Skip to main content
Erschienen in: BMC Infectious Diseases 1/2017

Open Access 01.12.2017 | Research article

Incidence of human rabies and characterization of rabies virus nucleoprotein gene in dogs in Fujian Province, Southeast China, 2002–2012

verfasst von: Jian-Ming Zhang, Zhi-Shan Zhang, Yan-Qin Deng, Shou-Li Wu, Wei Wang, Yan-Sheng Yan

Erschienen in: BMC Infectious Diseases | Ausgabe 1/2017

Abstract

Background

Rabies is a global fatal infectious viral disease that is characterized by a high mortality after onset of clinical symptoms. Recently, there has been an increase in the incidence of rabies in China. The aim of this study was to investigate the incidence of human rabies and characterize the rabies virus nucleoprotein gene in dogs sampled from Fujian Province, Southeast China from 2002 to 2012.

Methods

Data pertaining to human rabies cases in Fujian Province during the period from 2002 through 2012 were collected, and the epidemiological profiles were described. The saliva and brain specimens were collected from dogs in Quanzhou, Longyan and Sanming cities of the province, and the rabies virus antigen was determined in the canine saliva specimens using an ELISA assay. Rabies virus RNA was extracted from canine brain specimens, and rabies virus nucleoprotein gene was amplified using a nested RT-PCR assay, followed by sequencing and genotyping.

Results

A total of 226 human rabies cases were reported in Fujian Province from 2002 to 2012, in which 197 cases were detected in three cities of Quanzhou, Longyan and Sanming. ELISA assay revealed positive rabies virus antigen in six of eight rabid dogs and 165 of 3492 seemingly healthy dogs. The full-length gene fragment of the rabies virus nucleoprotein gene was amplified from the brain specimens of seven rabid dogs and 12 seemingly healthy dogs. Sequence alignment and phylogenetic analysis revealed that these 19 rabies virus nucleoprotein genes all belonged to genotype I, and were classified into three genetic groups. Sequencing analysis showed a 99.7% to 100% intra-group and an 86.4% to 89.3% inter-group homology.

Conclusions

This study is the first description pertaining to the epidemiological characteristics of human rabies cases and characterization of the rabies virus nucleoprotein gene in dogs in Fujian Province, Southeast China. Our findings may provide valuable knowledge for the development of strategies targeting the prevention and control of rabies.
Abkürzungen
CDC
Center for Disease Control and Prevention
ELISA
Enzyme-linked immunosorbent assay
G protein
Glycoprotein
L protein
Polymerase
M protein
Matrix protein
N protein
Nucleoprotein protein
P protein
Phosphoprotein
RT-PCR
Reverse transcription polymerase chain reaction

Background

Rabies is a fatal disease that is mainly transmitted by the bites of dogs. Globally, rabies is responsible for approximately 55,000 deaths each year [1]. In China, a total of 108,412 human rabies cases have been reported between 1950 and 2004, yielding to India as a country with the second highest number of rabies victims [2].
During the past decade, there has been a sharp increase in the incidence of human rabies in Fujian Province, Southeast China [35]. This trend reflects a rapid increase in the number of domestic dogs that lack effective canine vaccination and control measures, especially in the countryside [6]. However, the incidence of human rabies and the genotypes of dog rabies viruses remain unknown in Southeast China until now. This study aimed to investigate the incidence of human rabies and characterize dog rabies virus in Fujian province, Southeast China from 2002 to 2012.

Methods

Ethical statement

This study was approved by the Ethical Review Committee of Fujian Provincial Center for Disease Control and Prevention (CDC) (permission number: FJCDC-001207), and the study protocol was reviewed by the Institutional Review Board of Fujian CDC. All animal experiments were performed according to the Guidelines for the Care and Use of Laboratory Animals, and written informed consent was obtained from all human rabies cases described in this study.

Collection of human rabies cases

The data pertaining to human rabies cases were captured from the annual reports of Fujian CDC (Fuzhou, China) during the period from 2002 through 2012, and the epidemiological profile of the cases was described.

Canine samples

Dogs were sampled from Quanzhou, Longyan and Sanming cities, which had the highest incidence of human rabies in Fujian Province, Southeast China (Fig. 1). Table 1 shows the geographical origin and date of collection of all canine samples for the amplification of the rabies viral nucleoprotein (N) gene.
Table 1
Geographical origin and time of collection of the 19 dog samples used for amplification of the rabies virus nucleoprotein gene
Numbering of dog samples
Numbering of rabies virus isolates
Geographical origin of dog samples
Status of dogs
Time of sample collection
LY19
FJ001
Longyan
Seemingly healthy dogs
03/2007
LY36
FJ002
Longyan
Seemingly healthy dogs
03/2007
LY31
FJ003
Longyan
Seemingly healthy dogs
04/2007
QZ27
FJ004
Quanzhou
Seemingly healthy dogs
03/2007
QZ 31
FJ005
Quanzhou
Seemingly healthy dogs
03/2007
QZ 196
FJ006
Quanzhou
Seemingly healthy dogs
03/2007
QZ 260
FJ007
Quanzhou
Seemingly healthy dogs
03/2007
SM9
FJ008
Sanming
Rabies suspected dogs
11/2008
SM10
FJ009
Sanming
Rabies suspected dogs
11/2008
SM11
FJ010
Sanming
Rabies suspected dogs
01/2009
SM12
FJ011
Sanming
Rabies suspected dogs
01/2009
LY47
FJ012
Longyan
Seemingly healthy dogs
04/2007
LY48
FJ013
Longyan
Seemingly healthy dogs
03/2007
LY55
FJ014
Longyan
Seemingly healthy dogs
04/2007
SM2
FJ015
Sanming
Seemingly healthy dogs
11/2008
SM5
FJ016
Sanming
Seemingly healthy dogs
11/2008
SM14
FJ017
Sanming
Rabies suspected dogs
02/2009
SM15
FJ018
Sanming
Rabies suspected dogs
02/2009
SM16
FJ019
Sanming
Rabies suspected dogs
02/2009

Detection of rabies virus antigen in dog saliva

Saliva specimens were collected from both rabid and seemingly healthy dogs housed in nine randomly selected villages from each city. For saliva sampling, each dog was housed in a cage, and sterile Q-tips/cotton balls were placed in mouth until Q-tips/cotton balls were thoroughly soaked by the saliva. Saliva specimens were kept in cold storage, immediately transferred to laboratory, pretreated by centrifugation and stored at −20 °C for subsequent tests. The rabies virus antigen was detected in saliva specimens using an enzyme-linked immunosorbent assay (ELISA) kit (Wuhan Institute of Biological Products; Wuhan, China) following the manufacturer’s protocol. In this study, a rabid dog was defined as a dog that actively attacked humans and animals and presented sympathetic hyperfunction, which showed manifestations of salivation, manic agitation and disturbance of consciousness.

Amplification, cloning, sequencing and phylogenetic analysis of N gene in dog brain

A total of eight rabid dogs were sacrificed, and 81 seeming healthy (asymptomatic) dogs were euthanized. Canine brain tissues were collected and stored at −70 °C for the subsequent experiments. Total RNA was extracted from canine brain specimens using a Trizol reagent (Invitrogen; Carlsbad, CA, USA) according to the manufacturer’s instructions. N gene was amplified from the brain specimens using a nested reverse transcription polymerase chain reaction (RT-PCR) assay [7] with the primers described in Table 2 [8], while primers N1/N2 and N3/N4 were used for detection of virus nucleic acid, and primers N1/N5 and N6/N2 were used for the amplification of full-length N gene (Table 2).
Table 2
Primers used for nested RT-PCR amplification of the rabies virus nucleoprotein gene
Primer
Sequence (5′-3′)
Direction
Positions in genome
Paired primer
Product size (bp)
N1
ACAGACAGCGTCASATTGCAAAGC
Upstream
29–50
N2
1511
N2
TCGGATTGACGAAGATCTTGCTC
Downstream
1517–1539
N1
1511
N3
TTTGAGACTGCTCCTTTT
Upstream
587–605
N4
443
N4
CCCATATAGCATCCTAC
Downstream
1013–1029
N3
443
N5
CAGTCTCYTCNGCCATCT
Downstream
1570–1587
N1
1559
N6
ATGTAACACCTCTACAATGG
Upstream
55–74
N2
1485
PCR products were purified with the PCR product extraction kit (Omega Bio-Tek, Inc., Norcross, GA, USA), and cloned into the pMD18-T vector with a TA cloning kit (TaKaRa; Dalian, China) following the manufacturers’ instructions. Transformed clones were identified by restriction enzyme digestion and subjected to DNA sequencing. To increase the accuracy, we selected three clones of each fragment for sequencing. The sequence of the three clones that exhibited 100% homology was identified as the target sequence. Sequences were then aligned and compared with the N gene sequences of the reference strains obtained from GenBank using the software Bioedit version 7.0.1 (DNASTAR, Inc.; Madison, WI, USA) and MEGA version 4.0.

Data analysis

All data were entered into Microsoft Excel 2007 (Microsoft, Inc.; Redmond, WA, USA), and all statistical analyses were performed using the statistical software SPSS version 13.0 (SPSS, Inc.; Chicago, IL, USA). Differences of proportions were tested for statistical significance using chi-square test, and a P value <0.05 was considered statistically significant.

Results

Epidemiological profile of human rabies cases

During the period from 2002 to 2012, a total of 226 human rabies cases were reported in Fujian Province, Southeast China. The cases included 147 men and 79 women, and had a mean age of 34.6 years (range, 1 to 88 years). The professions included farmers (138 cases), students (29 cases), workers (22 cases), preschool-aged children (14 cases), housekeepers (13 cases), and unknown (10 cases). The human cases were distributed across Fujian Province, including Quanzhou (85 cases), Longyan (67 cases), Sanming (47 Cases), Nanping (11 cases), Ningde (10 cases), Xiamen (3 cases), Fuzhou (1 case), Pingtan (1 case) and Putian (1 case), and 88.1% cases were reported in the three cities of Quanzhou, Longyan and Sanming. The annual number of human rabies cases is shown in Fig. 2.

Rabies virus antigen in canine saliva

To investigate the incidence of rabies virus antigen in canine populations, a total of eight rabid dogs and 3492 seemingly healthy dogs were randomly selected from 27 villages of Quanzhou, Longyan and Sanming cities, of nine villages in each city, and dog saliva samples were collected. There were six of eight rabid dogs (75%) with detectable rabies viral antigen, and surprisingly, 165 of 3492 seemingly healthy dogs (4.7%) were positive for rabies virus antigens in saliva samples, suggesting that a considerable proportion of asymptomatic seemingly healthy dogs carries rabies virus (Fig. 3). There was a statistical significance in the incidence of rabies viral antigen between rabid and seemingly healthy dogs (P < 0.01).

N gene fragments in canine brain specimens

Nested RT-PCR assay detected a 443 bp viral gene fragment in the brain specimens from seven of eight rabid dogs (87.5%) and 12 of 81 seemingly healthy dogs (14.8%), and then, all fragments were amplified with primers N1/N2 and N3/N4. Subsequently, the full-length N gene (1485 bp) was obtained from these positive specimens with primers N1/N5 and N6/N2. The amplicons were cloned into the pMD18-T vector, and subjected to DNA sequencing (GenBank accession numbers: FJ561726-FJ561732, FJ866827-FJ866831 and FJ866834-FJ866836).

Phylogenetic analysis of full-length N genes

Putative amino acid sequences of the 19 nucleoproteins were compared with the reference N gene sequence available in GenBank. Based on sequence alignment and phylogenetic tree analysis, these 19 N genes were characterized as the genotype I rabies virus, although three distinct clusters were found to be geographic region-specific (Groups A to C) (Fig. 4). Sequencing analyses revealed 99.7% to 100% intra-group homology of N genes, and 86.4% to 89.3% inter-group homology at a nucleotide level, and 98.9% to 100% intra-group homology and 95.3% to 98.4% inter-group homology at an amino acid level, respectively.

Discussion

Analysis of the 1960–2014 notifiable surveillance data showed that rabies is still a serious public health concern in China, with a total of 120,913 human rabies cases reported in mainland China, including 19.8% cases observed during the period from 2004 through 2014 [9]. The highest incidence was recorded in 1981 (0.71/100,000), and in 2007 (0.25/100,000), and 59% of total cases were reported from June to November, including 11.0% of total cases observed in August. In addition, human rabies cases were reported in all provinces of in China, and the eastern and southern regions were more seriously affected relative to other regions [9]. Fujian Province is located in Southeast China, and is a high-risk environment for rabies [10]. The notifiable surveillance data showed 1894 human rabies cases during 1980–1989, 165 human cases during 1990–2000 [11], 206 human cases in 2000–2007 [12], and 123 human cases from 2006 to 2010 [5]. In 2013, only two human rabies cases and two deaths were observed in Fujian Province [13]. These data demonstrates an overall steady decline of human rabies cases in Fujian Province, Southeast China since 1980.
Rabies virus has a single-stranded, antisense, nonsegmented RNA virus genome (approximately 12 kb) encoding five viral proteins, including glycoprotein (G), nucleoprotein (N), phosphoprotein (P), matrix protein (M) and polymerase (L) [14]. N gene is highly conserved within the same subtype, and variations in this region can be used for virus subtyping and genotyping [15]. Nucleoprotein can protect viral nucleic acid from being damaged by host cell nuclease [16], and is one of the major protective antigens that induce cell-mediated immunity against rabies virus infection [17]. Molecular characterization of rabies virus N genes has been performed in some provinces of China [1820]; however, the genotypes of dog rabies viruses remain unclear in Fujian Province, Southeast China to date.
This study is the first survey on rabies incidence in domestic dogs in Fujian Province, Southeast China. Saliva specimens, which were collected from rabid and seemingly healthy dogs in 27 villages of Quanzhou, Longyan and Sanming cities, were detected for rabies virus antigen by an ELISA assay, and 4.7% of seemingly healthy dogs were positive for rabies virus antigens. Then, dogs with ELISA-positive saliva were sacrificed and brain specimens were sampled for the subsequent nested RT-PCR assay. Surprisingly, nested RT-PCR assay detected a 443 bp viral N gene fragment in the brain specimens of 14.8% (12/81) of seemingly healthy dogs. The results suggest that there are a considerable proportion of false negatives in preliminary screening by ELISA. Indeed, the reliability, reproducibility and diagnostic value of rabies virus antigen detection remain in debate in canine saliva since the complicated components in saliva specimens may affect ELISA assays, and no standardized kits are available in market until now [2123]. In addition, virus release occurs at limited intervals in infected dogs, and the difference in sampling time-points may partially contribute to great variations in rabies virus detection among different geographical regions, even inconsistent with local epidemiological conditions.
Sequencing analysis of the 19 full-length N genes revealed over 80% nucleotide and amino acid homology between rabies viral isolates form Fujian Province and other strains globally. Our findings demonstrate that seemingly healthy dogs may serve as carriers of rabies virus. Although the virus samples were captured from only three cities of the province, a considerable proportion of infected dogs inhabited in the communities without any obvious symptoms for a period of time, which is inconsistent with previous reports [2426]. Nested RT-PCR assay established in this study was found to be more sensitive in detection of rabies in seemingly healthy dogs. The mechanism for infected dogs without illness onset is still unclear; however, seemingly healthy dogs have important values in public health and cannot be neglected.
Canine vaccination has been shown to be the most effective approach for the prevention of human rabies, and it is theoretically possible to eliminate cases of the deadly rabies virus in people worldwide through mass canine vaccination [27]. However, the majority of dogs in the developing world are not given vaccination, such as India, China, and Pakistan, which challenges the control efforts and global rabies elimination program [27]. Currently, the most widely used veterinary rabies vaccines include inactivated, attenuated and genetically engineered vaccines in the world [28, 29]. In China, only veterinary inactivated and attenuated rabies vaccines are available [30]. In this study, most of the dogs were free-ranging dogs in rural areas, which did not receive vaccination. It is therefore suggested that, on one hand, rabies virus vaccine inoculation for domestic animals like dogs and cats should be popularized for rabies prevention and control; on other hand, if a dog has no history of definite vaccination, medical personnel should give a standard treatment to dog-bitten outpatients, and vaccinate them according to recommended vaccination protocols, regardless of health status.
To date, there have been seven genotypes of rabies virus characterized [31]. Based on the sequence of the rabies virus N gene, six clearly distinct genotypes were distinguished according to their percentage of amino acid similarity, including the vaccinal and classical rabies viruses of genotype 1, genotypes 2 (Lagos bat virus) and 3 (Mokola virus), genotypes 4 (Duvenhage virus) and 5 (EBL1) and genotype 6 represented by European bat lyssaviruses (EBL) serotype 2 (EBLV-2) [32]. In addition, genotype 7 (Australian bat lyssavirus, ABLV) was isolated from Australian bats [33]. Currently, the majority of the rabies viruses isolated from human cases were characterized as genotype 1 [30]. In the present study, sequencing analysis revealed that the 19 full-length rabies virus N genes belonged to genotype I. According to their geographical origins, three distinct clusters (groups A, B, and C) were originated exclusively from western, northern and southern Fujian, respectively, which is in agreement with previous studies [3436]. Phylogenetic analysis showed that the viral isolates in Group A shared the highest homology with a Guangxi isolate GX091, while viral isolates in Group B shared the highest homology with a Beijing isolate (Beijing Hu1). Notably, the viral isolates in Group C shared the highest homology with a vaccine strain 3aG and Nishigahara, a Japanese strain of veterinary vaccine. As a southeast coastal province of China, the complexity of rabies virus distribution in Fujian may reflect its geographic location with rapid economic development and frequent international communications. However, the detailed routes for rabies virus transmission cannot be determined among different cities to date, since limited molecular evidence is available in Fujian and neighboring regions.
The present study has several limitations. First, ELISA-positive saliva samples were not confirmed by RT-PCR. Our nested RT-PCR, which was employed to detect viral N gene in the brain specimens of dogs with ELISA-positive saliva samples, showed the low sensitivity (14.8%) of ELISA for the detection of rabies virus antigens in canine saliva specimens. As described above, ELISA detection is affected by multiple factors. Fortunately, the phylogenetic analysis is not affected, since the full-length N gene was amplified from PCR-positive samples. Second, we did not observe the dogs with ELISA-positive saliva samples for a period of time to see the eventual development of rabies or not. Third, we did not detect G gene in the canine samples. Currently, the rabies virus vaccine strains are CTN, 3aG, PV and Flury in Fujian province, and veterinary vaccine strains are ERA and SAD. Since G protein is the major inducer of protective immunity against rabies [37], we cannot link our findings with the rabies vaccination in Fujian Province.

Conclusions

This is the first description pertaining to the epidemiological characteristics of human rabies cases and characterization of the rabies virus N gene in dogs in Fujian Province, Southeast China. Our findings may provide valuable knowledge for the development of strategies targeting the prevention and control of rabies. Further extensive surveillance is required to track virus evolution, and infection status in dogs and other carrier species.

Acknowledgements

We would like to thank the staff from the Department of Natural Foci Diseases, Fujian Provincial Center for Disease Control and Prevention for their kind participation in the field work. Many thanks are addressed to Dr. Yu-Ping Wang from Fujian International Travel Healthcare Center for his kind help during data collection and writing of the manuscript.

Funding

This study was supported by the grants from the Natural Science Foundation of Fujian Province (grant nos. 2012 J05133 and 2015 J01152), Fujian Provincial Medical Innovation Projects (grant no. 2007-CX-5) and Jiangsu Provincial Medical Youth Talent, the Project of Invigorating Health Care through Science, Technology and Education (grant no. QNRC2016621). The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Availability of data and materials

All data described in the study can be provided for free by contact with the corresponding author.

Ethics approval

This study was approved by the Ethical Review Committee of Fujian Provincial Center for Disease Control and Prevention (permission number: FJCDC-001207), and the study protocol was reviewed by the Institutional Review Board of Fujian Provincial Center for Disease Control and Prevention. All animal experiments were performed according to the Guidelines for the Care and Use of Laboratory Animals, and written informed consent was obtained from all human rabies cases described in this study.
Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://​creativecommons.​org/​licenses/​by/​4.​0/​), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://​creativecommons.​org/​publicdomain/​zero/​1.​0/​) applies to the data made available in this article, unless otherwise stated.
Literatur
2.
Zurück zum Zitat Yin W, Dong J, Tu C, Edwards J, Guo F, Zhou H, Yu H, Vong S, Rabies Technical and Advisory Board. Challenges and needs for China to eliminate rabies. Infect Dis Poverty. 2013;2:23.CrossRefPubMedPubMedCentral Yin W, Dong J, Tu C, Edwards J, Guo F, Zhou H, Yu H, Vong S, Rabies Technical and Advisory Board. Challenges and needs for China to eliminate rabies. Infect Dis Poverty. 2013;2:23.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Yu J, Li H, Tang Q, Rayner S, Han N, Guo Z, Liu H, Adams J, Fang W, Tao X, Wang S, Liang G. The spatial and temporal dynamics of rabies in China. PLoS Negl Trop Dis. 2012;6:e1640.CrossRefPubMedPubMedCentral Yu J, Li H, Tang Q, Rayner S, Han N, Guo Z, Liu H, Adams J, Fang W, Tao X, Wang S, Liang G. The spatial and temporal dynamics of rabies in China. PLoS Negl Trop Dis. 2012;6:e1640.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Xie ZH, Huang WL, Hong RT, Li H, Xiang JJ. Analysis of the epidemiological trends of human rabies in Fujian province, 2004-2007. Dis Surveill. 2009;24:37–9. Xie ZH, Huang WL, Hong RT, Li H, Xiang JJ. Analysis of the epidemiological trends of human rabies in Fujian province, 2004-2007. Dis Surveill. 2009;24:37–9.
5.
Zurück zum Zitat Xiao FZ, Deng YQ, Chen L, Wang LL. Epidemiological characteristics of rabies in Fujian Province, 2006-2010. Chin J Dis Control Prev. 2012;16:917–8. Xiao FZ, Deng YQ, Chen L, Wang LL. Epidemiological characteristics of rabies in Fujian Province, 2006-2010. Chin J Dis Control Prev. 2012;16:917–8.
7.
Zurück zum Zitat Picard-Meyer E, Bruyère V, Barrat J, Tissot E, Barrat MJ, Cliquet F. Development of a hemi-nested RT-PCR method for the specific determination of European Bat Lyssavirus 1. Comparison with other rabies diagnostic methods. Vaccine. 2004;22:1921–9.CrossRefPubMed Picard-Meyer E, Bruyère V, Barrat J, Tissot E, Barrat MJ, Cliquet F. Development of a hemi-nested RT-PCR method for the specific determination of European Bat Lyssavirus 1. Comparison with other rabies diagnostic methods. Vaccine. 2004;22:1921–9.CrossRefPubMed
8.
Zurück zum Zitat Liu Q, Xiong Y, Luo TR, Wei YC, Nan SJ, Liu F, Pan Y, Feng L, Zhu W, Liu K, Guo JG, Li HM. Molecular epidemiology of rabies in Guangxi Province, south of China. J Clin Virol. 2007;39:295–303.CrossRefPubMed Liu Q, Xiong Y, Luo TR, Wei YC, Nan SJ, Liu F, Pan Y, Feng L, Zhu W, Liu K, Guo JG, Li HM. Molecular epidemiology of rabies in Guangxi Province, south of China. J Clin Virol. 2007;39:295–303.CrossRefPubMed
9.
Zurück zum Zitat Zhou H, Vong S, Liu K, Li Y, Mu D, Wang L, Yin W, Yu H. Human rabies in China, 1960-2014: a descriptive epidemiological study. PLoS Negl Trop Dis. 2016;10:e0004874.CrossRefPubMedPubMedCentral Zhou H, Vong S, Liu K, Li Y, Mu D, Wang L, Yin W, Yu H. Human rabies in China, 1960-2014: a descriptive epidemiological study. PLoS Negl Trop Dis. 2016;10:e0004874.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Wu X, Hu R, Zhang Y, Dong G, Rupprecht CE. Reemerging rabies and lack of systemic surveillance in People's Republic of China. Emerg Infect Dis. 2009;15(8):1159–64.CrossRefPubMedPubMedCentral Wu X, Hu R, Zhang Y, Dong G, Rupprecht CE. Reemerging rabies and lack of systemic surveillance in People's Republic of China. Emerg Infect Dis. 2009;15(8):1159–64.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Chen Y, Liu JM, Jiang AM. Rabies epidemics and surveillance in Fujian Province during the latest 20 years. Strait J Prev Med. 2002;8:36–7. Chen Y, Liu JM, Jiang AM. Rabies epidemics and surveillance in Fujian Province during the latest 20 years. Strait J Prev Med. 2002;8:36–7.
12.
Zurück zum Zitat Wang LL. Rabies epidemics and control in Fujian Province from 2000 to 2007. Strait J Prev Med. 2009;15:29–31. Wang LL. Rabies epidemics and control in Fujian Province from 2000 to 2007. Strait J Prev Med. 2009;15:29–31.
13.
Zurück zum Zitat Xiao FZ, Deng YQ, Chen L, Wang LL. Analysis on surveillance of human rabies, Fujian Province, 2013. Prev Med Trib. 2015;21:694–6. Xiao FZ, Deng YQ, Chen L, Wang LL. Analysis on surveillance of human rabies, Fujian Province, 2013. Prev Med Trib. 2015;21:694–6.
14.
Zurück zum Zitat Rupprecht C, Hanlon CA, Hemachudha T. Rabies re-examined. Lancet Infect Dis. 2002;2:327–43.CrossRefPubMed Rupprecht C, Hanlon CA, Hemachudha T. Rabies re-examined. Lancet Infect Dis. 2002;2:327–43.CrossRefPubMed
15.
Zurück zum Zitat Tordo N, Poch O, Ermine A, Keith G. Primary structure of leader RNA and nucleoprotein genes of the rabies genome: segmented homology with VSV. Nucleic Acids Res. 1986;6:2671–283.CrossRef Tordo N, Poch O, Ermine A, Keith G. Primary structure of leader RNA and nucleoprotein genes of the rabies genome: segmented homology with VSV. Nucleic Acids Res. 1986;6:2671–283.CrossRef
16.
Zurück zum Zitat Liu P, Yang J, Wu X, Fu ZF. Interactions amongst rabies virus nucleoprotein phosphoprotein and genomic RNA in virus infected and transfected cells. J Gen Virol. 2004;12:3725–34.CrossRef Liu P, Yang J, Wu X, Fu ZF. Interactions amongst rabies virus nucleoprotein phosphoprotein and genomic RNA in virus infected and transfected cells. J Gen Virol. 2004;12:3725–34.CrossRef
17.
Zurück zum Zitat Goto H, Minamoto N, Ito H, Ito N, Sugiyama M, Kinjo T, Kawai A. Mapping of epitopes and structural analysis of antigenic sites in the nucleoprotein of rabies virus. J Gen Virol. 2006;81:119–27.CrossRef Goto H, Minamoto N, Ito H, Ito N, Sugiyama M, Kinjo T, Kawai A. Mapping of epitopes and structural analysis of antigenic sites in the nucleoprotein of rabies virus. J Gen Virol. 2006;81:119–27.CrossRef
18.
Zurück zum Zitat Meng SL, Yan JX, Xu GL, Nadin-Davis SA, Ming PG, Liu SY, Wu J, Ming HT, Zhu FC, Zhou DJ, Xiao QY, Dong GM, Yang XM. A molecular epidemiological study targeting the glycoprotein gene of rabies virus isolates from China. Virus Res. 2006;124:125–38.CrossRefPubMed Meng SL, Yan JX, Xu GL, Nadin-Davis SA, Ming PG, Liu SY, Wu J, Ming HT, Zhu FC, Zhou DJ, Xiao QY, Dong GM, Yang XM. A molecular epidemiological study targeting the glycoprotein gene of rabies virus isolates from China. Virus Res. 2006;124:125–38.CrossRefPubMed
19.
Zurück zum Zitat Zhang HL, Zhang YZ, Yang WH, Tao XY, Li H, Ding JC, Feng Y, Yang DJ, Zhang J, He J, Shen XX, Wang LH, Zhang YZ, Song M, Tang Q. Molecular epidemiology of reemergent rabies in Yunnan Province, southwestern China. Emerg Infect Dis. 2014;20:1433–42. Zhang HL, Zhang YZ, Yang WH, Tao XY, Li H, Ding JC, Feng Y, Yang DJ, Zhang J, He J, Shen XX, Wang LH, Zhang YZ, Song M, Tang Q. Molecular epidemiology of reemergent rabies in Yunnan Province, southwestern China. Emerg Infect Dis. 2014;20:1433–42.
20.
Zurück zum Zitat Tao XY, Tang Q, Li H, Mo ZJ, Zhang H, Wang DM, Zhang Q, Song M, Velasco-Villa A, Wu X, Rupprecht CE, Liang GD. Molecular epidemiology of rabies in Southern People's Republic of China. Emerg Infect Dis. 2009;15:1192–8.CrossRefPubMedPubMedCentral Tao XY, Tang Q, Li H, Mo ZJ, Zhang H, Wang DM, Zhang Q, Song M, Velasco-Villa A, Wu X, Rupprecht CE, Liang GD. Molecular epidemiology of rabies in Southern People's Republic of China. Emerg Infect Dis. 2009;15:1192–8.CrossRefPubMedPubMedCentral
21.
Zurück zum Zitat Wang YJ, Qi FC, Xue XG, Li XB, Wang LN, Xie L, Wang Y, Xia QJ, Sui B, Zhang M, Wei T, Guo LJ. Development and application of ELISA method for rabies virus antigen. Chin J Biol. 2009;22:713–5. Wang YJ, Qi FC, Xue XG, Li XB, Wang LN, Xie L, Wang Y, Xia QJ, Sui B, Zhang M, Wei T, Guo LJ. Development and application of ELISA method for rabies virus antigen. Chin J Biol. 2009;22:713–5.
22.
Zurück zum Zitat Woldehiwet Z. Clinical laboratory advances in the detection of rabies virus. Clin Chim Acta. 2005;351:49–63.CrossRefPubMed Woldehiwet Z. Clinical laboratory advances in the detection of rabies virus. Clin Chim Acta. 2005;351:49–63.CrossRefPubMed
23.
24.
Zurück zum Zitat Fekadu M, Shaddock JH, Chandler FW, Baer GM. Rabies virus in the tonsils of a carrier dog. Arch Virol. 1983;78:37–47.CrossRefPubMed Fekadu M, Shaddock JH, Chandler FW, Baer GM. Rabies virus in the tonsils of a carrier dog. Arch Virol. 1983;78:37–47.CrossRefPubMed
25.
Zurück zum Zitat Kikkawa A, Uchida Y, Suwa Y, Taguchi K. A novel method for estimating the adaptive ability of guide dogs using salivary sIgA. J Vet Med Sci. 2005;67:707–12.CrossRefPubMed Kikkawa A, Uchida Y, Suwa Y, Taguchi K. A novel method for estimating the adaptive ability of guide dogs using salivary sIgA. J Vet Med Sci. 2005;67:707–12.CrossRefPubMed
26.
Zurück zum Zitat Zhang YZ, Fu ZF, Wang DM, Zhou JZ, Wang ZX, Lv TF, Xiong CL, Zou Y, Yao WR, Li MH, Dong GM, Xu GL, Niezgoda M, Kuzmin IV, Rupprecht CE. Investigation of the role of healthy dogs as potential carriers of rabies virus. Vector Borne Zoonotic Dis. 2008;8:313–9.CrossRefPubMed Zhang YZ, Fu ZF, Wang DM, Zhou JZ, Wang ZX, Lv TF, Xiong CL, Zou Y, Yao WR, Li MH, Dong GM, Xu GL, Niezgoda M, Kuzmin IV, Rupprecht CE. Investigation of the role of healthy dogs as potential carriers of rabies virus. Vector Borne Zoonotic Dis. 2008;8:313–9.CrossRefPubMed
27.
Zurück zum Zitat Davlin SL, Vonville HM. Canine rabies vaccination and domestic dog population characteristics in the developing world: a systematic review. Vaccine. 2012;30:3492–502.CrossRefPubMed Davlin SL, Vonville HM. Canine rabies vaccination and domestic dog population characteristics in the developing world: a systematic review. Vaccine. 2012;30:3492–502.CrossRefPubMed
28.
Zurück zum Zitat Frana TS, Clough NE, Gatewood DM, Rupprecht CE. Postmarketing surveillance of rabies vaccines for dogs to evaluate safety and efficacy. J Am Vet Med Assoc. 2008;232:1000–2.CrossRefPubMed Frana TS, Clough NE, Gatewood DM, Rupprecht CE. Postmarketing surveillance of rabies vaccines for dogs to evaluate safety and efficacy. J Am Vet Med Assoc. 2008;232:1000–2.CrossRefPubMed
29.
Zurück zum Zitat Lewis CE, Fry AM, Hermann JR, Siev D, Dusek DM, Gatewood DM. Potency testing of veterinary rabies vaccines: replacement of challenge by in vitro testing: considerations for development of alternative assays. Dev Biol (Basel). 2012;134:29–33. Lewis CE, Fry AM, Hermann JR, Siev D, Dusek DM, Gatewood DM. Potency testing of veterinary rabies vaccines: replacement of challenge by in vitro testing: considerations for development of alternative assays. Dev Biol (Basel). 2012;134:29–33.
30.
Zurück zum Zitat Zhu WY, Liang GD. Current status of canine rabies in China. Biomed Environ Sci. 2012;25:602–5.PubMed Zhu WY, Liang GD. Current status of canine rabies in China. Biomed Environ Sci. 2012;25:602–5.PubMed
31.
Zurück zum Zitat Singh R, Singh KP, Cherian S, Saminathan M, Kapoor S, Manjunatha Reddy GB, Panda S, Dhama K. Rabies - epidemiology, pathogenesis, public health concerns and advances in diagnosis and control: a comprehensive review. Vet Q. 2017;37:212–51.CrossRefPubMed Singh R, Singh KP, Cherian S, Saminathan M, Kapoor S, Manjunatha Reddy GB, Panda S, Dhama K. Rabies - epidemiology, pathogenesis, public health concerns and advances in diagnosis and control: a comprehensive review. Vet Q. 2017;37:212–51.CrossRefPubMed
32.
Zurück zum Zitat Bourhy H, Kissi B, Tordo N. Molecular diversity of the Lyssavirus genus. Virology. 1993;194:70–81.CrossRefPubMed Bourhy H, Kissi B, Tordo N. Molecular diversity of the Lyssavirus genus. Virology. 1993;194:70–81.CrossRefPubMed
33.
Zurück zum Zitat Speare R, Skerratt L, Foster R, Berger L, Hooper P, Lunt R, Blair D, Hansman D, Goulet M, Cooper S. Australian bat lyssavirus infection in three fruit bats from north Queensland. Commun Dis Intell. 1997;21:117–20.PubMed Speare R, Skerratt L, Foster R, Berger L, Hooper P, Lunt R, Blair D, Hansman D, Goulet M, Cooper S. Australian bat lyssavirus infection in three fruit bats from north Queensland. Commun Dis Intell. 1997;21:117–20.PubMed
34.
Zurück zum Zitat von Teichman BF, Thomson GR, Meredith CD, Nel LH. Molecular epidemiology of rabies virus in South Africa: evidence for two distinct virus groups. J Gen Virol. 1995;76:73–82.CrossRef von Teichman BF, Thomson GR, Meredith CD, Nel LH. Molecular epidemiology of rabies virus in South Africa: evidence for two distinct virus groups. J Gen Virol. 1995;76:73–82.CrossRef
35.
Zurück zum Zitat Yang DK, Shin EK, Oh YI, Kang HK, Lee KW, Cho SD, Song JY. Molecular epidemiology of rabies virus circulating in South Korea, 1998-2010. J Vet Med Sci. 2011;73:1077–82.CrossRefPubMed Yang DK, Shin EK, Oh YI, Kang HK, Lee KW, Cho SD, Song JY. Molecular epidemiology of rabies virus circulating in South Korea, 1998-2010. J Vet Med Sci. 2011;73:1077–82.CrossRefPubMed
36.
Zurück zum Zitat Song M, Tang Q, Wang DM, Mo ZJ, Guo SH, Li H, Tao XY, Rupprecht CE, Feng ZJ, Liang GD. Epidemiological investigations of human rabies in China. BMC Infect Dis. 2009;9:210.CrossRefPubMedPubMedCentral Song M, Tang Q, Wang DM, Mo ZJ, Guo SH, Li H, Tao XY, Rupprecht CE, Feng ZJ, Liang GD. Epidemiological investigations of human rabies in China. BMC Infect Dis. 2009;9:210.CrossRefPubMedPubMedCentral
37.
Zurück zum Zitat Dietzschold B, Wang HH, Rupprecht CE, Celis E, Tollis M, Ertl H, Heber-Katz E, Koprowski H. Induction of protective immunity against rabies by immunization with rabies virus ribonucleoprotein. Proc Natl Acad Sci U S A. 1987;84:9165–9.CrossRefPubMedPubMedCentral Dietzschold B, Wang HH, Rupprecht CE, Celis E, Tollis M, Ertl H, Heber-Katz E, Koprowski H. Induction of protective immunity against rabies by immunization with rabies virus ribonucleoprotein. Proc Natl Acad Sci U S A. 1987;84:9165–9.CrossRefPubMedPubMedCentral
Metadaten
Titel
Incidence of human rabies and characterization of rabies virus nucleoprotein gene in dogs in Fujian Province, Southeast China, 2002–2012
verfasst von
Jian-Ming Zhang
Zhi-Shan Zhang
Yan-Qin Deng
Shou-Li Wu
Wei Wang
Yan-Sheng Yan
Publikationsdatum
01.12.2017
Verlag
BioMed Central
Erschienen in
BMC Infectious Diseases / Ausgabe 1/2017
Elektronische ISSN: 1471-2334
DOI
https://doi.org/10.1186/s12879-017-2698-9

Weitere Artikel der Ausgabe 1/2017

BMC Infectious Diseases 1/2017 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Notfall-TEP der Hüfte ist auch bei 90-Jährigen machbar

26.04.2024 Hüft-TEP Nachrichten

Ob bei einer Notfalloperation nach Schenkelhalsfraktur eine Hemiarthroplastik oder eine totale Endoprothese (TEP) eingebaut wird, sollte nicht allein vom Alter der Patientinnen und Patienten abhängen. Auch über 90-Jährige können von der TEP profitieren.

Niedriger diastolischer Blutdruck erhöht Risiko für schwere kardiovaskuläre Komplikationen

25.04.2024 Hypotonie Nachrichten

Wenn unter einer medikamentösen Hochdrucktherapie der diastolische Blutdruck in den Keller geht, steigt das Risiko für schwere kardiovaskuläre Ereignisse: Darauf deutet eine Sekundäranalyse der SPRINT-Studie hin.

Bei schweren Reaktionen auf Insektenstiche empfiehlt sich eine spezifische Immuntherapie

Insektenstiche sind bei Erwachsenen die häufigsten Auslöser einer Anaphylaxie. Einen wirksamen Schutz vor schweren anaphylaktischen Reaktionen bietet die allergenspezifische Immuntherapie. Jedoch kommt sie noch viel zu selten zum Einsatz.

Therapiestart mit Blutdrucksenkern erhöht Frakturrisiko

25.04.2024 Hypertonie Nachrichten

Beginnen ältere Männer im Pflegeheim eine Antihypertensiva-Therapie, dann ist die Frakturrate in den folgenden 30 Tagen mehr als verdoppelt. Besonders häufig stürzen Demenzkranke und Männer, die erstmals Blutdrucksenker nehmen. Dafür spricht eine Analyse unter US-Veteranen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.