Background
Ankylosing spondylitis (AS) is the representative rheumatic disease of seronegative spondyloarthropathy and is characterized primarily by recurrent inflammatory back pain and bilateral sacroiliitis [
1]. Hip ankylosis, which is typically accompanied by enthesis heterotopic ossification (HO), occurs in about one-third of patients suffering from AS [
2]. Entheopathy in peripheral and axial sites induces distinct pathologic changes, and inflammatory enthesitis is clinically detectable in approximately 10% of patients suffering from early-stage AS and 50% of those suffering from established AS [
3]. Fibroblasts are the most numerous connective tissue cells in enthesis or ligament tissue (LT) and are reported to be associated with heterotopic ossification (HO) in LT [
4,
5]. However, the relevant mechanism by which fibroblasts mediate HO remains unclear.
CCL19, CCL21 and their corresponding receptor CCR7 are described to be crucially involved in the adaptive immune system, their primary role being the migration of monocytes/macrophages, mature dendritic cells (DCs) and naive T cells to lymph nodes [
6‐
9]. Studies have demonstrated that CCR7 is responsible for the migration of T cells into inflamed tissues and T-cell egress from these tissues via the afferent lymph under inflammatory conditions [
10] and that CCR7 knockout attenuates the development of diseases such as coronary sclerosis [
11]. Moreover, CCR7 signaling is considered to mediate both angiogenesis and tumor metastasis in different tumor microenvironments [
12‐
14].
The effects of these two chemokines on proliferation, adhesin and/or integrin avidity, invasiveness, endocytosis, differentiation and survival have been comprehensively summarized in a prospective review [
15].
Numerous studies have revealed their respective roles in immune diseases, such as rheumatoid arthritis (RA), eosinophilic pneumonia, breast cancer and acquired immune deficiency syndrome (AIDS) [
16‐
18]. A recent study demonstrated that CCL19 was more strongly expressed in systemic sclerosis (SSc) skin and was correlated to vascular inflammation [
19], providing further evidence for the role of CCL19 in perivascular inflammation and immune cell recruitment. A parallel study illustrated that serum CCL19 levels might reflect blood B cell imbalance and correlate to the levels of some serum B cell biomarkers, such as rheumatoid factor, anti-CCP, free light chains, IgG, IgA and IgM, in RA patients. Furthermore, serum CCL19 also acted as a potential predictor of the clinical response to rituximab in B cell-mediated RA subtypes [
20]. All of these results illustrate the pivotal function of CCL19 in clinical settings. However, the role of CCL19/CCL21 in ankylosing spondylitis is rarely reported and demands a more comprehensive understanding.
In this study, we preliminarily focus on AS patients experiencing severely limited hip activity (average BASFI = 62.24, which means severe functional limitations). First, we detected higher expression of CCL19, CCL21 in LT and ligament fibroblasts. No significant effect on LT fibroblast proliferation was detected upon exposure to these two chemokines. Next, we examined the roles of CCL19/CCL21 in the osteogenic potential of AS ligament fibroblasts. The expression of the bone markers ALP, OCN, Runx-2 and Osterix were up-regulated by CCL19/21 simulation. However, IBSP and COL1 expression was not seen up-regulated. Serum CCL19/CCL21 levels are closely associated, and CCL19 expression appeared to correlate to the Visual Analogue Scale (VAS) Pain Score and disease duration, whereas CCL21 expression did not display this correlation. Our result reveals a novel role of CCL19/CCL21 in ligament ossification and may provide useful evidence for further investigation in AS patients.
Methods
Patients
Patients meeting the modified New York criteria [
21] for AS and patients suffering from single hip OA who underwent total hip arthroplasty at our department from May 1, 2012, to October 31, 2013, were selected for this study. The demographic and clinical characteristics of all the subjects are summarized in Table
1. All patients who provided their written informed consent according to the Declaration of Shanghai Changhai Hospital were enrolled. This study was approved by Shanghai Changhai Hospital Ethics Committee and the Ethics Committee approval document number is CHEC2013-194 The LT samples were stored in a −80°C freezer after collection in the operating room. Primary cultures of ligament fibroblasts were generated according to a previously described method [
22] with some modifications.
Table 1
Demographic characteristics of AS and OA patients and healthy controls
Male/female | 35/7 | 20/9 | 9/7 |
Age (y) | 35.93 ± 11.30 | 43.48 ± 11.21 | 33.38 ± 5.88 |
HLA-B27 (+) | 36 | NA | NA |
ESR (mm/h) | 42.29 ± 25.74 | 8.92 ± 8.26 | NA |
CRP (mg/L) | 25.41 ± 19.75 | 9.56 ± 21.96 | NA |
BASDAI score | 52.3 ± 14.7 | NA | NA |
BASFI score | 62.24 ± 17.98 | NA | NA |
VAS score | 5.26 ± 1.94 | NA | NA |
BAS-G score | 5.51 ± 1.56 | NA | NA |
Disease duration (months) | 155 ± 103 | NA | NA |
Morning stiffness (min) | 13 ± 16 | NA | NA |
Serum CCL19 (pg/ml) | 354.12 ± 75.49 | 304.55 ± 82.82 | 215.15 ± 50.20 |
Serum CCL21 (pg/ml) | 535.33 ± 124.22 | 470.13 ± 79.75 | 390.92 ± 38.12 |
RNA extraction and real-time PCR
The LT was fully shredded using RNase-free scissors and transferred to a 1.5 ml RNase-free EP tube. A total of 1 ml of TRIzol (Invitrogen) was used for no more than 100 mg of LT. TRIzol was used according to the manufacturer’s instructions. Total RNA was reverse-transcribed to cDNA using a ReverTra Ace qPCR RT Kit (TOYOBO CO., LTD., Osaka, Japan). The transcripts were stored at −80°C until further use. For RT-PCR, SYBR Green Real Time PCR Master Mix (TOYOBO CO., LTD., Osaka, Japan) was used in a total volume of 20 μL. The primer sequences are listed in Table
2. The samples were evaluated in triplicate using an equal load of 10 ng of cDNA/well, and three independent experiments were performed. The data were collected using an ABI 7300 Real-Time PCR System.
Table 2
Primer sequences used for real-time PCR
Human CCL19 | CCAACTCTGAGTGGCACCAA | TGAACACTACAGCAGGCACC |
Human CCL21 | TGGCCTCTTACTCACCCTCT | GCCTCTTGATCCCCTTAGCC |
Human CCR7 | GCCTACGACGTCACCTACAG | GGCAGAAGAGTCGCCTATGG |
Beta-actin | CCATCGTCCACCGCAAAT | TGTCACCTTCACCGTTCC |
ALP | ATCTTTGGTCTGGCTCCCATG | TTTCCCGTTCACCGTCCAC |
Human OCN | GGCAGCGAGGTAGTGAAGAG | CTGGAGAGGAGCAGAACTGG |
Human COL1 | GAG AGC ATG ACC GAT GG | GTG ACG CTG TAG GTG AA |
IBSP | CGCCAATGAATACGACAATG | GATGCAAAGCCAGAATGGAT |
Human VEGF-A | GAGCCTTGCCTTGCTGCTCTA | CACCAGGGTCTCGATTGGAT |
Runx-2 | GCAGCAACCCAGAAACACTT | AACACATGACCCAGTGCAAA |
Osterix | AGAGGAGAGACTCGGGACAG | GAGTTGTTGAGTCCCGCAGA |
Immunohistochemistry
The LT samples were immediately fixed using 4% formaldehyde and embedded in paraffin. The samples were deparaffinized in xylene for 20 minutes at room temperature, followed by rehydration using an alcohol gradient. Antigens were unmasked by first incubating the slides in 0.01 mol/L boiling citrate buffer at pH 6.0 for 15 minutes and then cooling at room temperature. Endogenous peroxidase activity was blocked via incubation in 3% H2O2 for 5 minutes, followed by blocking with goat serum for 30 minutes at 37°C. The primary antibody rabbit anti-human CCL19 (1:100, R&D Systems), rabbit anti-CCL21 (1:100, R&D Systems), rabbit anti-CCR7 (1:100, ABGENT), or an isotype-matched irrelevant antibody (R&D Systems) was individually added to the sections at the proper concentration. Following three washes with PBS, the slides were incubated for 30 min in the secondary antibody (GT Vision III anti-mouse/rabbit Universal immunohistochemical detection kit, Dako, Denmark) at 37°C. The slides were washed 3 times with PBS and then stained with DAB for 5 minutes and hematoxylin for 45 s, followed by rinsing with tap water for 5 minutes. Finally, the slides were processed via alcohol gradient dehydration, xylene immersion and resin blocking. Three fields from each slide were randomly selected, and tissue staining was analyzed using Image-Pro Plus 6.0 software. The scored data were pooled, and the mean density value ± standard deviation (SD) was calculated for each group.
Primary cell isolation, culture, and procedures
The previously described method for primary cell isolation was mentioned performed [
22] with some modifications. The LT from patients suffering from AS or OA who underwent hip joint replacement surgery was washed with sterile saline to remove the blood. Then, the fats and synovial tissue were cleared from the LT, followed by shredding into 1–2 mm
3 tissue blocks. The tissue blocks were centrifuged twice in 15 ml centrifuge tubes in 10 ml of PBS at 1000 r/min. Next, the tissue blocks were digested in 5 ml of PBS and 500 μl of collagenase I (Sigma-Aldrich China, Shanghai, China) for 5 h at 37
°C. Then, 5 ml of 0.25% trypsin was added, and the samples were mixed and incubated at 37
°C for 2 minutes. The samples were filtered using 200 mesh filters, and the filtrate was centrifuged at 1000r/m for 5 minutes. The supernatant was discarded. Then, 5 ml of DMEM/high glucose culture medium supplemented with 100 U/ml penicillin (Invitrogen, Carlsbad, California, USA), 100 μ g/ml streptomycin (Invitrogen, Carlsbad, California, USA) and 12% FBS was added to the centrifuge tube. The samples were mixed by pipetting and transferred to culture flasks in a humidified 5% CO2 incubator at 37°C The passages from 3 to 8 were used. For osteogenic differentiation, the fibroblasts were cultured to confluence and then incubated in DMEM/high glucose medium containing 100 nM dexamethasone, 50 μg/ml ascorbic acid, 10 mM of β-glycerophosphate [
23,
24] and 12% fetal bovine serum.
Flow cytometric analysis
The expression of CD90 (Biolegend) was identified as a molecular marker of fibroblasts based on FACS analysis as previously described [
25,
26]. The fibroblasts were detached via brief incubation in 2 mM EDTA in PBS. Following fixation using 1 ml of fix buffer (0.5% BSA-PBS) and incubation at room temperature for 10 min, approximately 1 × 10
6 cells were stained at room temperature via incubation in an anti-CCR7 pAb (polyclonal antibody, catalog # AP4998a, ABGENT) or an irrelevant IgG2a isotype control at a concentration of 0.025/ml for 90 min. After two washing and centrifugation steps, the cells were incubated in a PE-conjugated goat-anti-rabbit IgG pab (Tianjin Sungene Biotech Co., Ltd, Tianjin, China) for 40 min. Then, the cells were immediately analyzed via flow cytometry, and the data were calculated using a FACSCalibur flow cytometer and CellQuest software (BD Biosciences).
Measurement of fibroblast proliferation
The proliferation of fibroblasts was examined via a cell counting kit-8 (CCK-8 kit) assay according to the manufacturer’s instructions. Briefly, approximately 2 × 10
3 cells were seeded in a volume of 100 μl DMEM on each well of a 96-well plate. A range of concentrations of CCL19/CCL21 (0–200 ng/ml, Propetech) was added to the medium, and the cells were cultured for 48 h. Mesangial (M) cells, which display a proliferative response upon exposure to CCL19 [
27], were kindly provided by Professor Mei Changlin (Shanghai Eastern Hepatobiliary Hospital) as a positive control. Then, 100 μl of fresh medium in 10 μl of the CCK-8 solution was added to each well and incubated at 37°C for 2 h. The absorbance (A) at 490 nm was measured. All assays were performed in quadruplicate, and three individual experiments were performed. The data are expressed as the mean values ± SD of 4 wells per treatment.
Assessment of fibroblast mineralization
1 × 10
6 fibroblasts from one AS LT were seeded on 6-well plates. Five groups were assigned: osteogenic differentiation medium as a positive control, CCL19 (10 ng/ml, according to previous studies [
16] and the manufacturer’s recommendations), CCL21 (10 ng/ml), CCL19/CCL21 (both 10 ng/ml), and PBS as a negative control (Grow group). After culturing for 48 h, total RNA was extracted to determine the mRNA expression levels of the osteogenesis-specific transcription factors Runx-2 and Osterix and the osteogenic differentiation markers IBSP, COL1, ALP and OCN. On days 2, 4 and 6, the culture supernatants were collected to detect of the levels of ALP and OCN (N-MID ELISA kit, Immuno-diagnostic Systems Inc, Fountain Hills, AZ, USA) via ELISA. All measurements were performed in duplicate.
Statistical analysis
All data are expressed as the means ± standard deviation (SD). For statistical comparisons of two groups of samples, the Mann–Whitney U-test was used. Alternatively, comparisons of continuous variables were performed using Student’s two-tailed t-test using SPSS 17.0 software; p < 0.05 was considered to be significant. The relative gene expression levels were determined according to the 2-ΔΔCt method, and the results were expressed as the fold-change compared to the negative control.
Discussion
In this study, we detected increased expression of CCL19/CCL21 in AS hip LT. IHC staining of CCL19/CCL21, as well as their distribution, indicate that vascular endothelial cells and fibroblasts may represent the primary source of CCL19/CCL21. However, in vitro cultured AS ligament fibroblasts secreted only a small amount of CCL19 and no CCL21. This indicates that other cells, such as vascular endothelial cells, are likely the source of CCL19/CCL21. Moreover, inflammatory macrophages in enthesis and inflammatory factors, such as TNF-α, LPS, which regulate the expression of CCL19/CCL21 in synovial fibroblasts [
16], may also similarly mediate the production of CCL19/CCL21. However, additional evidence is required.
Because fibroblasts are the principal cell type in LT and are closely associated with ligament ossification in AS patients [
22], we examined whether CCL19/CCL21 exert an effect on LT fibroblast proliferation or ossification, both of which are reported in AS. Previous studies have demonstrated the various proliferation effects of CCL19/CCL21 on human M cells, CD4 and CD8 T cells, bone marrow and cord blood CD34+ cells [
15,
27,
29‐
31]. A recent study reported a minor role of CCL19/CCL21 on the survival, proliferation or migration of adult neural precursor cells [
32]. Alternatively, fibroblasts from various organs displayed enhanced or inhibited proliferation in response to stimulation, such as hypoxia, Beta2-adrenergic receptor agonist treatment and EGF treatment [
4,
33,
34]. Here, we detected no apparent proliferative effect of CCL19/CCL21 on ligament fibroblasts in the 0–200 ng/ml concentration range. The reason for this result may be that ligament fibroblasts are terminally differentiated cells with limited proliferation capability.
Syndesmophytes are evident in AS and, ligament fibroblasts are involved in their formation [
22]. Many investigators have identified the ossification tendency of fibroblasts in LT. Cytokines such as CCL3 has been found to inhibit osteogenesis in myeloma [
35]. In this study, we found higher expression of bone markers, such as ALP and OCN, and the transcription factors Runx-2 and osterix after stimulation of AS fibroblasts with CCL19/CCL21. Runx-2 and osterix are key regulators of osteoblast maturation and differentiation and modulate the expression of bone markers, including ALP, COL1, IBSP and OCN [
36]. Our results provide an innovative role of CCL19/CCL21 in fibroblast ossification, thus presenting new research targets for ligament lesions in AS. However, the precise mechanism by which CCL19/CCL21 affect mineralization via Runx-2 or osterix is not certain. In RA synovial fibroblasts, CCL19 expression is primarily modulated by lipopolysaccharide (LPS), tumor necrosis factor-α (TNF-α), interleukin-1 beta (IL-1β) and IL-8, whereas CCL21 is modulated by TNF-α. Exogenous CCL19/CCL21 treatment up-regulated the expression of VEGF and Ang-I, both of which are crucial mediators of angiogenesis [
16]. Parallel studies of RA and OA fibroblasts have also found that CCL19/CCL21 mediated migration [
37]. In our study, we detected significantly increased VEGF mRNA expression following CCL19/CCL21 stimulation (data not shown). Ossification and angiogenesis are closely correlated, and VEGF is an essential mediator of both of these processes [
38]. Furthermore, VEGF is also regulated by osterix [
39]. Based on the above findings, we speculate that inflammatory factors, such as LPS or TNF-α, may be regulate CCL19/CCL21, and CCL19/CCL21 promote fibroblast ossification via the Runx-2-osterix-VEGF pathway. However, further evidence is required to validate this hypothesis, and additional studies are necessary.
In this study, we detected higher levels of serum CCL19/CCL21 in both AS and OA patients compared to HC. CCL19/CCL21 were reported to predict the inflammatory state in some diseases [
19,
20], but we did not detect any correlation between CCL19/CCL21 expression and inflammation or functional characteristics in AS patients. The serum CCL19/CCL21 levels are closely associated, which might indicate a combined effect of pathogenicity. Furthermore, the CCL19 levels correlated to two disease-related global and activity indicators: the VAS score and the disease duration. The VAS score reflects the pain level, and the disease duration may reflect the onset of disease. This result indicates that CCL19 is a relative indicator of early onset in AS patients.
There are some limitations to our study. First, pathological studies demonstrated that multiple cell types, including fibroblasts, periosteal cells, endothelial cells and stem cells, are present in LT, so other cells that express CCR7 should also be considered. Second, all of the patients in our study were admitted for joint replacement surgery and exhibited severely restricted hip activity and a poor BASFI score (average BASFI = 62.24, indicating severe functional limitations), and these patients do not represent the entire AS population. Third, there is a significant difference in the average age between the AS and OA groups, which may influence the results. Fourth, the precise concentrations of CCL19/CCL21 in AS LT (n = 10) and peripheral blood are similar to those of RA synovium and peripheral blood [
16], but ossification is not observed in RA patients. Two reasons may account for these results: ossification is caused by changes in the gene expression level in AS, and CCL19/CCL21 may accelerate this progress; and the concentration of CCL19/CCL21 used in this study, 10 ng/ml, which is far more than the levels in LT, induced the activation of ossification in cultured fibroblasts in vitro. In addition, the number of AS patients included in our study is small for correlation analysis. Further investigation using larger sample sizes would provide more convincing results.
In summary, we observed higher expression of CCL19/CCL21 in AS LT. The increased CCL19/CCL21 displayed pro-ossification potential but did not affect the proliferation of AS ligament fibroblasts. Moreover, the serum CCL19 levels significantly correlated to the serum CCL21 levels, the VAS score and the disease duration, which reveals its important role in global disease assessment of AS patients.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made.
The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
YQ conceived and designed the study, prepared the manuscript and performed the real-time PCR and IHC analyses; LD collected the clinical and laboratory data and the serum and tissue samples and performed cell culture, the CCK8 assay and ELISA; ZJ processed the data and interpreted and plotted the results. TWW and ZYM provides great help to review, selection and collection of patient data. All authors edited the manuscript and read and approved the final manuscript for publication.