Identification of a new tospovirus causing necrotic ringspot on tomato in China

A virus (isolate 2009-GZT) was isolated from naturally infected tomato fruits exhibiting necrotic and concentric ring spots in Wengan County, Guizhou province, China in 2009. The virus was maintained in systemic hosts Nicotiana benthamiana and N. rustica and in local lesion host Chenopodium quinoa by mechanical inoculation as described previously [16].

TZSV-specific antiserum (produced in our laboratory) and ELISA kits for detection of GRSV/TCSV, INSV, IYSV, and TSWV (Agdia, Elkhart, Indiana, USA) were used in ELISA to test saps collected from symptomatic tomato fruits and plants inoculated with isolate 2009-GZT.

Crude plant saps, extracted from natural symptomatic tomato fruits and from plant leaves mechanically inoculated with isolate 2009-GZT, were stained with 2% Ammonium Molybdate for electron microscopy as previously described [16].

Total RNA was extracted from symptomatic tomato fruits using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The universal primer pairs (TospS-3 W:GC(a/t)GTTCCAGGGTT(a/g)CT(t/c/g)TC, and Tosp-3: AGAGCAATCGAGGCGCTAATAA) designed based on the 3ʹ-end sequences of S RNAs of the members of Watermelon silver mottle virus (WSMoV) were used to obtain the 3ʹ-end sequence of about 700 nt of 2009-GZT. The cDNA was synthesized using AMV reverse transcriptase (Promega, Madison, Wisconsin, USA). The primer pairs J13 and UHP were used to amplify the NSs and N genes following the protocols described previously [14],[19]. The RT-PCR products were purified with UNIQ-10 (Sangon, Shanghai, China) and then cloned into pGEM-T Easy (Promega, Madison, WI, USA). The recombinant clones were sequenced. Based on these sequences, the specific primers (GZ-S1: GTTCAGGACCACCACAAAGGGAT, and GZ-S6R: GCAATCTCTCTGAACAAGTA) were designed to amplify the remaining sequence of S RNA.

The complete sequence of 2009-GZT S RNA was assembled and analyzed with the aid of DNAMAN version 5.0 (Lynnon Biosoft, QC, Canada). Phylogenetic trees were constructed using the neighbor-joining method with 1000 bootstrap replications in MEGA 6.0 [20]. The sequences used for comparison were obtained from the GenBank database: NC_018071(Bean necrotic mosaic virus, BeNMV), NC_008301 (Capsicum chlorosis virus, CaCV), AY867502 (Calla lily chlorotic spot virus, CCSV), NC_003619 (Groundnut bud necrosis virus, GBNV), AF080526 (Groundnut chlorotic fan-spot virus, GCFSV), L12048 (Groundnut ringspot virus, GRSV), AF013994 (Groundnut yellow spot virus, GYSV), KC290943 (Hippeastrum chlorotic ringspot virus, HCRV), NC_003624 (Impatiens necrotic spot virus, INSV), AF001387 (Iris yellow spot virus, IYSV), EU275149 (Melon severe mosaic virus, MSMV), AB038343 (Melon yellow spot virus, MYSV), KF383956(Pepper chlorotic spot virus, PCSV), EF445397 (Polygonum ringspot virus, PolRSV), HQ728387 (Soybean vein necrosis associated virus, SVNaV), NC_002051(Tomato spotted wilt virus, TSWV), AY686718 (Tomato yellow ring virus, TYRV), NC_010489 (Tomato zonate spot virus, TZSV), EU249351 (Watermelon bud necrosis virus, WBNV), NC_003843 (Watermelon silver mottle virus, WSMoV) for S RNAs; GQ478668 (Alstroemeria necrotic streak virus, AlNSV), AF067068 (Chrysanthemum stem necrosis virus, CSNV), S54325 (Tomato chlorotic spot virus, TCSV), FJ946835 (Tomato necrotic ringspot virus, TNRV), and AF067069 (Zucchini lethal chlorosis virus, ZLCV) for N genes.

Tomato fruit samples showing necrotic ringspot and concentric ringspot symptoms were collected from Wengan County, Guizhou province, China in 2009 (Figure 1A). These samples were tested by ELISA with antisera against GRSV/TCSV, INSV, IYSV, TSWV, and TZSV, respectively. The symptomatic samples reacted with the antiserum against TZSV N protein. The virus isolate, 2009-GZT, was obtained via three consecutive single lesion transfer in C. quinoa and in systemically infected N. rustica after mechanical inoculation. Further infection studies were used to determine the experimental host range of 2009-GZT. Systemic infection was observed in C. annuum, D. stramonium, N. benthamiana, N. debneyi, N. rustica, N. tabacum and S. lycopersicum, with the infected plants showing leaf chlorosis, necrosis, ringspot and/or fruit deformation. Local lesion infection was found in C. amaranticolor, C. quinoa and N. glutinosa. The virus did not infect Cucumis sativus (Table 1). ELISA showed that samples from all infected plants reacted positively with the TZSV-antiserum, but did not react with GRSV/TCSV, INSV, IYSV and TSWV antisera.

Roughly spherical and enveloped virions of 80–100 nm in diameter, typical of tospoviruses, were observed in the saps collected from 2009-GZT-infected N. tabacum var Honghuadajinyuan by electron microscopy (Figure 1B).

The complete nucleotide sequence of the 2009-GZT S RNA contained 3012 nt (accession no. KM355773). It had NSs and N open reading frames (ORFs) in an ambisense orientation, separated by a 670 nt intergenic region (IGR) with an AU content of 72.9%. The 1380 nt NSs ORF, from nt 67 to 1446 of the viral RNA (vRNA) strand, potentially encoded a protein of 459 amino acids. The 828 nt N ORF, from nt 2112 to 2945 of the viral complementary RNA strand, potentially encoded a protein of 276 amino acids. The predicted molecular masses of NSs and N proteins were 51.6 kDa and 30.2 kDa, respectively. The 5′- and 3′-untranslated regions were 66 and 68 nt long, respectively.

The 2009-GZT S RNA sequence shared the highest (68.2%) and lowest (28.9%) nucleotide identities with those of CCSV and GYSV, respectively. The N gene and protein shared higher nucleotide (60.2-76.3%) and amino acid (69.9-85.8%), respectively, sequence identities with those of the WSMoV serogroup (WSMoV, CaCV, GBNV, WBNV, TZSV and CCSV) than with those of the IYSV serogroup (IYSV, TYSV, HCRV and PolRSV) (53.5-55.7% nucleotide and 46.1-48.9% amino acid identities). It shared relatively low nucleotide (36.1-45.3%) and amino acid (16.4-36.1%) identities with those of GYSV, GCFSV, INSV, and those of the TSWV serogroup members (Table 2).

The NSs gene shared relatively higher identities (58–76.3% nucleotide and 61.6-80.8% amino acid) with those of the WSMoV serogroup than those of the other tospoviruses (Table 2). The S RNA IGR sequence shared identities (40.3%-52.3%) with those of the other tospoviruses. Phylogenetic analyses showed that the 2009-GZT N and NSs proteins were closely related to those of CCSV and TZSV, thereby clustered into the WSMoV serogroup (Figure 2).