were collected after 72 hours of culture and dispersed to single cell suspension by incubation with Trypsin (0.05%) and EDTA (Invitrogen), and passing through 22 G needle and 40 μm cell strainer. Single cells were resuspended in Stemline II medium at a concentration of 2–5 × 106 cells/ml and further diluted in Methocult SF H4436 semisolid medium (Stemcell Technologies, Canada) at ratio of 1:30. The above culture medium was supplemented with BMP-4, VEGF, Tpo, and FLT3 ligand (all at 50 ng/ml) and cultured in Low Attachment Plate (Corning). The growth of blast colonies was observed after 3 days. For further studies, the BCs were hand-picked into Stemline II medium and dispersed mechanically to single cell suspension.
Hematopoietic differentiation of blast cells
The blast cells were resuspended in Methocult SF H4436 media supplemented with 0.5% of EX-CYTE (Millipore) and plated onto untreated 12-well tissue culture plate (Becton Dickinson). After 15 days, the morphology of the colonies was assessed under inverted microscope Olympus with phase-contrast, the pictures were taken with Canon Digital Rebel XTi camera and the number of colonies of different type was subsequently counted. The single colony-forming units (CFUs) were hand-picked and assessed either by RT-PCR or Wright-Giemsa staining (Camco Quik Stain, Fischer, US).
Endothelial differentiation of blast cells
For endothelial differentiation, blast cells have been resuspended in EGM-2 complete media (Cambrex) and incubated in fibronectin coated plates (Becton Dickinson) for 5 days. To prove that fibronectin-adhering cells are of endothelial lineage, the Dil-Ac-LDL uptake assay was performed. The cells were incubated with 10 ug/ml Dil-Ac-LDL (R&D System) for 4 h, dissociated with Trypsin-EDTA and spun onto glass slides. After fixation with 4% paraformaldehyde (Fischer) in PBS for 5 min., the cells were counterstained with Hoechst 33342 (Invitrogen) and visualized under fluorescent microscope. Next, the capillary formation assay was performed. Endothelial cells had been resuspended in EGM-2 complete media and added onto the surface of solidified Matrigel (BD Biosciences). After 24 h of culture, the capillary formation was visualized under the inverted Olympus microscope with phase contrast, and pictures were taken using Canon Digital Rebel XTi camera.
RT-PCR
RNA was isolated using RNeasy Mini Kit (QIAGEN) and cDNA synthesis was performed with SuperScript
® First-Strand Synthesis System (Invitrogen) using the oligo(dT) method according to manufacturers' protocols. In samples from single-colonies, cDNA was prepared using CellsDirect cDNA Synthesis Kit (Invitrogen). To perform semi-quantitative analysis, 5 ug of RNA from each sample were used, the β-actin bands were used as internal loading control and a minimum number of cycles were performed to maintain the linearity of reaction. The sequences and annealing temperatures for primers resulted from extensive literature search and are listed in Table
1. PCR reaction was performed using Taq PCR Core Kit (QIAGEN) in DNA Thermal Cycler 480 (PERKIN ELMER CETUS) and the product was visualized in 2% agarose gel. (Table
1)
Table 1
The sequences of primers, product length and annealing temperatures used in RT-PCR reactions
β-Actin | TTTGAATGATGAGCCTTCGTCCCC | GGTCTCAAGTCAGTGTACAGGTAAGC | 129 | 59 |
T | TGTCCCAGGTGGCTTACAGATGAA | GGTGTGCCAAAGTTGCCAATACAC | 144 | 59 |
FOXA2 | CCATTGCTGTTGTTGCAGGGAAGT | CACCGTGTCAAGATTGGGAATGCT | 196 | 59 |
NeuroD | CCCATGGTGGGTTGTCATATATTCATGT | CCAGCATCACATCTCAAACAGCAC | 196 | 59 |
KDR | CCTCTACTCCAGTAAACCTGATTGGG | TGTTCCCAGCATTTCACACTATGG | 219 | 59 |
CD34 | AAATCCTCTTCCTCTGAGGCTGGA | AAGAGGCAGCTGGTGATAAGGGTT | 216 | 59 |
CD31 | ATCATTTCTAGCGCATGGCCTGGT | ATTTGTGGAGGGCGAGGTCATAGA | 159 | 59 |
SCL | AAGGGCACAGCATCTGTAGTCA | AAGTCTTCAGCAGAGGGTCACGTA | 104 | 59 |
PTCH | CGCTGTCTTCCTTCTGAACC | ATCAGCACTCCCAGCAGAGT | 282 | 60 |
GLI1 | CTCTGAGACGCCATGTTCAA | ATCCGACAGAGGTGAGATGG | 282 | 60 |
ε-globin | CACTAGCCTGTGGAGCAAGATGAA | AATCACCATCACGTTACCCAGGAG | 304 | 59 |
γ-globin | CGCTTCTGGAACGTCTGAGGTTAT | CCAGGAGCTTGAAGTTCTCAGGAT | 370 | 59 |
β-globin | TGTCCACTCCTGATGCTGTTATGG | AGCTTAGTGATACTTGTGGGCCAG | 302 | 59 |
Immunostaining
For FACS analysis, blast cells were isolated, washed and stained with appropriate monoclonal antibodies for 20 minutes at 4°C. The antibodies included: CD45-PerCp, CD34-FITC, CD31-PE (from Becton Dickinson), CD146-AF647, CD144(VE-cadherin)-PE, Flt-1-PE (from R&D Systems), CD33-PerCp (eBioscience). The cells were acquired using BD FACSCalibur (Becton Dickinson) and analyzed with FlowJo software (Tree Star).
Immunofluorescence microscopy
Carefully cleaned coverslips were incubated in poly-L-lysine (Sigma) and dried for 24 hours. H9 cells, EB (day 3) cells and BC (day 6) cells were harvested, washed in PBS, and were allowed to settle on the coated coverslips for 30 min at 37°C. The cells were then fixed in 1% paraformaldehyde for 30 min, washed with PBS, and the coverslips were blocked with 1% BSA for 60 min. Staining for HLA-A2 was performed with the FITC-conjugated antibody BB7.2 (BD Pharmingen) together with DAPI (Promega) for 2 hours at room T°. The coverslips were then washed with PBS and mounted with ProLong Gold mounting medium (Invitrogen) on pre-cleaned microscope slides. The slides were then dried overnight at room T° in dark and observed under a Nikon fluorescent microscope.
Discussion
Future clinical applications of human ES cells and their progenitors will require that they do not express or express only low levels of HLA antigens, which can be tolerated by the host immune system. In this work, for the first time, we describe low expression of HLA antigens in human ES, EB, and blast cells with dual hematopoietic and endothelial potential, which may have future clinical applications.
Although some published data on the existence of murine and adult human hemangioblast exist [
6], only recently two different research groups have used the hES/EB cell differentiation system
in vitro to investigate human embryonic hemangioblast. Both Kennedy et al. [
12] and Lu et al. [
13] used ES/EB system to differentiate very early dual hematopoietic/endothelial precursors which were capable of formation of blast colonies (BCs). Although they applied different culture conditions and the phenotype of obtained blast cells significantly differed, in both cases, these cells could differentiate to both blood and endothelial progenitors.
Similar to the above publications, we performed hES cell differentiation in EB system and obtained blast colonies which were further shown to be bipotential. As the main scope of our studies was the evaluation of clinical application of blast cells, we adopted our culture conditions from Lu et al. [
13] and studied HLA expression in these cultures. This methodology seems to be superior in order to not only investigate the existence of blast cells, but also to upscale its production. In the EB system, the early development of mesoderm and hemangioblast was stimulated with sequentially used growth factors: VEGF and BMP-4 in order to enhance mesodermal differentiation, and BMP-4, VEGF, Tpo, SCF and Flt3L to stimulate formation of early hematopoietic/endothelial precursors. We modified the ES-derived blast cell culture conditions using commercially available Methocult SF H4436 semisolid medium supplemented with BMP-4, VEGF, Tpo and Flt3L.
The blast colonies obtained by us had similar morphology as previously described, but they were composed of lower number of cells. Most likely this resulted from differences between hES cell lines used. Both Kennedy et al and Lu et al presented data based on H1 hES cells while we were using H9 cell line. As in the above papers, blast cells expressed embryonic and fetal globin genes, so at least some of them already differentiated to the erythroid lineage. Contrary to Lu et al., some of our ES-derived blast cells expressed CD31, CD34 and VE-cadherin, the molecules thought to be closely associated with the phenotype of hemangioblast [
12]. However, some of the blast cells in culture were already terminally differentiated and were shown to express either exclusively hematopoietic marker CD45 or endothelial antigen CD146.
Despite this fact, the blast cells produced in our conditions could be successfully differentiated to either functional endothelial cells or blood cells. We observed growth of colony forming units composed of either primitive nucleated erythrocytes, macrophages or both these lineages. Therefore, our culture system most likely parallels very early yolk sac hematopoiesis where only these cell populations exist. The similar type CFUs were obtained by Kennedy et al. Contrary to Lu et al., we did not obtain growth of multilineage colonies containing also megakaryocytes and granulocytes, which may be due to the modification of culture conditions described in methods and materials.
In both reports, as well as in our studies, it was shown that the majority of colonies, but not necessarily single cells, are bipotential. This suggests that hemangioblast exists at the EB stage and gives rise to bipotential cell clone. But, are the single blast cells also bipotential? Lu et al. reported that cells from primary blast colonies can form secondary colonies and a proportion of them maintain bipotentiality. This means that at least some of the blast cells have properties of hemangioblast. We also investigated this issue, but the yield of secondary colonies was very low and the majority of them formed BFU-E colonies rather than blast colonies. Therefore, based on our observations, it is most likely that the majority of blast cells obtained at day 6 are already committed precursors of blood cells or endothelium. In this situation, the real hemangioblast seems to occur mainly at EB stage and is transient.
In order to prove how long cells persist in a hemangioblast or hemato-endothelial precursor stage, as well as how to optimize the yield of EB-derived blast cells, we performed an experiment with sequential formation of blast cells from EBs from day 0 to 6. Based on our data, it is clear that blast colony-forming cells (BL-CFCs) – or dual hemato-endothelial precursors arise early in EB development and are called hemangioblasts (day 3). Moreover, we performed semi-quantitative RT-PCR analysis of gene expression in developing EBs, confirming that the differentiation of BL-CFCs occurs just after differentiation of mesoderm layer and was suppressed by a subsequent development of endoderm. We also observed that the expression of a number of hemangioblast-related genes (CD34, CD31, KDR) peaks exactly at the time point when BL-CFCs aroused. Therefore they can be used in quantitative analysis of hemangioblast differentiation in EB culture (and in improved culture conditions) to obtain a higher yield of cells. The increased expression of genes of Hedgehog pathway signaling on day 3 suggests that their action may be related to the differentiation of early hemangioblasts. Based on the literature, Hedgehog signaling is important for embryonic hematopoiesis and vasculogenesis, and it was suggested that it enhances paracrine BMP-4 signaling, leading to the development of blast-like cells [
19,
20].
Blast cells differentiating from hemangioblasts or hemato-endothelial precursors appear at a very early stage of ES differentiation, and it is unclear from previous studies whether it expresses HLA molecules. In this work, we, for the first time, demonstrated that the blast cells express HLA molecules at an elevated level compared with their precursors: ES and EB cells. Other studies have also demonstrated low levels of expression of MHC class I molecules in human undifferentiated ES cells [
21‐
24], while the levels of MHC class I molecules on human ES cells upon differentiation were reported to be slightly downregulated [
21] or moderately upregulated [
22]. These observations suggest that ES cell-derived therapeutics will most likely express MHC class I, and that they may be recognized by T cells and rejected upon transplantation. However, this issue still needs further detailed studies. Based on our data, although the blast cells can be characterized by mildly increased HLA expression compared to negative controls, e.g. ES and EB cells, it is still much lower than in differentiated endothelial and hematopoietic cells. Moreover, several published studies suggest immune- privileged properties of ES-derived cell products [
23,
25‐
28]. Human ES cells do not express co-stimulatory molecules and many other immune-related genes [
24,
29]. Moreover, the undifferentiated and differentiated ES cells were shown to be protected against T cell-mediated immune responses due to a high-level expression of the granzyme B inhibitor [
28]. In addition, human and murine ES cells are capable of actively modulating immune reactions as demonstrated by their ability to inhibit third-party allogeneic dendritic cell-mediated T cell proliferation [
23], to abrogate ongoing alloresponses in mixed lymphocyte reactions [
26,
30] and to completely prevent T cell cytotoxicity against allogeneic ConA blasts in vitro [
31]. Although human ES cells express relatively low levels of MHC-I, it was shown that they were also insensitive to human natural killer (NK) cell-mediated cytotoxicity [
22]. The resistance of hematopoietic stem cells to immune attack was shown in a previous study [
32]. Notably, embryonic tissues from early gestational stages were also known to be less immunogenic than their adult counterparts [
33]. In conclusion, we suggest that the ES cells and their early progenitors could evade immune surveillance due to their low immunostimulatory potential, and thus have future clinical potential.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
EC contributed to conception and design, funding, supervision, data analysis and interpretation, final approval of the manuscript. GWB contributed to conception and design, collection and/or assembly of data, writing the manuscript. SY contributed to conception and design, collection and/or assembly of data. BM contributed to collection and/or assembly of data, writing the manuscript. AA contributed to collection and/or assembly of data. SH contributed to the drafting and critical revision of the manuscript. Wei-PM contributed to critical revision of manuscript, HLA studies. ASS contributed to conception and design of ES differentiation cultures.