Background
Cancer is a complicated genetic disease trigged by cells that have accumulated multiple mutations that finally bestow malignant characteristics. Loss or inactivation of tumor suppressor genes, resulting from chromosomal deletion, mutation or hypermethylation, causes immortality of cancer cells [
1]. The inhibitor of growth (ING) gene family was identified as an important group of tumor suppressor proteins due to their critical role for the initiation, promotion and development of human cancers [
2]. The ING gene family includes five memebers (ING1, ING2, ING3, ING4 and ING5). All ING proteins share a highly conserved carboxy-terminal plant homeodomain (PHD) and regulate several cellular functions relevant to antitumor protection, such as cell cycle restriction, chromatin remodeling, senescence, apoptosis, autophagy and DNA repair.
ING5 is a novel member of the ING family whose fundamental role in tumor suppression has only recently been investigated. ING5 contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling [
3]. ING5 protein can interact with p53 and is involved in the p53-dependent regulatory pathway. Through this pathway and other mechanisms, ING5 induces apoptosis, differentiation and autophagy and decreases proliferation, invasion, metastasis and tumor formation by cancer cells [
4‐
6]. In addition, loss or downregulation of ING5 expression has been frequently observed in different cancer types, including head and neck squamous cell cancer [
7], colorectal cancer [
6], gastric cancer [
8] and oral squamous cell carcinoma [
9]. In breast cancer, ING5 has been found to be downregulated and efficiently inhibited the epithelial-mesenchymal transition of cancer cells [
10]. However, while the important role of ING5 as a potent tumor suppressor in the progression of human cancers has been frequently documented, the molecular mechanism accounting for the loss expression and dysfunction of ING5 in tumorigenesis is largely unknown and deserves further investigation.
MicroRNAs (miRNAs) are a family of small, non-coding RNAs that play an important role in the regulation of gene expression at the post-transcriptional level. miRNAs bind to complementary sequences in the 3’-untranslated regions (3’-UTRs) of target mRNAs to induce mRNA degradation or translational repression of the target genes. Studies over the past decade have revealed aberrant expression of miRNAs in human cancers as novel biomarkers. In principle, miRNAs can function as oncomiRs or tumor-suppressive miRNAs via targeting tumor suppressor genes or oncogenes, whose dysregulation and dysfunction lead to the misbehavior of cancer cells (e.g., malignant proliferation, invasion and metastasis). miR-24 is one of the most well-known miRNAs correlated with tumorigenesis. Overexpression of miR-24 has been found in a variety of human cancers, including pancreatic cancer [
11], non-small cell lung cancer [
12], hepatocellular carcinoma [
13] and gastric cancer [
14]. However, the latent molecular mechanisms through which miR-24 is involved in the development and progression of breast cancer remain to be fully elucidated.
In the present study, we performed a systematic analysis of ING5 expression in breast cancer and identified ING5 as a direct target of miR-24. Furthermore, we showed that miR-24 promoted the proliferation and invasion of, but suppressed the apoptosis of, breast cancer cells in vitro and accelerated xenografted tumor growth in vivo, probably via negatively regulating ING5.
Methods
Cell lines and tissues samples
The human breast cancer cell lines (MCF-7 and MDA-MB-231) were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences (Shanghai, China). The cells were cultured in DMEM medium (Gibco, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco) in a humidified incubator at 37 °C with 5% CO
2. Paired breast cancer and adjacent noncancerous tissue samples were obtained from patients who were undergoing surgical procedures at the Affiliated Drum Tower Hospital of Nanjing University Medical School (Nanjing, China). Written consent was obtained from all of the patients and all aspects of this project were approved by the Clinical Research Ethics Committee from the Affiliated Drum Tower Hospital of Nanjing University Medical School. Tissue specimens were immediately frozen in liquid nitrogen after resection and stored at −80 °C. For clinical features of the patients, see Table
1.
Table 1
Clinical features of breast cancer patients
BC #1 | IDC | Female | 57 | II |
BC #2 | IDC | Female | 56 | II |
BC #3 | IDC | Female | 61 | II-III |
BC #4 | IDC | Female | 55 | III |
BC #5 | IDC | Female | 56 | I-II |
BC #6 | IDC | Female | 48 | II |
BC #7 | IDC | Female | 55 | II-III |
BC #8 | IDC | Female | 50 | II-III |
RNA isolation and quantitative RT-PCR
RNA isolation and hydrolysis probe-based quantitative RT-PCR (qRT-PCR) were performed as previously described [
15]. For the quantification of miR-24 and U6 snRNA, 0.2 μg of total RNA obtained from cultured cells or tissues was reverse-transcribed to cDNA using AMV reverse transcriptase (TaKaRa, Dalian, China). The reaction mixture was incubated at 16 °C for 30 min, 42 °C for 30 min, and 85 °C for 5 min.qRT-PCR was carried out with a TaqMan PCR kit on an Applied Biosystems 7300 Sequence Detection System (Applied Biosystems). The real-time PCR cycles consisted of a pre-denaturation step at 95 °C for 5 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. After the reactions, the cycle threshold (C
T) data were determined using default threshold settings, and the average C
T was calculated from triplicate PCRs. C
T values of miR-24 were normalized to U6 snRNA, and the relative levels of miR-24 were determined using the formula 2
-ΔΔCT, in which ΔΔC
T = (C
T miR-24 – C
T U6)
target - (C
T miR-24 – C
T U6)
control.
For the quantification of ING5 and GAPDH mRNA, 1 μg of total RNA was reverse-transcribed to cDNA using Oligo d(T) primer (TaKaRa, Dalian, China). qRT-PCR was then performed using SYBR Green dye (Invitrogen) and specific primers for ING5 and GAPDH. The CT values were determined by setting a fixed threshold. The relative levels of ING5 mRNA were normalized to GAPDH using the 2-ΔΔCT method as described above.
The sequences of the primers used for amplification were as follows:
-
ING5 (sense): 5′-AAACGAACCCACGTACTGC-3′;
-
ING5 (antisense): 5′-TTGCGACACGAATGAAGG-3′;
-
GAPDH (sense): 5′-CGAGCCACATCGCTCAGACA-3′;
-
GAPDH (antisense): 5′-GTGGTGAAGACGCCAGTGGA-3′.
miRNA overexpression or knockdown
Lipofectamine 2000 (Invitrogen) was used for transfection in accordance with procedures suggested by the manufacturer. The overexpression of miR-24 was achieved by transfecting cells with a miR-24 mimic (pre-miR-24, a synthetic double-stranded RNA oligonucleotide mimicking the precursor of miR-24), whereas the knockdown of miR-24 was achieved by transfecting cells with a miR-24 inhibitor (anti-miR-24, a chemically modified antisense oligonucleotide designed to target mature miR-24). Scrambled RNAs were used as the negative controls (pre-miR-control and anti-miR-control). Equal amounts of RNAs were transfected when the cells were approximately 70% confluent. The cells were harvested 24 h after the transfection for the isolation of RNA or protein. The MCF-7 cells were also treated with actinomycin D (2 μg/mL, Sigma) and incubated for 8 h to inhibit transcription after 12 h of transfection.
Protein isolation and western blotting
Tissue samples were processed in a Tissuelyser machine (Jingxin, Shanghai, China). The cells or processed tissue products were lysed in RIPA lysis buffer and the protein supernatants were collected after centrifuging. A BCA protein assay kit (Thermo Scientific, Rockford, IL, USA) was used to calculate the protein concentration. For western blotting, equal amounts of protein samples were separated on SDS-PAGE gels and transferred to a PVDF membrane (Bio-Rad, California, USA). After blocking in 5% skim milk, the membranes were incubated with primary antibodies (ING5, 1:800, Proteintech Group, Inc, IL, USA; GAPDH, 1:2000, Santa Cruz Biotechnology) () at 4 °C overnight. After incubation with goat anti-rabbit secondary antibody (1:2000, Santa Cruz Biotechnology) for 1 h at room temperature, the bands were detected with the SuperSignal West Pico chemiluminescence substrate (Pierce, Thermo Scientific).
Plasmid construction and siRNA interference assay
A mammalian expression plasmid designed to specifically express the open reading frame (ORF) of human ING5 without the miR-24-targeted 3’-UTR was purchased from Invitrogen. An ING5-HA fusion plasmid which inserted a hemagglutinin (HA) fragment (TACCCTTATGATGTGCCAGATTATGCC) at the C-terminal of the ING5 expression plasmid was purchased from Realgene. The siRNA -targeting human ING5 was designed and synthesized by Invitrogen (sense) 5′-GCGCUUUGAAGCAGAUCUGTT-3′; (antisense) 5′-CAGAUCUGCUUCAAAGCGCTT-3′. The empty plasmid backbone and a scrambled siRNA served as the negative control. For MCF-7 cells seeded in 6-well plates, equal amount of plasmid (0.02 μg) or siRNA (200 pmol) were transfected.
Luciferase reporter assay
The human ING5 3’-UTR with a wild-type or a mutant miR-24 target sequence was inserted into the p-MIR-reporter plasmid (Ambion) to create p-MIR-luc-ING5 WT or p-MIR-luc-ING5 Mut, respectively. The desired constructs were confirmed by sequencing. The sequence that interacts with the seed sequence of miR-24 was mutated (from CTGAGCC to GACTCGG). For the luciferase reporter assay, MCF-7 cells were seeded into 24-well plates and transfected with a mixture of 0.2 μg p-MIR-luc-ING5 WT or Mut, 0.1 μg β-galactosidase (β-gal) expression plasmid (Ambion) and equal amounts (20 pmol) of RNAs. The β-gal plasmid was used as a transfection control. The luciferase activity was analyzed 24 h after transfection using luciferase assay kits (Promega, Madison, WI, USA).
Cell viability assay
MCF-7 cells were plated at 1 × 103 cells per well in 96-well plates in 100 μL DMEM medium supplemented with 1% FBS. Cells were then collected at 12, 24, 36, 48, 60, 72, 96 and 120 h after transfection. The Cell Counting Kit-8 (CK04-500, Dojindo) was used to determine the viability of the MCF-7 cells based on the procedures suggested by the manufacturer. Briefly, 10 μL of the provided CCK-8 liquid was added to the test wells and the plates were incubated for 2 h. The absorbance was then measured at a wavelength of 450 nm.
Transwell invasion assay
For the invasion assay, 2 × 104 transfected MCF-7 cells were suspended in serum-free DMEM and seeded into the upper invasion chamber (BD Biosciences, Bedford, MA) that was pre-coated with a thin layer of Matrigel. DMEM containing 10% FBS was placed into the lower compartment as a chemo-attractant. The cells were allowed to invade for 10 h, and then the cells adhering to the lower Matrigel membrane were fixed 4% paraformaldehyde and stained with 0.1% crystal violet solution at room temperature. The noninvasive cells in the upper chamber were gently scraped out with cotton swabs. The invaded cells were counted in 3 different fields per well under a microscope at 100 × magnification.
Cell apoptosis assay
The apoptosis of MCF-7 cells was determined using the FITC-Annexin V Apoptosis Detection Kit I (BD Biosciences) based on the procedures provided by the manufacturer. The transfected MCF-7 cells were cultured in serum-free DMEM for 24 h. The collected cells were washed with cold PBS and resuspended in 1 × binding buffer, followed by staining with FITC-Annexin V and propidium iodide (PI) in the dark for 15 min. The apoptotic cells were calculated using a fluorescence-activated cell-sorting (FACS) flow cytometer (BD Biosciences, San Jose, CA, USA).
Xenograft assays in nude mice
Athymic BALB/c female nude mice (4 weeks old) were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China) and were randomly divided into 3 groups (3 mice per group). MCF-7 cells were infected with a control lentivirus or a lentivirus to overexpress miR-24, or transfected with an ING5 overexpressing plasmid. After treatment, the MCF-7 cells were uniformly suspended in PBS at a final concentration of 1× 107 per mL. For each mouse, 0.1 mL cell suspension solution (1× 106 cells) was subcutaneously injected and all the injection performance was carried out according to the standard protocol. The needle was inserted into the armpit of the right hind leg at a 45 degree angle and a 5 mm depth, midway down. The mice were sacrificed and photographed 28 days post-injection. The xenograft tumors were removed and weighed. Part of tissue was used for extracting total RNA and protein, and the remainder tissue was made into tumor section slides for hematoxylin and eosin (H&E) staining and immunohistochemical staining for ING5 and Ki-67. All animal care and handling procedures were performed in accordance with the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals.
Statistical analysis
The results are presented as the means ± SE. All of the images shown are representative of at least three independent experiments. qRT-PCR, luciferase reporter assay, cell viability assay, transwell invasion assay and cell apoptosis assay were all performed in triplicate, and each experiment was repeated several times. The differences were considered to be significant at p < 0.05 based on Student’s t-test.
Discussion
Breast cancer continues to be the leading cause of cancer-related mortality in women worldwide. Despite advances in diagnosis and access to different types of treatment such as surgery, radiotherapy, chemotherapy and hormone therapy, numerous women with breast cancer continue to succumb to this malignancy. Some treatments for breast cancer may cause side effects that persist or appear months or years after treatment. Understanding the underlying mechanisms that regulate the progression of breast cancer is crucial for the development of novel therapeutics. Considerable research efforts should also be performed to develop novel therapeutic strategies to combat breast carcinogenesis.
ING proteins have recently received more attention due to their involvement in the development of multiple tumors [
19,
20]. ING5 belongs to the ING tumor suppressor family and aberrant expression of ING5 has been found in several tumors [
6‐
9]. Consistent with these reports, here in we found that the ING5 protein was downregulated in breast cancer tissues compared to normal adjacent tissues. Indeed, downregulation of ING5 is involved in the pathogenesis of breast cancer and some other types of cancer. For example, a genome-wide functional screen by Mendes-Pereira identified ING5 as one of the set of genes whose silencing caused sensitivity to tamoxifen in breast cancer therapy regimens [
21]. Furthermore, it has been reported that ING5 may inhibit cancer aggressiveness via prevention of the epithelial-mesenchymal transition in breast cancer and lung cancer [
10,
22]. Additionally, tumor-specific mutation and downregulation of ING5 mRNA were found in oral squamous cell carcinoma [
9]. These findings validate that ING5 is involved in cancer pathogenesis as a tumor suppressor gene. Likewise, our functional study also supports the anti-tumor role of ING5 in breast cancer cells. Overexpression of ING5 significantly inhibited the proliferation and invasion of breast cancer cells, but stimulated apoptosis, while knockdown of ING5 had the opposite effects on these cellular functions. Epigenetic modification of cancer cells by either silencing oncogenes or reactivating silenced tumor suppressors may sensitize cancer cells to lower doses of conventional cytotoxic agents. For example, the combination of ING1 with a chemical agent can act synergistically to block breast cancer cell growth [
23]. Following this theory, it is quite possible that ING5 may also affect breast cancer cell response to chemotherapeutic drugs. Thus, induction of ING5 expression may become an attractive therapeutic strategy for breast cancer.
It is well known that miRNAs interact with the 3’-UTRs of their target mRNAs through imperfect complementary binding and that the targeted transcripts subsequently undergo accelerated turnover and translational repression [
24]. As potent post-transcriptional regulators of gene expression, miRNAs may be therefore involved in ING5 regulation and may well explain the disparity between ING5 protein and ING5 mRNA expression in breast cancer tissues. To determine the molecular mechanism underlying ING5 downregulation in breast cancer, we used computational bioinformatics to predict those miRNAs that could target ING5 and identified miR-24. Aberrant expression of miR-24 has been found in multifarious cancer types and miR-24 has both tumor-suppressive and oncogenic properties depending on the cellular context. In breast cancer, it has been shown that miR-24 exhibited great capability for discriminating and monitoring between cancer patients and controls [
25,
26]. Moreover, miR-24 played a key role in breast cancer invasion and metastasis [
17], suggesting the oncogenic role of miR-24 in breast cancer. In the present study, we found that miR-24 levels were consistently higher in breast cancer tissues. We then experimentally validated ING5 as a novel target of miR-24 by cell transfection and luciferase reporter assays. Furthermore, we provided evidence that induction of miR-24 expression could mimic ING5 suppression, stimulating the proliferation and invasion of breast cancer cells, and suppressing apoptosis. In addition, restoration of ING5 expression could reverse the miR-24-induced cellular phenotypes, suggesting that targeting ING5 is a major mechanism by which miR-24 exerts its oncogenic function. Taken together, these results portray a novel regulatory pathway employing miR-24 and ING5 to fine-tune the balance of breast cancer cells.
Given the involvement of aberrant miRNA expression in the initial and developmental stages of human cancers, therapeutic strategies based on the manipulation of miRNA activity hold great promise to influence cancer behavior. For the anti-tumorigenic miRNAs, induced expression of individual miRNAs, either through transfection or therapeutic delivery methods, has demonstrated the ability to suppress tumor progression without toxicity [
27]. Conversely, for cases in which miRNAs are consistently upregulated in cancers, targeting common oncogenic miRNAs through the use of antisense reagents such as antagomirs and locked nucleic acids has proven to be a potential intervention to block cancer-associated miRNAs [
28,
29]. In this study, ING5 is downregulated in breast cancer and is negatively regulated by miR-24. Hence, it is quite possible that modulating miR-24 may increase ING5 expression and subsequently activate the anti-tumor effects of ING5. Indeed, restoration of ING5 expression with a miR-24-resistant ING5 overexpression plasmid completely reversed miR-24-induced cellular phenotypes and blocked xenografted tumor growth in vivo. In the future, greater research emphasis is needed to characterize the feasibility of targeting miR-24 in cancer therapy and to develop simplified and cost-effective manipulation methods.
Conclusions
In conclusion, this study demonstrated that ING5 can suppress the proliferation and invasion of, and stimulate the apoptosis of breast cancer cells. This study also showed for the first time that miR-24 accomplishes its oncogenic effects by negatively regulating ING5 expression in breast cancer. Further research on miR-24 and ING5 may reveal a new avenue for treatment of breast cancer.
Acknowledgements
Not applicable.