Identification of a novel nidovirus in an outbreak of fatal respiratory disease in ball pythons (Python regius)
verfasst von:
Lorenzo Uccellini, Robert J Ossiboff, Ricardo EC de Matos, James K Morrisey, Alexandra Petrosov, Isamara Navarrete-Macias, Komal Jain, Allison L Hicks, Elizabeth L Buckles, Rafal Tokarz, Denise McAloose, Walter Ian Lipkin
Respiratory infections are important causes of morbidity and mortality in reptiles; however, the causative agents are only infrequently identified.
Findings
Pneumonia, tracheitis and esophagitis were reported in a collection of ball pythons (Python regius). Eight of 12 snakes had evidence of bacterial pneumonia. High-throughput sequencing of total extracted nucleic acids from lung, esophagus and spleen revealed a novel nidovirus. PCR indicated the presence of viral RNA in lung, trachea, esophagus, liver, and spleen. In situ hybridization confirmed the presence of intracellular, intracytoplasmic viral nucleic acids in the lungs of infected snakes. Phylogenetic analysis based on a 1,136 amino acid segment of the polyprotein suggests that this virus may represent a new species in the subfamily Torovirinae.
Conclusions
This report of a novel nidovirus in ball pythons may provide insight into the pathogenesis of respiratory disease in this species and enhances our knowledge of the diversity of nidoviruses.
The online version of this article (doi:10.1186/1743-422X-11-144) contains supplementary material, which is available to authorized users.
Lorenzo Uccellini, Robert J Ossiboff contributed equally to this work.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
Conceived and designed the experiments: LU, RJO, DM, WIL. Performed the experiments: LU, INM, AP. Analyzed the data: LU, RJO, ALH, KJ, RT, WIL. Clinical and pathological examination of study cases: RJO, RDM, JKM, ELB. Contributed reagents/materials/analysis tools: DM, WIL. Wrote the paper: LU, RO, RT, WIL, and DM. All authors read and approved the final manuscript.
Abkürzungen
ssRNA
Single-stranded RNA
kb
Kilobases
H&E
Hematoxylin and eosin
PCR
Polymerase chain reaction
nt
Nucleotide.
Findings
Nidovirales is a large order of positive sense, single-stranded RNA (ssRNA) viruses that consists of the many genera and species in the families Coronaviridae, Arteriviridae, Roniviridae and Mesoniviridae. Although the genomes of nidoviruses vary in length, ranging from 13 to 32 kilobases (kb), the organization of the genomes are similar across the entire order [1‐4]. The 5′ end of the genome encodes two replicase polyproteins (pp1a and pp1ab), structural proteins and accessory proteins. Genes downstream of the replicase polyprotein gene are expressed from a nested set of 3′-coterminal subgenomic mRNAs, a replication strategy unique to the Nidovirales[5‐7].
Nidoviruses infect a broad range of hosts including humans and other mammals, birds, fish, insects and crustaceans [8‐11]. Although reptiles are susceptible to infection by a wide variety of viruses (as reviewed in [12]), nidovirus infections have not previously been described. Viruses affecting the reptile respiratory tract include herpesviruses [13], iridoviruses [14], adenoviruses [15], flaviviruses [16], and, of particular importance in snakes, paramyxoviruses [17] and reoviruses [18].
Anzeige
Here we report the discovery of a novel nidovirus in a collection of ball pythons (Python regius) in upstate New York with pneumonia, tracheitis and esophagitis. The snakes were found dead between July 2011 and September 2013.
Gross postmortem examination was performed on 4 snakes. Snake 1, a 6-year-old, female piebald color morph ball python, was submitted in July of 2011. Snake 2, a 6-year-old, male lesser platinum color morph ball python, was submitted in December of 2011. Snake 3, a 3-year-old female paradox color morph ball python, and snake 4, a 7-year-old female pastel color morph ball python, were submitted in September 2013. After gross evaluation, samples of tissues were collected and saved in 10% neutral buffered formalin, routinely processed and mounted in paraffin. Five μm paraffin ribbons were cut and stained with either hematoxylin and eosin (H&E) or Gram’s stain for histologic examination. Eleven tissues, including lung (n = 4), liver (n = 1), spleen (n = 3) and esophagus (n = 3) from the 4 snakes were collected and stored at −20°C.
Gross and histologic findings in all four snakes were primarily restricted to the respiratory and upper gastrointestinal tracts (Table 1). Hematoxylin and eosin stained sections (Figure 1A through F) revealed marked hyperplasia of epithelial cells lining air exchange areas (pneumocytes) with significant mononuclear (lymphocytes and plasma cells) and granulocytic (heterophils) interstitial inflammation and epithelial necrosis (Figure 1B). Similar inflammatory and hyperplastic changes were also present in the trachea (Figure 1D), esophagus (Figure 1F) and oral cavity. Gram-negative stained bacteria are shown in lung tissue from a snake with bacterial bronchopneumonia (Figure 1H).
Table 1
Pathologic and molecular findings in ball pythons (Python regius) with nidoviral-associated disease
Inflammationa
PCRb
ISHc
Snake
Lung
Trachea
Nasal Cavity
Esophagus
Oral Cavity
Liver
Spleen
Kidney
Lung
Spleen
Esophagus
Trachea
Liver
Lung
1
+, H
+, H
+
+, H
+
-
-
-
+
+
NT
NT
NT
+
2
+
+
+
+, H
+
Nec
-
-
+
+
+
NT
NT
+
3
+
+
NE
NE
+
-
Nec
-
NA
+
NA
NT
+
NT
4
+
+
NE
NE
+
-
NE
-
+
NT
NT
+
NT
NT
aH, epithelial hyperplasia; NE, Not examined; Nec, Necrosis.
bNT, Not tested.
cISH, In Situ Hybridization; NT, Not tested NA, not available.
+, PCR Positive.
-, PCR Negative.
×
Total nucleic acids were extracted from snake samples (lung and spleen for snake 1, lung, spleen and esophagus for snake 2, spleen and liver for snake 3, lung and trachea for snake 4) using the EasyMag (bioMérieux, Inc.) platform; Samples from snakes 1 and 2 were depleted of ribosomal RNA (Ribo-Zero™ rRNA Removal, Epibio) and treated with DNAse I (TURBO DNA-free™, Ambion). cDNA synthesis was performed using SuperScript II first-strand synthesis supermix (Invitrogen). Viral discovery was performed using broadly reactive consensus PCR assays targeting common respiratory viruses of animals, including paramyxoviruses [19‐21], reoviruses [16] and caliciviruses [22]. When PCR analysis failed to yield a causative agent, high-throughput sequencing was performed on all samples originating from snakes 1 and 2 (Ion PGM, Life Sciences). On average, 850,000 reads were obtained from each sample. All reads were processed by trimming primers and adaptors, length filtering, and masking of low-complexity regions (WU-BLAST 2.0). To remove host sequences, the remaining reads were subjected to a homology search using BLASTn against a database consisting of ribosomal and genomic metazoan sequences. Following the processing, an average of 250,000 reads per sample remained for further analysis.
Anzeige
Nucleotide sequence analysis (BLASTn) of processed reads was uninformative; however, amino acid analysis (BLASTx) revealed multiple reads with amino acid homology of <50% to the polyprotein region of the Nidovirales subfamily Torovirinae, including Breda virus, White bream virus, and Fathead minnow virus. Assembly of all Torovirinae-like reads generated a 3,408 nt contig with 33% amino acid homology to the replicase polyprotein 1ab of Fathead minnow virus. The presence of this 3,408 nt sequence in both snakes was confirmed by PCR using primers shown in Table 2. Cycling conditions are described in a footnote to Table 2. Samples from multiple tissues of snakes 3 and 4 were also screened and tested positive for this virus.
Table 2
Sequences of primers used to amplify the 3,408 fragment of ball python Nidovirus
Primer name*
Sequence 5′ – 3′
Nucleotide position
BPNV 1Fwd BPNV 1Rev
ACCTGCTACCGATGTCCAAG GTCGTTGTTGGCTGAGTGTG
1-963
BPNV 2Fwd BPNV 2Rev
TTCAAGCGAACCAAGTTCATCC TCTTGGACATCGGTAGCAGG
718-1485
BPNV 3Fwd BPNV 3Rev
AACATCCTCGACAACGCAGG ACGTAGTCTTGCCAGTTCCC
1446-1647
BPNV 4Fwd BPNV 4Rev
CCACAACCCGACAGTCAGTA GTACGTAGTCTTGCCAGTTCC
1456-2154
BPNV 5Fwd BPNV 5Rev
GGCACAGTAACAGCACAACG GTACTGCAAGATGCCGTTGC
2152-3030
BPNV 6Fwd BPNV 6Rev
GTGACTACACGAAATGCGACC GTCAAACATGAAAGCGTGCG
2995-3131
BPNV 7Fwd BPNV 7Rev
GTCGTCAACTTGTCCCACCA CTGCCATGCTACGGAAGACT
3088-3408
*PCR cycling conditions: 95°C for 10 minutes followed by 35 cycles of 95° C for 30 seconds, 55°C for 30 seconds, 72°C for 1 minute, except primer pair BPNV 1 and BPNV 6 where annealing temperature was 53°C.
For phylogenetic analysis, the 3,408 nt sequence was translated with Se-Al v2.0a11, and a 1,136 amino acid fragment was aligned against all Nidovirales sequences from GenBank using ClustalW. The best-fit model of amino acid substitution, the Whelan and Goldman (WAG) matrix, was selected using the maximum likelihood method implemented in MEGA version 5.2 [23]. A Bootstrap-supported (1000 replicates) maximum likelihood phylogenetic tree was constructed using MEGA version 5.2. The ball python-associated virus clustered within the Torovirinae subfamily (Figure 2). A neighbor-joining phylogenetic method was also implemented with congruent results. Based on the phylogenetic position and the genetic distances between species, this virus, tentatively called ball python nidovirus (BPNV, GenBank accession number KM267236) may represent a new species within the subfamily Torovirinae. In situ hybridization to a 934 nt fragment of the genomic polyprotein 1ab region was used to assess viral infection and distribution in the lung tissue. Positive cytoplasmic staining, consistent with the presence of viral nucleic acid, was confirmed in the cytoplasm of pulmonary cells, presumably epithelial cells (Figure 3A). The specificity of probes for in situ hybridization was confirmed by the absence of signal when the same probe was used on control pulmonary tissue from an uninfected, 6-year-old, female ball python maintained at College of Veterinary Medicine, Cornell University (Figure 3B).
×
×
Respiratory disease can be an important cause of morbidity and mortality in both wild and captive reptiles. In captivity, reptiles, and particularly snakes, are frequently maintained in collections with a high population density in relatively small spaces. As such, disease transmission within collections can occur rapidly, and early detection and diagnosis is critical in controlling disease spread.
Although 8 of 12 snakes with disease in the collection showed gram-negative rods by Gram stain and follow up culture in 4 revealed the presence of Aeromonas sp., Pseudomonas sp., Serratia sp., no evidence of bacterial infection was found in 4 snakes. In contrast, all snakes with epithelial hyperplasia in the trachea, lung and esophagus and mononuclear inflammatory infiltrates had viral signal by PCR and ISH. In concert, these data suggest a role for this nidovirus in the pathogenesis of respiratory disease. However, unequivocal implication will require experimental infection studies.
The identification of this novel nidovirus expands our understanding of nidoviral diversity and provides insight into the pathogenesis of respiratory disease in snakes. Phylogenetic analysis indicated that the virus belongs to a novel genus within the Torovirinae subfamily distinct from the Torovirus and recently characterized Banifivirus genera [24]. Due to overlapping clinical signs and pathologic lesions of the newly discovered nidovirus with the best characterized viral respiratory pathogens of snakes, paramyxoviruses and reoviruses [17, 18], it is possible that nidoviral infections were previously misdiagnosed or overlooked. PCR-based detection methods to rapidly determine infection status and etiology of respiratory disease in snakes are recommended to guide decisions for managing husbandry and veterinary care.
Availability of supporting data
The data set supporting the results of this article is included within the article.
Acknowledgements
The authors would like to thank the following: Simon Williams; Raja Duraisamy; Simon J. Antony; Nischay Mishra; Sandra Abel Nielsen; Ingrid Lombardino, Andrew Cushing, Emi Knafo, Rebecca Eddy and Danielle Tarbert for clinical assistance, case submissions and case organization; Ellie Kahn for manuscript preparation; Don Schlafer, Gerald Duhamel, Brian Caserto, Julia Rodriguez-Ramos Fernandez, Heather Daverio, Kim Bonner, Gavin Hitchener, Laura Coffee, Allan Pessier and Scott Terrell for assistance with postmortem evaluation/consultation; Martin Slade and the Cornell University College of Veterinary Medicine Histopathology Laboratory for processing of histologic preparations and sample shipping; and the owner of the snakes for allowing the characterization of this potential pathogen. Lorenzo Uccellini was supported by an American-Italian Cancer Foundation Post-Doctoral research Fellowship. Support for work at the Center for Infection and Immunity comes from the National Institutes of Health (U19 AI109761 - Center for Research in Diagnostics and Discovery) and USAID PREDICT.
While this manuscript was in preparation, Bodewes et al. reported detection of a similar nidovirus in another species, Python molurus: Bodewes R, Lempp C, Schürch A, Habierski A, Hahn K, Lamers M, von Dörnberg K, Wohlsein P, Drexler JF, Haagmans B, Smits SL, Baumgärtner W, Osterhaus AD: Novel divergent nidovirus in a python with pneumonia. J Gen Virol 2014. Epub ahead of print.
Anzeige
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
The authors declare that they have no competing interests.
Authors’ contributions
Conceived and designed the experiments: LU, RJO, DM, WIL. Performed the experiments: LU, INM, AP. Analyzed the data: LU, RJO, ALH, KJ, RT, WIL. Clinical and pathological examination of study cases: RJO, RDM, JKM, ELB. Contributed reagents/materials/analysis tools: DM, WIL. Wrote the paper: LU, RO, RT, WIL, and DM. All authors read and approved the final manuscript.
Identification of a novel nidovirus in an outbreak of fatal respiratory disease in ball pythons (Python regius)
verfasst von
Lorenzo Uccellini Robert J Ossiboff Ricardo EC de Matos James K Morrisey Alexandra Petrosov Isamara Navarrete-Macias Komal Jain Allison L Hicks Elizabeth L Buckles Rafal Tokarz Denise McAloose Walter Ian Lipkin
Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.
Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.
Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.
Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.
Update Innere Medizin
Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.