Human herpesvirus type 1 and type 2 disrupt mitochondrial dynamics in human keratinocytes

Human keratinocytes (HaCaT cells) were cultured as a monolayer using Dulbecco’s modified Eagle’s medium (DMEM; Gibco) supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, 100 U of penicillin per ml and 100 mg of streptomycin per ml, at 37 °C in a humidified atmosphere of 5% CO₂. Cells were grown to full confluence with a medium change every 2 days. The McIntyre strain of HHV-1 and HHV-2 strain 333 were grown in Vero cell cultures (ATCC no. CRL1587). To produce the virus for the experiments, the Vero cells were infected with HHV-1 or HHV-2 at 0.001 plaque-forming units (PFU)/cell. One hour after infection at 37 °C, the inoculum was removed by aspiration, fresh culture medium was added, and the cells were cultured for 3 days. Culture supernatants were harvested at 72 h after virus challenge, and after three cycles of freezing (-80 °C) and thawing at RT, they were clarified by centrifugation at 800 g for 10 min and stored in small volumes at -80 °C. A virus stock suspension containing approximately 10⁸ PFU/ml was used in all the experiments.

HaCaT cells (10⁷ cells per well) were infected with HHV-1 or HHV-2 for 60 min at 37 °C. After adsorption, the inoculum was removed by aspiration and fresh culture medium was added. The cells were then incubated for 2, 24 or 48 hours at 37 °C with 5% CO₂.

The growth kinetics, behaviour and morphology of HaCaT cells infected with HHV-1 or HHV-2 were analysed using a JuLI™ Br Live Cell Analyser system for a bright-field image analysis (NanoEnTek, Korea) [4]. HaCaT cells (10⁷ cells per well) were seeded in a 6-well plate and infected with HHV-1 or HHV-2 as described above. Cell-growth images were captured for 48 h at 7-min intervals. Cell confluence analysis was done and a real-time cell growth curve was generated using JuLI Br PC software. All images were captured at objective magnification of ×4.

To determine the number of viral DNA copies per reaction, a standard curve was prepared as described previously [7]. Briefly, fragments of glycoprotein B gene sequence of HHV-1 and HHV-2 were amplified using appropriate primers: HSV-1Fext (GTGATGTTGAGGTCGATGAAGGT) and HSV-1Rext (ACAACGCGACGCACATCAAGGT) and HSV-2Fext (CGTACGATGAGTTTGTGTTGGCGA) and HSV-2Rext (TCAGCTGGTGAGAGTACGCGTA). The products were cloned in pGEM-T Easy Vector. Serial dilutions of recombinant plasmids were prepared ranging from 10 to 10⁷ copies per reaction. Real-time PCR was performed in 96-well plates using a 7500 Real Time PCR System thermocycler (Applied Biosystems) with TaqMan Universal Master Mix II (Applied Biosystems) and probes labelled with JOE as described previously [11].

HaCaT cells seeded on glass coverslips in a 12-well plate were infected with HHV-1 or HHV-2. At 2, 24 and 48 h p.i. (hour postinfection) coverslips were incubated with 100 nM MitoRed (Sigma-Aldrich) for 30 min at 37 °C, then washed three times with culture medium and fixed in 3.7% paraformaldehyde/PBS (Sigma-Aldrich). The presence of viral antigens was detected by means of direct immunofluorescence, using FITC-conjugated polyclonal rabbit anti-herpes simplex virus 1/2 serum (Dako, dilution 1:200).

Additionally, at 2 and 24 h p.i., HaCaT cells were stained for dynamin-related protein 1 (Drp1) detection. At the beginning, cells were washed twice in PBS (Sigma-Aldrich) and fixed in 3.7% paraformaldehyde/PBS (Sigma-Aldrich) for 30 min at room temperature (RT), then permeabilized with 0.5% Triton X-100 (Sigma-Aldrich) solution in PBS. Before staining, fixed HaCaT cells on coverslips were blocked with PBS containing 1% bovine serum albumin (BSA) (Sigma Chemicals) for 30 min at room temperature. The presence of Drp1 was detected by using DNM1L polyclonal antibody (Invitrogen, dilution 1:500) and Alexa Fluor 488 goat anti-rabbit (Invitrogen; dilution 1:250).

Cell nuclei were stained with Bisbenzimidine/Hoechst 33258 according to manufacturer’s recommendations. Afterwards, coverslips were mounted on microscope slides using anti-fade mounting medium (Sigma-Aldrich). Uninfected HaCaT cells served as a negative control. For Drp1 staining, HaCaT cells pre-incubated with Dynasore (GTPase inhibitor; 80 µM/ml) for 60 min before infection served as a positive control. Results were evaluated using a confocal microscope (Leica TCS SP8-WWL).

Confocal images were acquired using a Leica white light laser scanning confocal microscope (Leica TCS SP8-WWL, KAWA.SKA Sp. z o.o., Poland) with a 63x oil-immersion lens, using excitation at 405 nm, 499 nm, 569 nm for Hoechst, FITC and MitoRed, respectively. Images were captured and converted to 24-bit tiff files for visualization using the Leica Application Suite X (LAS X) software platform (Leica Microsystems).

For mitochondrial morphology analysis, MiNa Single Image macro was used. This tool allows the number of individuals, number of networks, mean length of branches/rod, mean network size, mean network size per branch, and mitochondrial footprint to be computed. In order to perform this analysis images, obtained by confocal microscopy were used according to the protocol established by Valente et al. [18]. Each analysis was performed on ten cells.

Cellular fluorescence was quantified using a NucleoCounter NC-3000 image cytometer (ChemoMetec). The NucleoCounter system was used for evaluation of mitochondrial transmembrane potential (Δψ) and cell vitality at 24 h p.i. In the mitochondrial potential assay, HaCaT cells were stained with JC-1 (cationic dye 5,5,6,6-tetrachloro-1,1,3,3-tetraethylbenzimidazol-carbocyanine iodide; ChemoMetec A/S). First, the suspended HaCaT cells were diluted with PBS to a final concentration of 1.5 ×10⁶ cells/mL. The samples were then incubated with 12.5 mL of a 200 mg/mL solution of JC-1 for 10 min at 37 °C. After incubation, samples were washed twice in PBS and resuspended in 250 mL of a 1 mg/mL solution of 4′,6-diamidino-2-phenylindole in PBS. In the vitality assay (detection of changes in the intracellular level of thiols), HaCaT cells were stained with VitaBright-48 (ChemoMetec A/S), acridine orange (ChemoMetec A/S), and propidium iodide (PI; ChemoMetec A/S). Suspended HaCaT cells were diluted with PBS to a final concentration of 2.0 × 10⁹ cells/mL and were mixed with 5 mL of VitaBright-48·PI·acridine orange. Subsequently, the samples were examined using a Nucleo-Counter NC-3000 according to manufacturer’s instructions. The results were analyzed using the NucleoView NC-3000 software (details of the NucleoCounter NC-3000 design and capabilities are available at www.​chemometec.​com) [2].

The results were statistically evaluated by one-way analysis of variance (ANOVA) using the Student–Newman–Keuls multiple comparisons test and the Tukey–Kramer multiple comparisons test. This analysis was performed using GraphPad Prism^TM version 4.03 software (GraphPad Software Inc., San Diego, CA, USA). Statistical differences were interpreted as significant at P < 0.05 (*) and highly significant at P < 0.01 (**).

During HHV-1 infection, a cytopathic effect (CPE) was observed as morphology changes in HaCaT cells. After 24 h p.i. and 48 h p.i., we observed a diffuse cytopathic effect, manifesting as cell rounding, shrinking and lysis of individual cells. Interestingly, we did not observe large changes in the confluence of monolayer during the study. At 48 h p.i., the confluence has decreased to around 90% (Fig. 1A and B). Similar results were observed with cells infected with HHV-2 (data not shown).

The quantitative PCR analysis showed a statistically significant increase in the DNA copy number of analyzed viruses in comparison to the uninfected control (Fig. 1C). The highest, statistically significant, increase in the copy number of viral DNA was observed at 48 h p.i. with HHV-1 and HHV-2 (2.8 ± 1.01 × 10⁷ and 1.9 ± 1.31 × 10⁷ copies/ml, respectively; P <0.01). We also found a significant increase in the viral DNA copy number in the culture medium at 24 h p.i. and 48 h p.i., which was most probably the result of the release of progeny virions from the cell (Fig. 1C).

In uninfected HaCaT cells, the mitochondrial network was dense, branched and spread evenly throughout the cell (Fig. 2). We observed many tubular, long and highly interconnected mitochondria localized in the subcellular region and a small number of punctate mitochondria. Moreover, we observed fusion of mitochondria of dividing cells, which accumulated in close proximity to the chromosomes (Fig. 2A and D). In uninfected cells, we distinguished three types of mitochondrial shape: tubular (Fig. 2H), punctate (Fig. 2I) and branched mitochondrial network (Fig. 2 J).

HHV-1 and HHV-2 infection caused changes in the morphology of the mitochondrial network. At 2 h p.i., with both HHV-1 and HHV-2, we observed the interaction of viral particles with the mitochondrial network. The viral antigens were located near the cell nucleus (Fig. 3A), and interestingly, they partially colocalized with mitochondria (Fig. 3A XIII and XIV). At 24 h p.i. with HHV-1 (Fig. 3B), we observed changes in the shape of the mitochondrial network and its distribution within the cell in comparison to uninfected HaCaT cells. The mitochondrial network was organized near the nucleus. At the same time, we observed colocalization of some viral particles with mitochondria. Similar observations were made in the case of infection with HHV-2. After 48 h p.i. we observed an increase in viral replication. During HHV-1 infection, the mitochondrial network was completely fragmented. In the case of HHV-2 infection, after 48 h we observed accumulation of viral antigens within the cells. Moreover, a cytopathic effect in the form of plaques and multinucleated cells was also observed (Fig. 3B I and II).

Examples of cells selected for mitochondrial morphology analysis are shown in Fig. 4A-G’. At 2 h p.i., with HHV-1, we observed a decrease in the number of mitochondrial networks, together with an increase in the number of individual mitochondrial objects. In addition, both the percentage of cross-linked mitochondria and the length of the network branches decreased. Moreover, the total area of mitochondria decreased. At 24 h p.i., the number of mitochondrial objects increased, and we observed a decrease in the number of mitochondrial networks. We also observed a reduction in the total mitochondrial area. At 48 h p.i., we observed a significant increase in the number of mitochondrial objects. The mean number of branches per network was reduced at 2, 24, and 48 h p.i., but the results were not statistically significant. HHV-1 infection caused various changes in the morphology of the mitochondrial network in HaCaT cells. This analysis shows that the mitochondrial network underwent fission and was fragmented after infection (Fig 4H).

HHV-2 infection caused changes similar to those caused by HHV-1. We observed a gradual increase in the number of mitochondria, which reached a maximum at 48 h p.i. We also observed changes in mitochondrial cross-linking, as well as a decrease in the length of the mitochondrial branches, but these differences were statistically insignificant. At 24 and 48 h p.i., a statistically significant decrease in the overall mitochondrial surface area was observed (Fig. 4I).

We then investigated the distribution of Drp1 in HaCaT cells. In uninfected control cells, Drp1, as well as the mitochondrial network, was distributed evenly in the cytoplasm (Fig. 5A). After 24 h of treatment with Dynasore, which is an inhibitor of GTPases, we observed a decrease in the Drp1 level in treated cells and the presence of tubular mitochondria (Fig. 5B). During infection, we observed that Drp1 was partially translocated from the cytoplasm to the outer membrane of the mitochondria. After 2 h p.i., with both HHV-1 and HHV-2, we observed a colocalization of Drp1 with mitochondria localized in perinuclear area. After 24 h p.i. we observed a decrease in Drp1 protein expression in infected cells together with progressive disintegration of the mitochondrial network (Fig. 5C-F).

In this assay, changes in the mitochondrial potential that occurred during HHV-1 or HHV-2 infection were evaluated (Fig. 6A, C). Considering the pivotal role of mitochondria in orchestrating the apoptotic pathway, we measured the mitochondrial potential using the JC-1 method. The principle of the test depends on the fact that JC-1, a mitochondrial-potential-sensitive dye, accumulates in the matrix of mitochondria by forming J-aggregates with red fluorescence when the mitochondrial potential is high and becomes a monomer with green fluorescence when it is low. HaCaT cells treated with CCCP served as a positive control (Fig. 6A IV). In these cells, a low mitochondrial potential was observed. Cells treated with CCCP exhibited the characteristics of cells with dysfunctional mitochondria; JC-1 was present in the cytosol in its monomeric form, emitting green fluorescence. During infection with both HHV-1 and HHV-2 (2 and 24 h p.i.), we observed changes in mitochondrial potential. The most significant decrease was observed in HaCaT cells at 2 h p.i. However, at 24 h p.i., a decrease in the mitochondrial potential had also occurred, but it was not statistically significant and was similar to the values obtained with the negative control (Fig. 6A, C). It was also found that HHV-1 and HHV-2 infection caused a reduction in the vitality of HaCaT cells at 24 h p.i. (Fig. 6B and D). The decrease in vitality was more pronounced in the case of HHV-1 infection than after infection with HHV-2.