Introduction
Toll-like receptors (TLRs) and interleukin-1 receptors (IL-1Rs) are involved in the production of various cytokines that are associated with the innate immune response against many different infectious agents. TLRs and IL-1Rs share many structural similarities and utilize common downstream adaptive molecules after activation by their ligands. In general, these innate immune responses induced by TLRs and IL-1Rs are known to play a protective role against various microbes [
1]. However, several recent studies have indicated that these signals may also play a pathogenic role in viral infections [
2‐
4]. In addition to TLRs, IL-1Rs are also considered to be important innate receptors because IL-1β, in particular, is a prominent cytokine that appears in the early stage of microbial infections [
3]. The IL-1R family contains six receptors, including IL-1RI, which recognizes the principal inflammatory cytokine IL-1β and the less inflammatory cytokine IL-1α [
1,
5]. IL-1β is generated from the cleavage of pro-IL-1β by caspase-1 in inflammasomes after infections, and the downstream signaling cascade of the IL-1β-IL-1R interaction leads to the induction of various proinflammatory cytokines and the activation of lymphocytes [
6]. IL-1β-deficient mice show broad host susceptibility to various infections [
7,
8]. Moreover, IL-1RI-deficient mice are susceptible to certain pathogens, including
Listeria monocytogenes[
1]. Therefore, these responses to IL-1β are apparently critical for protection from many types of viruses and microbes. However, the level of IL-1β has also been linked to many different inflammatory autoimmune diseases, including diabetes, lupus, arthritis, and multiple sclerosis (MS) [
1,
4].
Theiler’s murine encephalomyelitis virus (TMEV) is a positive-stranded RNA virus in the
Picornaviridae family [
9]. TMEV establishes a persistent CNS infection in susceptible mouse strains that results in the development of chronic demyelinating disease, and the system has been studied as a relevant viral model for human multiple sclerosis [
10‐
12]. Cells infected with TMEV produce various proinflammatory cytokines, including type I IFNs, IL-6 and IL-1β [
13]. TLR3 and TLR2 are involved in the production of these cytokines following infection with TMEV [
14,
15]. In addition, melanoma differentiation-associated gene 5 and dsRNA-activated protein kinase R are known to contribute to the production of proinflammatory cytokines [
14,
16]. These pathways also induce activation of caspase-1, leading to the generation of IL-1β and IL-1α, which contribute to further cytokine production, such as IL-6 promoting the development of pathogenic Th17 cells. Because IL-1β signals are associated with both host protection from viral infections and pathogenesis of inflammatory immune-mediated diseases, we here investigated the role of IL-1β-mediated signals in the development of TMEV-induced demyelinating disease.
We have previously reported that Th17 cells preferentially develop in an IL-6-dependent manner after TMEV infection, and that Th17 cells promote persistent viral infection and induce the pathogenesis of chronic demyelinating disease [
17]. In addition, our earlier studies indicated that administration of either lipopolysaccharide (LPS) or IL-1β, thereby inducing high levels of IL-6 production, into resistant C57BL/6 (B6) mice renders the mice susceptible to the development of TMEV-induced demyelinating disease [
18]. These results suggest that an excessive level of IL-1β is harmful to TMEV-induced demyelinating disease by generating high levels of pathogenic Th17 cells [
19]. In this study, we confirmed the role of excessive IL-1β in the generation of a high level of Th17 cells in resistant B6 mice, supporting the pathogenic mechanisms of IL-1β. Furthermore, we have also utilized IL-1R-deficient mice to investigate the role of IL-1β-mediated signaling in the development of TMEV-induced demyelinating disease. Our results indicate that the lack of IL-1 signaling in resistant B6 mice also induced TMEV-induced demyelinating disease. The initial deficiencies in T cell function, including cytokine production and high viral persistence in the late stage of viral infection, were found in IL-1R-deficient mice. Therefore, the presence of an excessive amount of IL-1 plays a pathogenic role by elevating pathogenic Th17 responses, whereas the lack of IL-1 signals promotes viral persistence in the spinal cord, leading to chronic immune-mediated inflammatory disease.
Materials and methods
Animals
Female C57BL/6 mice were purchased from the Charles River Laboratories (Charles River, MA, USA) through the National Cancer Institute (Frederick, MD). Female B6.129S7-Il1r1
tm1Imx
/J mice (IL-1R knockout (KO)) were purchased from Jackson Laboratories (Bar Harbor, ME, USA). These mice were housed in the Animal Care Facility of Northwestern University. Experimental procedures that were approved by the Animal Care and Use Committee (ACUC) of Northwestern University in accordance with NIH animal care guidelines were used in this study.
Synthetic peptides and antibodies
All peptides used were purchased from GeneMed (GeneMed Synthesis Inc, CA, USA) and used as described previously [
20]. All antibodies used were purchased from BD Pharmingen (San Diego, CA, USA).
Virus
The BeAn strain of TMEV was generated, propagated, and titered in BHK-21 cells grown in Dulbecco’s modified Eagle medium supplemented with 7.5% donor calf serum as previously described [
21]. Viral titer was determined by plaque assays on BHK cell monolayers.
Viral infection of mice and assessment of clinical signs
For intracerebral (i.c.) infection, 30 μl virus solution, containing 1×106 pfu, was injected into the right cerebral hemisphere of 6 to 8 week-old mice (n = 10 per group) anesthetized with isoflurane. Clinical symptoms of disease were assessed weekly on the following grading scale: grade 0 = no clinical signs; grade 1 = mild waddling gait; grade 2 = severe waddling gait; grade 3 = moderate hind limb paralysis; grade 4 = severe hind limb paralysis and loss of righting reflex.
Reverse-transcriptase PCR and real-time PCR
Total cellular RNA from the brain and spinal cord of infected SJL/J mice was isolated using Trizol® Reagent (Invitrogen, CA, USA). First-strand cDNA was synthesized from 1 μg total RNA utilizing SuperScript® III First-Strand Synthesis Supermix or M-MLV (Invitrogen). The cDNAs were amplified with specific primer sets using the SYBR Green Supermix (Bio-Rad) on an iCycler (Bio-Rad). Primers for control GAPDH and cytokine genes were purchased from Integrated DNA Technologies. GAPDH: forward primer, AACTTTGGCATTGTGGAAGG and reverse primer, ACACATTGGGGGTAGGAACA; VP-1: TGACTAAGCAGGACTA-TGCCTTCC and CAACGAGCCACATATGCGGATTAC; IFN-α: (5’-ACCTCCTCT-GACCCAGGAAG-3’ and 5’-GGCTCTCCAGACTTCTGCTC-3’); IFN-β: CCCTAT-GGAGATGACGGAGA and CTGTCTGCTGGTGGAGTTCA; CXCL10: (5’-AAGT-GCTGCCGTCATTTTCT-3’ and 5’-GTGGCAATGATCTCAACACG-3’); IL-10: GCCAAGCCTTATCGGAAATGATCC and AGACACCTTGGTCTTGGAGCTT; IFN-γ: ACTGGCAAAAGGATGGTGAC and TGA GCTCATTGAATGCTTGG; IL-17A: CTCCAGAAGGCCCTCAGACTAC and AGCTTTCCCTCCGCATTGACACAG; IL-6: AGTTGCCTTCTTGGGACTGA and TCCACGATTTCCCAGAGAAC; TNF-α: GGTCACTGTCCCAGCATCTT and CTGTGAAGGGAATGGGTGTT.
Isolation of CNS-infiltrating mononuclear cells (MNCs)
Mice were perfused with sterile Hank’s balanced salt solution (HBSS), and excised brains and spinal cords of 3 mice per group were homogenized. CNS-infiltrating MNCs were then enriched in the one third bottom fraction of a continuous Percoll (Pharmacia, Piscataway, NJ, USA) gradient after centrifugation for 30 minutes at 27,000
g as described previously [
22].
Flow cytometry
CNS-infiltrating lymphocytes were isolated, and Fc receptors were blocked using 100 μL of 2.4G2 hybridoma (ATCC) supernatant by incubating at 4°C for 30 minutes. Cells were stained with anti-CD8 (clone 53–6.7), anti-CD4 (clone GK1.5), anti-CD11b (clone M1/70), anti-NK1.1 (clone PK136), anti-GR-1 (clone RB6-8C5) and anti-CD45 (clone 30-F11) antibodies. All antibodies used for flow cytometry were purchased from BD Pharmingen (San Diego, CA). Cells were analyzed using a Becton Dickinson LSRII flow cytometer.
Intracellular staining of cytokine production
Freshly isolated CNS-infiltrating MNCs from three mice per group were cultured in 96-well round-bottom plates in the presence of the relevant or control peptide as previously described [
23]. Allophycocyanin-conjugated anti-CD8 (clone Ly2) or anti-CD4 (clone L3T4) antibodies and a PE-labeled rat monoclonal anti-IFN-γ (XMG1.2) antibody were used for intracellular cytokine staining. Cells were analyzed on a Becton Dickinson FACS Calibur or LSRII cytometer. Live cells were gated based on light scattering properties.
T cell proliferation assay
Splenocytes from TMEV-infected mice, CD4+ T cells from spleens of OTII mice stimulated with specific epitope peptide, or in vitro TMEV-infected peritoneal macrophages in the presence of 2 μM ovalbumin (OVA)-specific peptides or 100 μg OVA protein were used. Cultures were incubated in 96-well flat-bottomed microtiter plates for 72 h and then pulsed with 1.0 μCi [3H]TdR and harvested 18 h later. [3H]TdR uptake by the cells was determined in triplicate using a scintillation counter and expressed as net counts per minute (Δcpm) ± standard error of the mean (SEM) after subtraction of the background count of cultures with PBS instead of stimulators.
Histopathological analyses
At 70 days post-infection, mice were anesthetized and perfused via intracardiac puncture with 50 mL of PBS. Brain and spinal cords from IL-1R KO and B6 control mice were dissected and fixed in 4% formalin in PBS for 24 h. Anterior cortex (bregma: 3.0 to 2.0 mm), subventricular zone (bregma: 1.7 to 0.48), hippocampus (bregma: -1.0 to −2.5 mm), and cerebellum (bregma: -5.6 to −7.0 mm) were investigated. In addition, cervical, thoracic, and lumbar regions of the spinal cord were also examined. The tissues were embedded in paraffin for sectioning and staining. Paraffin-processed brains and spinal cords were sectioned at 6 μm. Adjacent sets of three sections from each animal were deparaffinized, rehydrated, and evaluated by H & E staining for inflammatory infiltrates, Luxol Fast Blue (LFB) staining for axonal demyelination, and Bielschowsky silver staining for axon loss. Slides were examined using a Leica DMR light microscope, and images were captured using an AxioCam MRc camera and AxioVision imaging software. The inflammatory infiltrates were evaluated by the presence or absence of the monocytes/lymphocytes based on the H & E staining and immunofluorescent staining of CD45+ cells. Histologic white matter demyelination was graded as: 1) normal myelination, 2) mild or minor demyelination (> 50% myelin staining preserved), or 3) moderate to severe demyelination (< 50% myelin staining preserved).
ELISA
Cytokine levels produced by splenocytes from TMEV-infected mice or CD4+ T cells from spleens of OTII mice were determined after stimulation with specific epitope peptides (2 μM each), or in vitro TMEV-infected peritoneal macrophages in the presence of OVA-specific peptide (2 μM) for 72 h, respectively. IFN-γ (OPTEIA kit; BD Pharmingen), IL-17 (R&D Systems, Minneapolis, MN, USA) levels were assessed. Plates were read using a Spectra MAX 190 microplate reader (Molecular Devices, Sunnyvale, CA, USA) at a 450 nm wavelength.
Statistical analysis
Data were presented as mean ± SD of either two to three independent experiments or one representative of at least three separate experiments. The significance of differences in the mean values was determined by Student’s t-test. Clinical scores were analyzed by Mann–Whitney U-test. P values < 0.05 were considered statistically significant.
Discussion
TMEV-infection in susceptible strains of mice induces chronic demyelinating disease that is primarily mediated by CD4
+ T cells [
17,
30,
31]. However, epitope-specific CD4
+ T cells can be protective or pathogenic depending on when activated T cells are available in conjunction with viral infection [
23,
32,
33]. Interestingly, the level of IL-1β, induced following infection with TMEV, plays an important role in the pathogenesis of TMEV-induced demyelinating disease [
18,
34]. Previously, it has been shown that administration of IL-1 to mice exacerbates the development of experimental autoimmune encephalomyelitis (EAE), the pathogenic immune mechanisms of which are similar to those of TMEV-induced demyelinating disease [
35‐
37]. In addition, IL-1 appears to directly activate astrocytes and microglia to exacerbate neurodegeneration in non-immune-mediated diseases [
38]. Because IL-1β is induced via the innate immunity mediated by various TLRs and because the downstream IL-1 signals mediated via IL-1R also play an important role in the host defense [
1,
4], we have investigated the role of IL-1β signals in the development of TMEV-induced demyelinating disease by assessing the effects of IL-1β administration and using IL-1R-deficient mice.
We have previously demonstrated that administration of IL-1β into resistant B6 mice renders the resistant mice susceptible to TMEV-induced demyelinating disease [
18]. The administration of IL-1β dramatically increased the level of IL-17 production in the CNS of the resistant mice, which do not produce a high level of Th17 cells following TMEV infection (Figure
1). This result is consistent with recent reports that IL-1β strongly promotes the development of IL-17-producing Th17 cells either directly or via the production of IL-6 [
19,
39]. The presence of high levels of IL-17A in mice infected with TMEV exerts a strong pathogenic role by inhibiting the apoptosis of virus-infected cells, blocking cytolytic CD8
+ T cell function, and elevating cellular infiltration to the CNS [
17]. Recently, it was also shown that the presence of FoxP3
+ Treg cells that preferentially expand due to stimulation by IL-1β [
40] is not beneficial for the development of TMEV-induced demyelinating disease; hence, these regulatory cells inhibit the protective anti-viral immune responses [
41]. Therefore, administration of IL-1β, resulting in a higher level of IL-1β, appears to promote the pathogenesis of TMEV-induced demyelinating disease in resistant B6 mice by elevating pathogenic Th17 and Treg responses to TMEV antigens. In addition, it is known that IL-1 directly activates astrocytes and microglia in the CNS [
42], which are associated with the pathogenesis of TMEV-induced demyelinating disease [
13,
43]. Furthermore, IL-1 mediates the loss of astroglial glutamate transport and drives motor neuron injury in the spinal cord during viral encephalomyelitis [
44]. The expression of IL-1R1 is upregulated in glial cells following TMEV infection [
45], and thus the elevated receptor expression is likely to exert the detrimental effects seen as a result of IL-1 signaling on neurodegeneration and/or pathogenic immune responses.
In the absence of IL-1R1-mediated signals, resulting from engagements with the predominant cytokine IL-1β and weak cytokine IL-1α, strongly resistant B6 mice become susceptible to the development of TMEV-induced disease (Figure
2). Viral loads in the spinal cord are higher in the absence of IL-1R signals, suggesting that the presence of IL-1 signaling plays an important role in controlling viral persistence during the course of TMEV infection. The high viral loads also accompanied higher cellular infiltration into the CNS. Histopathological examinations of the virus-infected IL-1R-deficient B6 mice confirmed the elevated lymphocyte infiltration, demyelination and axonal losses in the CNS compared to control B6 mice (Figure
3). These results are consistent with previous reports indicating that either IL-1β- or IL-1RI-deficient mice are susceptible to various infections [
1,
7,
8,
46]. These results collectively suggest that either an abnormally high level of IL-1β or the absence of IL-1-mediated signals lead to high viral loads and cellular infiltration to the CNS, resulting in the elevated development of TMEV-induced demyelinating disease. Therefore, a fine balance of IL-1β-mediated signaling appears to be important for protection from viral infections. It is also interesting to note that this viral model for MS is markedly different from the EAE model, which is not associated with microbial infections, in that a deficiency of IL-1R1 significantly reduces the development of demyelinating disease [
37].
Despite many previous studies on the role of IL-1β signaling in viral infections, the underlying mechanisms of the signals involved in the protection from infection remain unclear. Previously, it has shown that IL-1-mediated signals augment T cell responses by increasing cellular infiltration, as well as upregulating cytokine production and co-stimulatory molecule expression in APCs [
5,
47,
48]. However, our results showed that the cellular infiltration is elevated in IL-1R1 KO mice during the early stages of viral infection (Figure
2), although the anti-viral CD4
+ T cell responses in the CNS of virus-infected IL-1R KO mice are lower without compromising either peripheral CD4
+ T cell responses (Figure
5) or CNS CD8
+ T cell responses (Figure
6). These results suggest that the APCs associated with CD4
+ T cell responses in the CNS are primarily affected by the absence of IL-1-mediated signaling. Our previous studies strongly suggested that primarily the microglia and, to a certain extent, astrocytes, harbor viral loads and play important roles in the stimulation of the level and type of the CD4
+ T cell response [
43]. In addition, it is known that IL-1 signaling affects the function of these cell types [
42]. Therefore, it is most likely that these cells play an important role in the development of anti-viral CD4
+ T cell responses in the CNS during the early stage of viral infection. Because the cytokine production profile of APCs is altered in the absence of IL-1 signaling, perhaps due to the elevated expression of inhibitory molecules (Figure
7), similar mechanisms by CNS APCs may negatively affect the initial development and/or function of anti-viral T cells following viral infection. Regarding the underlying mechanisms, it is currently unclear how the deficiency in IL-1 signals enhances the expression of inhibitory molecules in APCs. However, we have observed that APCs from susceptible SJL mice expressed significantly higher levels of these molecules upon viral infection either
in vitro or
in vivo compared to cells from resistant B6 mice (data not shown), suggesting that the viral load may lead to the elevated expression. Therefore, it is most likely that the absence of IL-1 signals permits the initial elevation of viral load (Figure
4), and the higher viral load, in turn, leads to an eventual compromise in the efficiency of anti-viral T cell responses and functions. In contrast, the presence of excessive IL-1 signals preferentially triggers T cell responses that are unfavorable for the protection of the hosts from chronic viral persistence and the pathogenesis of demyelinating disease, as previously seen [
17,
19].
Competing interests
The authors declare that they have no competing interests.
Authors’ contribution
BSK directed experiments, interpreted the results and wrote the manuscript. YHJ conducted immunological experiments and helped writing. LM conducted histological experiments and wrote the corresponding portions. HSK performed some molecular analyses. WH and HSP conducted the initial immunological experiments. CSK contributed for the interpretation of results and direction of the study. All authors read and approved the final manuscript.