Skip to main content
Erschienen in: Reproductive Biology and Endocrinology 1/2011

Open Access 01.12.2011 | Research

In vitroeffects of relaxin on gene expression in porcine cumulus-oocyte complexes and developing embryos

verfasst von: Jean M Feugang, Jonathan M Greene, Scott T Willard, Peter L Ryan

Erschienen in: Reproductive Biology and Endocrinology | Ausgabe 1/2011

Abstract

Background

Relaxin hormone peptide is found in porcine follicular and utero-tubal fluids, but its possible actions during early embryo development are still undetermined. Here, we investigated the effects of porcine relaxin during oocyte maturation and embryo development, and gene expression in the pig.

Methods

Immature cumulus-oocyte complexes (COCs) were obtained from ovarian follicles of sows. In experiment 1, COCs were matured in the presence of 0, 20, or 40 ng relaxin/ml, or 10% (v/v) porcine follicular fluid. In experiment 2, COCs were in vitro matured, fertilized and resulting embryos were cultured in the presence of 0, 20, or 40 ng relaxin/ml. In experiment 3, COCs were matured in the presence of 40 ng relaxin/ml, fertilized and zygotes were cultured as indicated in experiment 2. We evaluated the proportions of matured oocytes in experiment 1, cleaved and blastocysts on Day 2 and Day 7 post insemination in all experiments. The total cell number of blastocysts was also evaluated. In parallel, transcription levels of both relaxin and its receptors (RXFP1 and RXFP2), as well as a pro- (Bax) and anti- (Bcl2-like 1) apoptotic-related genes were determined. All data were analyzed by ANOVA and significant differences were fixed for P < 0.05.

Results

In experiment 1, relaxin significantly increased the proportions of matured oocytes and cleaved embryos, as well as the expression level of RXFP2 mRNA compared to RXFP1 (P < 0.05). There was no effect on endogenous expression of relaxin and Bcl2-like1/Bax ratios. In all experiments, relaxin did not affect the proportions of blastocysts, but did significantly increase their total cell numbers (P < 0.05). Furthermore, no effect of relaxin was observed on Bcl2-like1/Bax expression ratios, which were similar between groups.

Conclusions

Exogenous relaxin influences its own receptors expression, improves oocyte nuclear maturation. Its beneficial effect on total cell number of blastocysts appears to be through a Bcl2-like1/Bax-independent mechanism.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1477-7827-9-15) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

JMF conceived and performed all the experiments, and wrote the first draft of the manuscript. JMG contributed to the in vitro embryo production. STW and PLR contributed to the design of the study, revised and approved the manuscript. All authors read and approved the final manuscript.

Background

Gene expression is one of the major events occurring during oocyte maturation and early embryo development, and its perturbation in culture system may contribute to the limited production of high quality blastocysts [13]. Numerous strategies such as low oxygen tension during culture, co-culture, and utilization of simple or complex media supplemented with various molecules have been developed to improve embryo culture efficiencies [1, 46]. These molecules such as relaxin are generally found in the vicinity of oocytes and embryos. Relaxin is a peptide hormone found at higher levels in follicular fluids and genital tract secretions of various species [711]. Despite its pleiotropic roles reported in various reproductive and non-reproductive tissues [1113], little is still known on embryonic effects of relaxin during early pregnancy.
In livestock, the pig is the primary animal model used for the study of relaxin effects [11, 14, 15] due to the important production of relaxin in both pregnant and non-pregnant pigs. Indeed, pigs exhibit high levels of relaxin in ovarian follicular fluids [8, 14], and its secretions by corpora lutea and uterine cells significantly increase during the post-ovulatory period [11, 14, 1618]. Numerous studies have reported various actions of relaxin on pig reproductive tissues such as cervical and uterine tissues, including modulation of embryo implantation during pregnancy in rats [1921]. Despite these physiological conditions, it is not known whether relaxin influences oocyte maturation and/or embryo development in the pig.
Relaxin hormone peptide exerts autocrine, endocrine, and paracrine effects through membrane receptors known as RXFP1 and RXFP2 [2224]. These receptors have been detected in porcine reproductive tissues [25, 26], including oocytes and embryos [27]. But, their potential activation by relaxin and further implications on oocyte maturation and embryo development are still unknown.
From this background, the present study aims to bring more insight into the biological functions of relaxin during early pregnancy using pigs as experimental models. We evaluated the effect of relaxin on the proportion of oocytes resuming nuclear maturation and on embryo development, as well as the total cell number of blastocysts. We determined the effects of relaxin on endogenous relaxin, RXFP1, RXFP2, and pro- (Bax) and anti- (Bcl2-like1) apoptotic-related genes expressions in porcine oocytes and in vitro produced embryos.

Methods

Unless otherwise indicated, all chemicals and reagents were purchased from Sigma-Aldrich (Saint Louis, MO, USA) for embryo production or Invitrogen Co. (Carlsberg, CA, USA) for gene expression. Lyophilised relaxin hormone (pRLN) produced from pregnant sow ovaries was a gift from Dr. C Bagnell [15]. It was dissolved in deionized water (10 μg/ml), aliquoted, and stored as stock solution at -80°C. Pre-warmed solutions of NaCl (0.9%; w/v) and Hepes-buffered Tyrode Lactate solution (Vigro-Bioniche, Pullman, WA, USA) supplemented with polyvinyl alcohol (PVA: 0.1%; w/v) and pyruvate (100 μM) were used to wash the ovaries, and the oocytes and the embryos, respectively. Oocytes were matured in TCM199+L-glutamine medium supplemented with PVA (1%; w/v), glucose (2.8 mM), pyruvate (0.91 mM), cysteamine (0.57 mM), EGF (10 ng/ml), and FSH (0.4 μg/ml) and fertilized in the modified Tris-buffered medium (mTBM) containing caffeine (2 mM) and BSA-fraction V (0.1%; w/v). Embryos were cultured in NCSU-23 medium (Millipore, Billerica, MA, USA) supplemented with BSA-FAF (0.4%; w/v). All media contained 10 μl/ml antibiotics (gentamycin and penicillin G/Streptomycin sulphate) and were pre-incubated for at least 2 h before use. Oocytes and embryos were placed in 4-well dishes (Nunc, Roskilde, Denmark) for incubations under a humidified atmosphere of 39°C and 5% CO2 in air.

Cumulus-oocyte complex collection, in vitro maturation (IVM), fertilization (IVF) and embryo culture (IVC)

Sow (Yorkshire-Landrace) ovaries were harvested at a local abattoir (Southern Quality Meats, Pontotoc, MS, USA) and washed in the laboratory. Immature cumulus-oocyte complexes (COCs) were aspirated from follicles of 3-6 mm diameter. Oocytes with homogenous ooplasm and surrounded by cumulus cells were selected for maturation per groups of 50-75 COCs in 500 μl of medium. After 44 h incubation, COCs were collected and transferred into 250 μl of fertilization medium. High motile spermatozoa of pooled semen (Prestage Farms, West-Point, MS, USA) were purified through a discontinuous percoll gradient (90%-45%) and 250 μl of suspended sperm cells (12 × 105 spermatozoa/ml) was used to fertilize the COCs. Both gametes were co-incubated (Day 0 post-insemination or Day 0pi). Presumptive zygotes were harvested at 18 hpi and mechanically separated from the cumulus cells followed by the transfer of cumulus free-zygote into drops of cultured medium (1 embryo/1-2 μl) overlaid with mineral oil. Embryos were incubated for up to 6 days (Day 7pi).

Experiment 1: Developmental and gene expression effects of pRLN added during IVM

Cumulus-oocyte complexes were matured in the presence of 0, 20 or 40 ng/ml pRLN, or 10% (v/v) pFF. They were subsequently fertilized, and the presumptive zygotes were cultured until the blastocyst stage. All steps were processed as described above.
In a preliminary study aimed at evaluating our culture conditions, a total of 550 COCs (in 4 independent replicates) were matured in the presence of 10% pFF. Proportions of 44 ± 4% (mean ± SD) cleaved embryos and 17 ± 3% (mean ± SD) blastocysts (per cleaved: 40/229) were obtained.

Evaluation of oocyte maturation

COCs were collected after maturation (44 h) followed by a mechanical separation of oocytes and cumulus cells. Denuded oocytes were fixed in acetic acid: ethanol mix (1:3, v/v; 24 h at 4°C), stained with 1% aceto-orcein, and mounted onto slides for nuclear status evaluation under a phase-contrast microscope (Nikon Instruments Inc.; Melville, NY). Oocytes with germinal vesicle, metaphase I, or metaphase II nucleus features were classified as immature (GV), resuming meiosis (MI), or mature (MII) oocytes.

Evaluation of embryo development

Proportions of cleaved and blastocyst stage embryos were evaluated on Day 2pi and Day 7pi, respectively.

Sample collection for gene expression

Groups of 30 immature and 30 mature COCs were mechanically separated from their respective cumulus cells under a stereomicroscope. Isolated cumulus cells and cumulus free (or denuded) oocytes and other groups of 10 cleaved embryos (2-4 cells) and 3 blastocysts (Day 7pi) were separately selected under microscope based on morphological criteria (homogenous cytoplasm) for the gene expression study. All samples were stored at -80°C until analysis.

Experiment 2: Developmental and gene expression effects of pRLN added during IVM and IVC

Cumulus-oocyte complexes were maturated in the presence of 0, 20 or 40 ng pRLN/ml followed by their fertilization. Resulting zygotes were cultured for up to 6 days (Day 7pi) in the presence of 0, 20 or 40 ng/ml of pRLN. All steps were processed as described above and embryo production was done in duplicate for developmental and gene expression studies.

Developmental evaluation of relaxin effects

Cleaved and blastocyst stage embryos were recorded on Day 2pi and Day 7pi, respectively. Day 7pi-blastocysts were placed on microscope slides, air dried, fixed (for 24 h in absolute alcohol), and stained with the Hoechst 33342 dye. Blastocyst cell numbers were evaluated under an Epifluorescence microscope (Nikon Inc., Melville, NY, USA).

Sample collection for gene expression

Groups of 10 zygotes, 10 cleaved (2-4 cells) and 3 blastocyst stage embryos were selected based on their morphology under a stereomicroscope and stored per groups at -80°C until analysis.

RNA isolation and RT-PCR

Total RNA were isolated from frozen-thawed samples (RNeasy Micro Kit, Qiagen Inc., Valencia, USA), reverse-transcribed into cDNA (Superscription III Platinum® Two-Step qRT-PCR Kit) which were used for detecting the expression levels of relaxin and its receptors (RXFP1 and 2) and apoptotic related genes (Bax and Bcl2-like1). Expression levels of β-actin in each biological sample were determined for normalization. To this end, semi-quantitative (Taq DNA polymerase kit) and real-time (SYBR® GreenER q PCR SuperMixes for iCycler) PCR techniques were employed. Table 1 summarizes the primer pairs' characteristics. The PCR conditions were as followed: 5 min at 95°C; 45 cycles of [30 sec at 95°C, 30 sec at the optimal annealing temperature (Table 1) and 30 sec at 72°C]; 10 min at 72°C. Real time PCRs using tested (Bax, Bcl2-like1, Relaxin, RXFP1 and RXFP2) and internal control (β-actin) genes' primer pairs were performed, and the comparative Ct method was used to determine the transcript levels as previously described [28]. Relaxin, RXFP1 and RXFP2 gene expression data are indicated as relative expression to β-actin, while individually normalized Bax and Bcl2-like1 to β-actin are shown as Bcl2-like1/Bax ratios. All PCR products were further resolved on 1.5% agarose gels to verify of the amplification quality given the size of the amplicon products.
Table 1
Primer sequence characteristics
Gene symbols
GenBank Acc.#,
(NCBI)
Primer sequences (5'-3')
AT
(oC)
Amplicon
sizes (bp)
RXFP1
CA994862.1
S:
AS:
AGGCTGACGAGGACAACT
CAGAACCGACCAAGCATT
52.5
132
RXFP2
CA997681.1
(XM_001927967.1)
S:
AS:
CATCTGCTGGATTCCCGTAT
TTCAAGGCACTGTTCACC
55
117
RELAXIN
NM213872.1
S:
AS:
TGTGGCTCCGTCTCCTGGGG
GTTGCCTTCAGCTCCTGTGGC
55
164
BCL2-like1
NM214285.1
S:
AS:
TGAATCAGAAGCGGAAACCC
GCTCTAGGTGGTCATTCAGGTAAG
60
416
BAX
AJ606301
S:
AS:
TTTCTGACGGCAACTTCAACTG
AGCCACAAAGATGGTCACTGTCT
60
238
β-ACTIN
U07786
S:
AS:
ACTGGCATTGTCATGGACTCTG
AGTTGAAGGTGGTCTCGTGGAT
60
397
S, sens; AS, AntiSens
In parallel, sections of electrophoresis gels containing relaxin, RXFP1 and RXFP2 PCR products generated from porcine neonates uterine cells (Ut) and ovarian corpora lutea (CL) samples were excised to test their authenticities. Agarose gel sections were purified and submitted for sequencing (BigDye terminator V1.1 cycle sequencing kit; Applied Biosciences Inc., Foster City, USA) followed by their BLAST on pig genome (NCBI repository database). Bax, Bcl2-like1 and β-actin primer sequences published by Wang et al. were used in this study [28].

Statistical analysis

All experiments were repeated at least three times and RNA samples obtained from each experimental replicate. One-way ANOVA (SYSTAT, Systat software Inc., Chicago, IL, USA) followed by the Fisher's Least Square Difference test for pairwise comparisons were used to analyze the pRLN effects. The Student's t-test was used to compare the expression levels of Bax, Bcl2-like1, RXFP1, and RXFP2 mRNA within the sample type (MCC: mature cumulus cell, or MII: mature oocyte). Results are expressed as mean (± SD) for gene expression or (± SEM) for developmental data, and P < 0.05 are fixed for significant differences.

Results

Experiment 1: Development and gene expression effects of pRLN added IVM

Developmental effects

The presence of pRLN during IVM did not affect the cumulus cell expansion (data not shown); however, it did significantly increase the proportion of oocytes that resumed meiosis (79% ± 4%, 87% ± 3%, and 91% ± 3%, for 0, 20 and 40 ng pRLN/ml, respectively, P < 0.05), and, subsequently, increased the proportions of oocytes that reached metaphase II (68% ± 5%, 80% ± 4% or 88% ± 4% for 0, 20 or 40 ng pRLN/ml, respectively, P < 0.05; ANOVA; Table 2).
Table 2
Effect of relaxin on porcine oocyte maturation
pRLN during IVM (ng/ml)
Total Oocytes (N)
Nuclear maturation status of oocytes
  
GV% (n)
MI% (n)
MII% (n)
0
451
21 ± 4 (93)a
11 ± 5 (51)a
68 ± 5 (307)a
20
472
13 ± 3 (61)ab
7 ± 2 (31)a
80 ± 4 (380)b
40
331
9 ± 3 (30)b
3 ± 3 (9)b
88 ± 4 (291)c
P values (ANOVA)
10-3
0.03
10-4
abc Different superscripts within the same column indicate significant difference (P < 0.05; ANOVA). Data are mean values (± SEM) of at least 4 independent replicates.
Furthermore, we evaluated the effect of relaxin on embryo development by maturing a total of 1,169 COCs in the presence of 0, 20 and 40 ng pRLN/ml (4 to 7 independent replicates, Table 3). Only 40 ng pRLN/ml significantly increased the cleavage and blastocyst rates in comparison to the control group (51 ± 5% and 10 ± 3% vs. 37 ± 4% and 12 ± 3%, respectively; P < 0.05). There were no significant differences between the 20 ng pRLN/ml treatment and the control. Moreover, the mean cell number of blastocysts was significantly higher in the 40 ng pRLN/ml group (38 ± 3) compared to others (control: 31 ± 4 and 20 ng pRLN/ml: 32 ± 6; P < 0.05), which appeared similar.
Table 3
Developmental effects of relaxin added during oocyte maturation
pRLN during IVM (ng/ml)
Total Zygotes (N)
% of cleaved at Day 2pi (n)
Blastocyst formation at Day 7pi
   
Total (T)
% (T/N)
Cell number (n)
0
383
37 ± 4 (141)a
45
12 ± 3a
31 ± 4 (16)a
20
344
40 ± 4 (135)a
23
8 ± 4a
32 ± 6 (12)a
40
442
51 ± 5 (226)b
46
10 ± 3a
38 ± 3 (12)b
ab Different superscripts within the same column indicate significant difference (P < 0.05; ANOVA). Data are mean values (± SEM) of at least 5 independent replicates.

Gene expression effects

We evaluated the effect of relaxin on Bax, Bcl2-like1, relaxin, RXFP1 and RXFP2 gene expression in both cumulus cells and oocytes. With exception of relaxin, all other gene transcripts were detected in both cell types (Figure 1, 2 and 3). Their expression levels in cumulus cells were always lower than that in oocytes (P < 0.05). The concentration of 40 ng pRLN/ml significantly increased RXFP2 mRNA transcript levels in oocytes and cumulus cells (Figure 1A; P < 0.05), but had no effect on Bcl2-like1/Bax ratios in both cell types (Figure 2). The presence of 10% porcine follicular fluid (pFF) significantly increased RXFP1 mRNA amounts in mature cumulus cells and oocytes, as well as the Bcl2-like1/Bax ratio in mature oocytes (Figure 1B and 2; P < 0.05). However, relaxin transcripts were not detected in oocytes, and neither pRLN nor pFF were able to induce its de novo expression (Figure 3A).

Experiment 2: Developmental and gene expression effects of pRLN added during IVM and IVC

Developmental effects

A preliminary study was conducted with a total of 1,343 zygotes cultured in culture media containing 0 (control), 20, or 40 ng pRLN/ml. We found no significant effects of relaxin on the proportions of cleaved embryos and blastocysts. However, the mean cell numbers of blastocysts were significantly increased in the presence of pRLN (control: 31 ± 4, 20 ng/ml: 49 ± 12, 40 ng/ml: 38 ± 8; P < 0.05, ANOVA). Based on these results, we evaluated the effect of pRLN added during oocyte maturation (0 or 40 ng/ml) and embryo culture (0, 20, or 40 ng/ml).
Oocytes matured in the presence of 40 ng pRLN/ml followed the culture of resulting zygotes in the presence of 20 or 40 ng pRLN/ml (Treated-1 and Treated-2, respectively). Embryos produced without any exposure to pRLN served as the control group. A total of 949 were used in at least three independent replicates to evaluate the effect of pRLN added during both maturation (Treated-1) and embryo culture (Treated-2). Results summarized in Table 4 revealed a negative effect of pRLN on the cleavage rate in group Treated-1 (40-20) compared to Treated-2 (40-40) and control (33 ± 5% vs. 51 ± 8% and 48 ± 3%, respectively; P < 0.05), whereas no differences in term of blastocysts rates were observed. However, the mean cell number of blastocysts was significantly increased in the Treated-2 group (43 ± 6) compared to the control group (31 ± 3; P < 0.05).
Table 4
Effects of relaxin added during both oocyte maturation and embryo culture
pRLN (ng/ml) during
Total Zygotes (N)
% of cleaved at Day 2pi (n)
Blastocyst formation at Day 7pi
IVM
IVC
  
Total (T)
% (T/N)
Cell number (n)
0
0
324
48 ± 3 (156)a
24
8 ± 2a
31 ± 3 (24)a
40
20
272
33 ± 5 (91)b
19
7 ± 2a
33 ± 3 (12)a
40
40
353
51 ± 8 (172)a
33
10 ± 2a
43 ± 6 (10)b
abc Different superscripts within the same columns indicate significant difference (P < 0.05; ANOVA). Data are mean values (± SEM) of at least 5 independent replicates.

Gene expression effects

We evaluated the effect of 40 ng pRLN/ml added during oocyte maturation (IVM), embryo culture (IVC), or both periods (IVM/IVC) on Bax and Bcl2-like1 gene expression in cleaved and blastocyst stage embryos. Figures 3B and 3C show that the Bcl2-like1/Bax ratios were significantly higher in cleaved embryos compared to blastocysts (P < 0.05, t-test). However, the moment of relaxin exposure (IVM or IVC) had no significant effect on these ratios (ANOVA).

Discussion

Numerous physiological roles have been attributed to relaxin [10, 11]; but its effects during embryo development are still unknown despite its presence in gamete and embryo environments. Here, we could not detect the expression of relaxin in porcine COCs but found an accumulation of its receptors RXFP1 and RXFP2 mRNA in COCs which appeared to be modulated by exogenous relaxin. In addition, relaxin moderately influenced embryo development but significantly increased the total cell number of blastocysts irrespective of the moment of its addition in the media (oocyte maturation and/or embryo culture).
The present study reports developmental effects of relaxin used at concentrations similar to those found in the literature [2931]. Indeed, variable but large amounts of relaxin are found in follicular fluids surrounding porcine oocytes, while pre-implantation embryos are suspected to be exposed to unknown amounts of relaxin during their utero-tubal progression and development (corresponding to the ovarian luteal phase). Beneficial roles of relaxin have been demonstrated during follicle growth and ovulation [7, 14], uterine receptivity and activity process in various species such as pigs [14], primates [32, 33] and rodents [21, 34, 35]. To our knowledge, the current study is the first to report developmental effects of exogenous relaxin during both oocyte maturation and early embryo development.
These effects are results of putative interactions between relaxin and its receptors located on plasma membranes of target cells [22, 24, 36]. In previous studies, we reported the presence of these receptors on porcine oocytes and embryos [27]. Here, we found that the addition of porcine relaxin in a follicular fluid-free maturation medium induces an accumulation of RXFP2 mRNA in COCs. This effect is surprising given that relaxin is the specific ligand of RXFP1, although it can bind with low affinity to RXFP2. This observation suggests a possible role of RXFP2 receptors during mammalian oocyte maturation process in the pig, as also suggested in rhesus macaque [37] and rat [38] oocytes expressing RXFP2 mRNA. In-depth studies of INSL3-RXFP2 complex during oocyte maturation and embryo development will definitely contribute to better characterize the full developmental effects of this complex.
Nevertheless, given the complexity of molecular interactions existing within the follicular fluid, a likely activation of RXFP1 receptors during in vivo oocyte maturation cannot be ruled out; and seems to be highlighted in the current study by the significant increase of RXFP1 mRNA in oocytes matured in the presence of porcine follicular fluid alone. The existence of such interactions may also explain our contradictory results with a recent study reporting a lack of relaxin effect on nuclear maturation of pig oocytes [39]. These authors tested the effect of recombinant human relaxin added in maturation medium already containing porcine follicular fluid (10%) and whose high relaxin contents [8, 40] and beneficial effect on oocyte maturation [41, 42] could have interfered with their results. In our study, oocytes were matured in the absence of follicular fluid, and the supplementation of the basal medium with relaxin significantly increased the proportions of oocytes resuming and accomplishing meiotic maturation. This beneficial effect of relaxin could be explained by its interactions with its receptors leading to an inhibition of oocyte meiosis blocking factors such as cyclic adenosine monophosphate (cAMP) as previously suggested [38].
Most interesting, the developmental effects of relaxin suggest both direct and indirect effects on embryos and oocytes, respectively. While embryos were freed of the surrounding cumulus cells after fertilization, oocytes were matured together with their surrounding cumulus cells. Using rodent oocytes, Kawamura et al. have proposed an indirect effect of relaxin on its targets in a paracrine way [38]. Irrespective of the moment of its addition, the increased total cell number of blastocysts appears as the hallmark of relaxin during early embryo development. Indeed, beneficial effects of relaxin were limited at the cleavage stage (high proportions) following oocyte maturation in the presence of relaxin, while any effects were observed on blastocyst formation compared to the control groups.
Developmental effects of relaxin in our study indicate possible perturbations of molecular mechanisms associated with cell cycle, and specifically cell proliferation. A recent study has demonstrated a positive effect of relaxin on glutathione (GSH) synthesis in in vitro matured porcine oocytes [39]. Indeed, GSH is a routine indicator or oocyte cytoplasmic maturation [43], whose beneficial effects on blastocyst formation and quality (hatching and cell number) are well-documented [4448]. Therefore, we suggest that the increase of blastocyst cell number in our study is probably associated to an increase of GSH in oocytes and/or developing embryos.
In addition, production of GSH induces an imbalance of reduced-oxidative (REDOX) status of cells leading to potential modifications of cellular functions such as cell cycle (incidence of apoptosis) [49]. Therefore, we anticipated an activation of apoptotic-related genes by relaxin. Apoptosis is an important biological process during blastocyst formation of which fine-tuned balances between pro-apoptotic (Bax) and anti-apoptotic (Bcl2-like1) genes are critical for the survival of embryos [50]. Our study revealed that Bcl2-like1/Bax ratios were always in direction of Bcl2-like1 transcripts which is favorable to embryo survival. The presence of relaxin during culture did not significantly affect this ratio which remained comparable between groups.

Conclusions

In summary, our findings suggest that the increase in the total cell number in blastocysts is the hallmark effect of exogenous relaxin. Given that the cell number of blastocysts is an important gauge for in vitro-produced embryos, the supplementation of porcine embryo culture media with relaxin could be considered. However, the effects of relaxin on the expression of developmentally important genes should be investigated.

Acknowledgements

The authors thank the Southern Quality Meats (Pontotoc, Mississippi, USA) for facilitating the collection of ovaries. This work was supported by the USDA-ARS Biophotonics Initiative project # 58-6402-3-0120 and the Mississippi Agricultural and Forestry Station (MAFES).
This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://​creativecommons.​org/​licenses/​by/​2.​0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

JMF conceived and performed all the experiments, and wrote the first draft of the manuscript. JMG contributed to the in vitro embryo production. STW and PLR contributed to the design of the study, revised and approved the manuscript. All authors read and approved the final manuscript.
Anhänge

Authors’ original submitted files for images

Literatur
1.
Zurück zum Zitat Kikuchi K, Onishi A, Kashiwazaki N, Iwamoto M, Noguchi J, Kaneko H, Akita T, Nagai T: Successful Piglet Production after Transfer of Blastocysts Produced by a Modified In Vitro System. Biol Reprod. 2002, 66 (4): 1033-1041. 10.1095/biolreprod66.4.1033.CrossRef Kikuchi K, Onishi A, Kashiwazaki N, Iwamoto M, Noguchi J, Kaneko H, Akita T, Nagai T: Successful Piglet Production after Transfer of Blastocysts Produced by a Modified In Vitro System. Biol Reprod. 2002, 66 (4): 1033-1041. 10.1095/biolreprod66.4.1033.CrossRef
2.
Zurück zum Zitat Pomar FJ, Teerds KJ, Kidson A, Colenbrander B, Tharasanit T, Aguilar B, Roelen BA: Differences in the incidence of apoptosis between in vivo and in vitro produced blastocysts of farm animal species: a comparative study. Theriogenology. 2005, 63 (8): 2254-2268. 10.1016/j.theriogenology.2004.10.015.CrossRef Pomar FJ, Teerds KJ, Kidson A, Colenbrander B, Tharasanit T, Aguilar B, Roelen BA: Differences in the incidence of apoptosis between in vivo and in vitro produced blastocysts of farm animal species: a comparative study. Theriogenology. 2005, 63 (8): 2254-2268. 10.1016/j.theriogenology.2004.10.015.CrossRef
3.
Zurück zum Zitat Kitagawa Y, Suzuki K, Yoneda A, Watanabe T: Effects of oxygen concentration and antioxidants on the in vitro developmental ability, production of reactive oxygen species (ROS), and DNA fragmentation in porcine embryos. Theriogenology. 2004, 62 (7): 1186-1197. 10.1016/j.theriogenology.2004.01.011.CrossRef Kitagawa Y, Suzuki K, Yoneda A, Watanabe T: Effects of oxygen concentration and antioxidants on the in vitro developmental ability, production of reactive oxygen species (ROS), and DNA fragmentation in porcine embryos. Theriogenology. 2004, 62 (7): 1186-1197. 10.1016/j.theriogenology.2004.01.011.CrossRef
4.
Zurück zum Zitat Petters RM, Wells KD: Culture of pig embryos. J Reprod Fertil Suppl. 1993, 48: 61-73. Petters RM, Wells KD: Culture of pig embryos. J Reprod Fertil Suppl. 1993, 48: 61-73.
5.
Zurück zum Zitat Abeydeera LR: In vitro production of embryos in swine. Theriogenology. 2002, 57 (1): 256-273. 10.1016/S0093-691X(01)00670-7.CrossRef Abeydeera LR: In vitro production of embryos in swine. Theriogenology. 2002, 57 (1): 256-273. 10.1016/S0093-691X(01)00670-7.CrossRef
6.
Zurück zum Zitat Webb R, Garnsworthy PC, Campbell BK, Hunter MG: Intra-ovarian regulation of follicular development and oocyte competence in farm animals. Theriogenology. 2007, 68: S22-S29. 10.1016/j.theriogenology.2007.04.036.CrossRef Webb R, Garnsworthy PC, Campbell BK, Hunter MG: Intra-ovarian regulation of follicular development and oocyte competence in farm animals. Theriogenology. 2007, 68: S22-S29. 10.1016/j.theriogenology.2007.04.036.CrossRef
7.
Zurück zum Zitat Bagnell CA: Production and biologic action of relaxin within the ovarian follicle: an overview. Steroids. 1991, 56 (5): 242-246. 10.1016/0039-128X(91)90041-S.CrossRef Bagnell CA: Production and biologic action of relaxin within the ovarian follicle: an overview. Steroids. 1991, 56 (5): 242-246. 10.1016/0039-128X(91)90041-S.CrossRef
8.
Zurück zum Zitat Matsumoto D, Chamley WA: Identification of relaxins in porcine follicular fluid and in the ovary of the immature sow. J Reprod Fertil. 1980, 58 (2): 369-375. 10.1530/jrf.0.0580369.CrossRef Matsumoto D, Chamley WA: Identification of relaxins in porcine follicular fluid and in the ovary of the immature sow. J Reprod Fertil. 1980, 58 (2): 369-375. 10.1530/jrf.0.0580369.CrossRef
9.
Zurück zum Zitat Seppala M, Tiitinen A: Endometrial responses to corpus luteum products in cycles with induced ovulation: theoretical and practical considerations. Hum Reprod. 1995, 10 (Suppl 2): 67-76.CrossRef Seppala M, Tiitinen A: Endometrial responses to corpus luteum products in cycles with induced ovulation: theoretical and practical considerations. Hum Reprod. 1995, 10 (Suppl 2): 67-76.CrossRef
10.
Zurück zum Zitat Hisaw F: Experimental relaxation of the pubic ligament of the guinea pig. Proc Soc Exp Biol Med. 1926, 23: 661-663.CrossRef Hisaw F: Experimental relaxation of the pubic ligament of the guinea pig. Proc Soc Exp Biol Med. 1926, 23: 661-663.CrossRef
11.
Zurück zum Zitat Sherwood OD: Relaxin's physiological roles and other diverse actions. Endocr Rev. 2004, 25 (2): 205-234. 10.1210/er.2003-0013.CrossRef Sherwood OD: Relaxin's physiological roles and other diverse actions. Endocr Rev. 2004, 25 (2): 205-234. 10.1210/er.2003-0013.CrossRef
12.
Zurück zum Zitat Gunnersen JM, Crawford RJ, Tregear GW: Expression of the relaxin gene in rat tissues. Mol Cell Endocrinol. 1995, 110 (1-2): 55-64. 10.1016/0303-7207(95)03516-A.CrossRef Gunnersen JM, Crawford RJ, Tregear GW: Expression of the relaxin gene in rat tissues. Mol Cell Endocrinol. 1995, 110 (1-2): 55-64. 10.1016/0303-7207(95)03516-A.CrossRef
13.
Zurück zum Zitat Dschietzig T, Bartsch C, Baumann G, Stangl K: Relaxin-a pleiotropic hormone and its emerging role for experimental and clinical therapeutics. Pharmacol Ther. 2006, 112 (1): 38-56. 10.1016/j.pharmthera.2006.03.004.CrossRef Dschietzig T, Bartsch C, Baumann G, Stangl K: Relaxin-a pleiotropic hormone and its emerging role for experimental and clinical therapeutics. Pharmacol Ther. 2006, 112 (1): 38-56. 10.1016/j.pharmthera.2006.03.004.CrossRef
14.
Zurück zum Zitat Bagnell CA, Zhang Q, Downey B, Ainsworth L: Sources and biological actions of relaxin in pigs. J Reprod Fertil Suppl. 1993, 48: 127-138. Bagnell CA, Zhang Q, Downey B, Ainsworth L: Sources and biological actions of relaxin in pigs. J Reprod Fertil Suppl. 1993, 48: 127-138.
15.
Zurück zum Zitat Yan W, Ryan PL, Bartol FF, Bagnell CA: Uterotrophic effects of relaxin related to age and estrogen receptor activation in neonatal pigs. Reproduction. 2006, 131 (5): 943-950. 10.1530/rep.1.00762.CrossRef Yan W, Ryan PL, Bartol FF, Bagnell CA: Uterotrophic effects of relaxin related to age and estrogen receptor activation in neonatal pigs. Reproduction. 2006, 131 (5): 943-950. 10.1530/rep.1.00762.CrossRef
16.
Zurück zum Zitat Lobb DK, Porter DG: Rapid increase in relaxin gene expression in early pregnancy in the pig. Mol Cell Endocrinol. 1992, 89 (1-2): R5-8. 10.1016/0303-7207(92)90225-U.CrossRef Lobb DK, Porter DG: Rapid increase in relaxin gene expression in early pregnancy in the pig. Mol Cell Endocrinol. 1992, 89 (1-2): R5-8. 10.1016/0303-7207(92)90225-U.CrossRef
17.
Zurück zum Zitat Ohleth KM, Bagnell CA: Relaxin secretion and gene expression in porcine granulosa and theca cells are stimulated during in vitro luteinization. Biol Reprod. 1999, 60 (2): 499-507. 10.1095/biolreprod60.2.499.CrossRef Ohleth KM, Bagnell CA: Relaxin secretion and gene expression in porcine granulosa and theca cells are stimulated during in vitro luteinization. Biol Reprod. 1999, 60 (2): 499-507. 10.1095/biolreprod60.2.499.CrossRef
18.
Zurück zum Zitat Parry LJ, Vodstrcil LA: Relaxin Physiology in the Female Reproductive Tract during Pregnancy. Relaxin and Related Peptides. 2007, 34-48. full_text.CrossRef Parry LJ, Vodstrcil LA: Relaxin Physiology in the Female Reproductive Tract during Pregnancy. Relaxin and Related Peptides. 2007, 34-48. full_text.CrossRef
19.
Zurück zum Zitat Min G, Hartzog MG, Jennings RL, Winn RJ, Sherwood OD: Evidence That Endogenous Relaxin Promotes Growth of the Vagina and Uterus during Pregnancy in Gilts. Endocrinology. 1997, 138 (2): 560-565. 10.1210/en.138.2.560. Min G, Hartzog MG, Jennings RL, Winn RJ, Sherwood OD: Evidence That Endogenous Relaxin Promotes Growth of the Vagina and Uterus during Pregnancy in Gilts. Endocrinology. 1997, 138 (2): 560-565. 10.1210/en.138.2.560.
20.
Zurück zum Zitat Ryan P, Baum D, Lenhart J, Ohleth K, Bagnell C: Expression of uterine and cervical epithelial cadherin during relaxin-induced growth in pigs. Reproduction. 2001, 122 (6): 929-937. 10.1530/rep.0.1220929.CrossRef Ryan P, Baum D, Lenhart J, Ohleth K, Bagnell C: Expression of uterine and cervical epithelial cadherin during relaxin-induced growth in pigs. Reproduction. 2001, 122 (6): 929-937. 10.1530/rep.0.1220929.CrossRef
21.
Zurück zum Zitat Rogers PA, Murphy CR, Squires KR, MacLennan AH: Effects of relaxin on the intrauterine distribution and antimesometrial positioning and orientation of rat blastocysts before implantation. J Reprod Fertil. 1983, 68 (2): 431-435. 10.1530/jrf.0.0680431.CrossRef Rogers PA, Murphy CR, Squires KR, MacLennan AH: Effects of relaxin on the intrauterine distribution and antimesometrial positioning and orientation of rat blastocysts before implantation. J Reprod Fertil. 1983, 68 (2): 431-435. 10.1530/jrf.0.0680431.CrossRef
22.
Zurück zum Zitat van der Westhuizen ET, Halls ML, Samuel CS, Bathgate RA, Unemori EN, Sutton SW, Summers RJ: Relaxin family peptide receptors--from orphans to therapeutic targets. Drug Discov Today. 2008, 13 (15-16): 640-651. 10.1016/j.drudis.2008.04.002.CrossRef van der Westhuizen ET, Halls ML, Samuel CS, Bathgate RA, Unemori EN, Sutton SW, Summers RJ: Relaxin family peptide receptors--from orphans to therapeutic targets. Drug Discov Today. 2008, 13 (15-16): 640-651. 10.1016/j.drudis.2008.04.002.CrossRef
23.
Zurück zum Zitat Hayes ES: Biology of primate relaxin: a paracrine signal in early pregnancy?. Reprod Biol Endocrinol. 2004, 2: 36-10.1186/1477-7827-2-36.PubMedCentralCrossRef Hayes ES: Biology of primate relaxin: a paracrine signal in early pregnancy?. Reprod Biol Endocrinol. 2004, 2: 36-10.1186/1477-7827-2-36.PubMedCentralCrossRef
24.
Zurück zum Zitat Bathgate RA, Ivell R, Sanborn BM, Sherwood OD, Summers RJ: International Union of Pharmacology LVII: recommendations for the nomenclature of receptors for relaxin family peptides. Pharmacol Rev. 2006, 58 (1): 7-31. 10.1124/pr.58.1.9.CrossRef Bathgate RA, Ivell R, Sanborn BM, Sherwood OD, Summers RJ: International Union of Pharmacology LVII: recommendations for the nomenclature of receptors for relaxin family peptides. Pharmacol Rev. 2006, 58 (1): 7-31. 10.1124/pr.58.1.9.CrossRef
25.
Zurück zum Zitat Yan W, Wiley AA, Bathgate RA, Frankshun AL, Lasano S, Crean BD, Steinetz BG, Bagnell CA, Bartol FF: Expression of LGR7 and LGR8 by neonatal porcine uterine tissues and transmission of milk-borne relaxin into the neonatal circulation by suckling. Endocrinology. 2006, 147 (9): 4303-4310. 10.1210/en.2006-0397.CrossRef Yan W, Wiley AA, Bathgate RA, Frankshun AL, Lasano S, Crean BD, Steinetz BG, Bagnell CA, Bartol FF: Expression of LGR7 and LGR8 by neonatal porcine uterine tissues and transmission of milk-borne relaxin into the neonatal circulation by suckling. Endocrinology. 2006, 147 (9): 4303-4310. 10.1210/en.2006-0397.CrossRef
26.
Zurück zum Zitat Min G, Sherwood OD: Localization of specific relaxin-binding cells in the ovary and testis of pigs. Biol Reprod. 1998, 59 (2): 401-408. 10.1095/biolreprod59.2.401.CrossRef Min G, Sherwood OD: Localization of specific relaxin-binding cells in the ovary and testis of pigs. Biol Reprod. 1998, 59 (2): 401-408. 10.1095/biolreprod59.2.401.CrossRef
27.
Zurück zum Zitat Feugang J, Rodriguez-Munoz J, Willard S, Bathgate R, Ryan P: Examination of relaxin and its receptors expression in pig gametes and embryos. Reprod Biol Endocrinol. 2011, 9 (1): 10-10.1186/1477-7827-9-10.PubMedCentralCrossRef Feugang J, Rodriguez-Munoz J, Willard S, Bathgate R, Ryan P: Examination of relaxin and its receptors expression in pig gametes and embryos. Reprod Biol Endocrinol. 2011, 9 (1): 10-10.1186/1477-7827-9-10.PubMedCentralCrossRef
28.
Zurück zum Zitat Wang H, Rodriguez-Osorio N, Feugang JM, Jung SY, Garrison K, Wolgemuth C, Greer L, Crenshaw M, Memili E: Effects of culture media and inhibitors on biology of porcine early embryonic development in vitro. Livest Sci. 2009, 121 (1): 102-107. 10.1016/j.livsci.2008.06.013.CrossRef Wang H, Rodriguez-Osorio N, Feugang JM, Jung SY, Garrison K, Wolgemuth C, Greer L, Crenshaw M, Memili E: Effects of culture media and inhibitors on biology of porcine early embryonic development in vitro. Livest Sci. 2009, 121 (1): 102-107. 10.1016/j.livsci.2008.06.013.CrossRef
29.
Zurück zum Zitat Choa SJ, Dlamini BJ, Klindt J, Schwabe C, Jacobson CD, Anderson LL: Antiporcine relaxin (antipRLX540) treatment decreases relaxin plasma concentration and disrupts delivery in late pregnant pigs. Anim Reprod Sci. 1998, 52 (4): 303-316. 10.1016/S0378-4320(98)00135-3.CrossRef Choa SJ, Dlamini BJ, Klindt J, Schwabe C, Jacobson CD, Anderson LL: Antiporcine relaxin (antipRLX540) treatment decreases relaxin plasma concentration and disrupts delivery in late pregnant pigs. Anim Reprod Sci. 1998, 52 (4): 303-316. 10.1016/S0378-4320(98)00135-3.CrossRef
30.
Zurück zum Zitat Han YJ, Miah AG, Yoshida M, Sasada H, Hamano K, Kohsaka T, Tsujii H: Effect of relaxin on in vitro fertilization of porcine oocytes. J Reprod Dev. 2006, 52 (5): 657-662. 10.1262/jrd.18038.CrossRef Han YJ, Miah AG, Yoshida M, Sasada H, Hamano K, Kohsaka T, Tsujii H: Effect of relaxin on in vitro fertilization of porcine oocytes. J Reprod Dev. 2006, 52 (5): 657-662. 10.1262/jrd.18038.CrossRef
31.
Zurück zum Zitat Miah AG, Tareq KM, Hamano K, Kohsaka T, Tsujii H: Effect of relaxin on acrosome reaction and utilization of glucose in boar spermatozoa. J Reprod Dev. 2006, 52 (6): 773-779. 10.1262/jrd.18037.CrossRef Miah AG, Tareq KM, Hamano K, Kohsaka T, Tsujii H: Effect of relaxin on acrosome reaction and utilization of glucose in boar spermatozoa. J Reprod Dev. 2006, 52 (6): 773-779. 10.1262/jrd.18037.CrossRef
32.
Zurück zum Zitat Einspanier A, Lieder K, Husen B, Ebert K, Lier S, Einspanier R, Unemori E, Kemper M: Relaxin supports implantation and early pregnancy in the marmoset monkey. Ann N Y Acad Sci. 2009, 1160: 140-146. 10.1111/j.1749-6632.2009.03947.x.CrossRef Einspanier A, Lieder K, Husen B, Ebert K, Lier S, Einspanier R, Unemori E, Kemper M: Relaxin supports implantation and early pregnancy in the marmoset monkey. Ann N Y Acad Sci. 2009, 1160: 140-146. 10.1111/j.1749-6632.2009.03947.x.CrossRef
33.
Zurück zum Zitat Ghosh D, Stewart DR, Nayak NR, Lasley BL, Overstreet JW, Hendrickx AG, Sengupta J: Serum concentrations of oestradiol-17beta, progesterone, relaxin and chorionic gonadotrophin during blastocyst implantation in natural pregnancy cycle and in embryo transfer cycle in the rhesus monkey. Hum Reprod. 1997, 12 (5): 914-920. 10.1093/humrep/12.5.914.CrossRef Ghosh D, Stewart DR, Nayak NR, Lasley BL, Overstreet JW, Hendrickx AG, Sengupta J: Serum concentrations of oestradiol-17beta, progesterone, relaxin and chorionic gonadotrophin during blastocyst implantation in natural pregnancy cycle and in embryo transfer cycle in the rhesus monkey. Hum Reprod. 1997, 12 (5): 914-920. 10.1093/humrep/12.5.914.CrossRef
34.
Zurück zum Zitat Pusey J, Kelly WA, Bradshaw JM, Porter DG: Myometrial activity and the distribution of blastocysts in the uterus of the rat: interference by relaxin. Biol Reprod. 1980, 23 (2): 394-397. 10.1095/biolreprod23.2.394.CrossRef Pusey J, Kelly WA, Bradshaw JM, Porter DG: Myometrial activity and the distribution of blastocysts in the uterus of the rat: interference by relaxin. Biol Reprod. 1980, 23 (2): 394-397. 10.1095/biolreprod23.2.394.CrossRef
35.
Zurück zum Zitat Lee VH, Fields PA: Rabbit endometrial relaxin: immunohistochemical localization during preimplantation, pregnancy, and lactation. Biol Reprod. 1990, 42 (4): 737-745. 10.1095/biolreprod42.4.737.CrossRef Lee VH, Fields PA: Rabbit endometrial relaxin: immunohistochemical localization during preimplantation, pregnancy, and lactation. Biol Reprod. 1990, 42 (4): 737-745. 10.1095/biolreprod42.4.737.CrossRef
36.
Zurück zum Zitat Halls ML, Bathgate RA, Summers RJ: Relaxin family peptide receptors RXFP1 and RXFP2 modulate cAMP signaling by distinct mechanisms. Mol Pharmacol. 2006, 70 (1): 214-226. Halls ML, Bathgate RA, Summers RJ: Relaxin family peptide receptors RXFP1 and RXFP2 modulate cAMP signaling by distinct mechanisms. Mol Pharmacol. 2006, 70 (1): 214-226.
37.
Zurück zum Zitat Hanna C, Yao S, Patta M, Jensen J, Wu X: Expression of insulin-like 3 (INSL3) and differential splicing of its receptor in the ovary of rhesus macaques. Reprod Biol Endocrinol. 2010, 8 (1): 150-10.1186/1477-7827-8-150.PubMedCentralCrossRef Hanna C, Yao S, Patta M, Jensen J, Wu X: Expression of insulin-like 3 (INSL3) and differential splicing of its receptor in the ovary of rhesus macaques. Reprod Biol Endocrinol. 2010, 8 (1): 150-10.1186/1477-7827-8-150.PubMedCentralCrossRef
38.
Zurück zum Zitat Kawamura K, Kumagai J, Sudo S, Chun SY, Pisarska M, Morita H, Toppari J, Fu P, Wade JD, Bathgate RA, et al: Paracrine regulation of mammalian oocyte maturation and male germ cell survival. Proc Natl Acad Sci USA. 2004, 101 (19): 7323-7328. 10.1073/pnas.0307061101.PubMedCentralCrossRef Kawamura K, Kumagai J, Sudo S, Chun SY, Pisarska M, Morita H, Toppari J, Fu P, Wade JD, Bathgate RA, et al: Paracrine regulation of mammalian oocyte maturation and male germ cell survival. Proc Natl Acad Sci USA. 2004, 101 (19): 7323-7328. 10.1073/pnas.0307061101.PubMedCentralCrossRef
39.
Zurück zum Zitat Kim HS, Jeong YI, Lee JY, Jeong YW, Hossein MS, Hyun HS, Hwang WS: Effects of Recombinant Relaxin on In Vitro Maturation of Porcine Oocytes. J Vet Med Sci. 2010, 72 (3): 333-337. 10.1292/jvms.09-0411.CrossRef Kim HS, Jeong YI, Lee JY, Jeong YW, Hossein MS, Hyun HS, Hwang WS: Effects of Recombinant Relaxin on In Vitro Maturation of Porcine Oocytes. J Vet Med Sci. 2010, 72 (3): 333-337. 10.1292/jvms.09-0411.CrossRef
40.
Zurück zum Zitat Ohleth KM, Zhang Q, Bagnell CA: Relaxin protein and gene expression in ovarian follicles of immature pigs. J Mol Endocrinol. 1998, 21 (2): 179-187. 10.1677/jme.0.0210179.CrossRef Ohleth KM, Zhang Q, Bagnell CA: Relaxin protein and gene expression in ovarian follicles of immature pigs. J Mol Endocrinol. 1998, 21 (2): 179-187. 10.1677/jme.0.0210179.CrossRef
41.
Zurück zum Zitat Avery B, Strobech L, Jacobsen T, Bogh IB, Greve T: In vitro maturation of bovine cumulus-oocyte complexes in undiluted follicular fluid: effect on nuclear maturation, pronucleus formation and embryo development. Theriogenology. 2003, 59 (3-4): 987-999. 10.1016/S0093-691X(02)01139-1.CrossRef Avery B, Strobech L, Jacobsen T, Bogh IB, Greve T: In vitro maturation of bovine cumulus-oocyte complexes in undiluted follicular fluid: effect on nuclear maturation, pronucleus formation and embryo development. Theriogenology. 2003, 59 (3-4): 987-999. 10.1016/S0093-691X(02)01139-1.CrossRef
42.
Zurück zum Zitat Marchal R, Feugang JM, Perreau C, Venturi E, Terqui M, Mermillod P: Meiotic and developmental competence of prepubertal and adult swine oocytes. Theriogenology. 2001, 56 (1): 17-29. 10.1016/S0093-691X(01)00539-8.CrossRef Marchal R, Feugang JM, Perreau C, Venturi E, Terqui M, Mermillod P: Meiotic and developmental competence of prepubertal and adult swine oocytes. Theriogenology. 2001, 56 (1): 17-29. 10.1016/S0093-691X(01)00539-8.CrossRef
43.
Zurück zum Zitat Luberda Z: The role of glutathione in mammalian gametes. Reprod Biol. 2005, 5 (1): 5-17. Luberda Z: The role of glutathione in mammalian gametes. Reprod Biol. 2005, 5 (1): 5-17.
44.
Zurück zum Zitat de Matos DG, Furnus CC: The importance of having high glutathione (GSH) level after bovine in vitro maturation on embryo development effect of beta-mercaptoethanol, cysteine and cystine. Theriogenology. 2000, 53 (3): 761-771. 10.1016/S0093-691X(99)00278-2.CrossRef de Matos DG, Furnus CC: The importance of having high glutathione (GSH) level after bovine in vitro maturation on embryo development effect of beta-mercaptoethanol, cysteine and cystine. Theriogenology. 2000, 53 (3): 761-771. 10.1016/S0093-691X(99)00278-2.CrossRef
45.
Zurück zum Zitat Feugang JM, de Roover R, Moens A, Leonard S, Dessy F, Donnay I: Addition of beta-mercaptoethanol or Trolox at the morula/blastocyst stage improves the quality of bovine blastocysts and prevents induction of apoptosis and degeneration by prooxidant agents. Theriogenology. 2004, 61 (1): 71-90. 10.1016/S0093-691X(03)00191-2.CrossRef Feugang JM, de Roover R, Moens A, Leonard S, Dessy F, Donnay I: Addition of beta-mercaptoethanol or Trolox at the morula/blastocyst stage improves the quality of bovine blastocysts and prevents induction of apoptosis and degeneration by prooxidant agents. Theriogenology. 2004, 61 (1): 71-90. 10.1016/S0093-691X(03)00191-2.CrossRef
46.
Zurück zum Zitat Furnus CC, de Matos DG, Picco S, Garcia PP, Inda AM, Mattioli G, Errecalde AL: Metabolic requirements associated with GSH synthesis during in vitro maturation of cattle oocytes. Anim Reprod Sci. 2008, 109 (1-4): 88-99. 10.1016/j.anireprosci.2007.12.003.CrossRef Furnus CC, de Matos DG, Picco S, Garcia PP, Inda AM, Mattioli G, Errecalde AL: Metabolic requirements associated with GSH synthesis during in vitro maturation of cattle oocytes. Anim Reprod Sci. 2008, 109 (1-4): 88-99. 10.1016/j.anireprosci.2007.12.003.CrossRef
47.
Zurück zum Zitat Van Soom A, Yuan YQ, Peelman LJ, de Matos DG, Dewulf J, Laevens H, de Kruif A: Prevalence of apoptosis and inner cell allocation in bovine embryos cultured under different oxygen tensions with or without cysteine addition. Theriogenology. 2002, 57 (5): 1453-1465. 10.1016/S0093-691X(01)00726-9.CrossRef Van Soom A, Yuan YQ, Peelman LJ, de Matos DG, Dewulf J, Laevens H, de Kruif A: Prevalence of apoptosis and inner cell allocation in bovine embryos cultured under different oxygen tensions with or without cysteine addition. Theriogenology. 2002, 57 (5): 1453-1465. 10.1016/S0093-691X(01)00726-9.CrossRef
48.
Zurück zum Zitat Bing YZ, Hirao Y, Iga K, Che LM, Takenouchi N, Kuwayama M, Fuchimoto D, Rodriguez-Martinez HTN: In vitro maturation and glutathione synthesis of porcine oocytes in the presence or absence of cysteamine under different oxygen tensions: role of cumulus cells. Reprod Fertil Dev. 2002, 14 (3): 125-131. 10.1071/RD01127.CrossRef Bing YZ, Hirao Y, Iga K, Che LM, Takenouchi N, Kuwayama M, Fuchimoto D, Rodriguez-Martinez HTN: In vitro maturation and glutathione synthesis of porcine oocytes in the presence or absence of cysteamine under different oxygen tensions: role of cumulus cells. Reprod Fertil Dev. 2002, 14 (3): 125-131. 10.1071/RD01127.CrossRef
49.
Zurück zum Zitat Ozawa M, Nagai T, Fahrudin M, Karja NWK, Kaneko H, Noguchi J, Ohnuma K, Kikuchi K: Addition of glutathione or thioredoxin to culture medium reduces intracellular redox status of porcine IVM/IVF embryos, resulting in improved development to the blastocyst stage. Mol Reprod Dev. 2006, 73 (8): 998-1007. 10.1002/mrd.20533.CrossRef Ozawa M, Nagai T, Fahrudin M, Karja NWK, Kaneko H, Noguchi J, Ohnuma K, Kikuchi K: Addition of glutathione or thioredoxin to culture medium reduces intracellular redox status of porcine IVM/IVF embryos, resulting in improved development to the blastocyst stage. Mol Reprod Dev. 2006, 73 (8): 998-1007. 10.1002/mrd.20533.CrossRef
50.
Zurück zum Zitat Yang M, Rajamahendran R: Expression of Bcl-2 and Bax proteins in relation to quality of bovine oocytes and embryos produced in vitro. Anim Reprod Sci. 2002, 70 (3-4): 159-169. 10.1016/S0378-4320(01)00186-5.CrossRef Yang M, Rajamahendran R: Expression of Bcl-2 and Bax proteins in relation to quality of bovine oocytes and embryos produced in vitro. Anim Reprod Sci. 2002, 70 (3-4): 159-169. 10.1016/S0378-4320(01)00186-5.CrossRef
Metadaten
Titel
In vitroeffects of relaxin on gene expression in porcine cumulus-oocyte complexes and developing embryos
verfasst von
Jean M Feugang
Jonathan M Greene
Scott T Willard
Peter L Ryan
Publikationsdatum
01.12.2011
Verlag
BioMed Central
Erschienen in
Reproductive Biology and Endocrinology / Ausgabe 1/2011
Elektronische ISSN: 1477-7827
DOI
https://doi.org/10.1186/1477-7827-9-15

Weitere Artikel der Ausgabe 1/2011

Reproductive Biology and Endocrinology 1/2011 Zur Ausgabe

Blutdrucksenkung könnte Uterusmyome verhindern

Frauen mit unbehandelter oder neu auftretender Hypertonie haben ein deutlich erhöhtes Risiko für Uterusmyome. Eine Therapie mit Antihypertensiva geht hingegen mit einer verringerten Inzidenz der gutartigen Tumoren einher.

„Übersichtlicher Wegweiser“: Lauterbachs umstrittener Klinik-Atlas ist online

17.05.2024 Klinik aktuell Nachrichten

Sie sei „ethisch geboten“, meint Gesundheitsminister Karl Lauterbach: mehr Transparenz über die Qualität von Klinikbehandlungen. Um sie abzubilden, lässt er gegen den Widerstand vieler Länder einen virtuellen Klinik-Atlas freischalten.

Antikörper-Wirkstoff-Konjugat hält solide Tumoren in Schach

16.05.2024 Zielgerichtete Therapie Nachrichten

Trastuzumab deruxtecan scheint auch jenseits von Lungenkrebs gut gegen solide Tumoren mit HER2-Mutationen zu wirken. Dafür sprechen die Daten einer offenen Pan-Tumor-Studie.

Mammakarzinom: Senken Statine das krebsbedingte Sterberisiko?

15.05.2024 Mammakarzinom Nachrichten

Frauen mit lokalem oder metastasiertem Brustkrebs, die Statine einnehmen, haben eine niedrigere krebsspezifische Mortalität als Patientinnen, die dies nicht tun, legen neue Daten aus den USA nahe.

Update Gynäkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert – ganz bequem per eMail.