Background
Endogenous nitric oxide (NO) produced by three isoforms of nitric oxide synthase (NOS1, NOS2 and NOS3) is involved in a broad spectrum of physiological and pathological activities such as immune responses, neurotransmission, and smooth muscle relaxation [
1,
2]. NOS genes are abnormally up-regulated in various cancers and the increased expression is correlated with poor survival [
3,
4]. NOSs regulate multiple biological functions including autophagy, metabolism and proliferation by producing a low level of nitric oxide in tumors [
5‐
7]. Nitric oxide produced by NOSs exerts dual functions in a cGMP-dependent or cGMP-independent manner [
8‐
10]. In the cGMP-dependent manner, nitric oxide reacts with the active site of soluble guanylate cyclase, leading to enzymatic activation and subsequent activation of MAPK cascade [
11,
12]. The cGMP-independent pathway is commonly through modification of target proteins [
9,
13]. NO-nitrosylated cysteine residues of proteins altered functional properties of energy metabolism such as mitochondrial respiration/proliferation and reactions of glucose metabolism [
13,
14]. NO can react with superoxide anions to yield peroxynitrite, which nitrates with amino acids to form nitrotyrosine (nitration) and leads to the downregulation of the JAK/STAT pathway, contributing to IFN
\(\upalpha \) tolerance of tumor cells [
15].
More and more studies indicated that NOS2 expressed in tumor-infiltrating immune cells such tumor associated macrophages (TAMs) and myeloid-derived suppressor cells (MDSCs) play a critical role in cancer immune modulation [
5,
16]. NOS2-derived NO inhibits the proliferation of effector T cells and downregulation of IFN
\(\upgamma \) productions, but promotes the differentiation of regulatory T cells in tumor microenvironment [
17]. The expression and function of the three isoforms of NOS differ in different cell types [
4]. NOS1 is a calcium-dependent, constitutively expressed nitric oxide synthase that can produce low levels of nitric oxide in a variety of tissues and tumors [
17]. Unlike the other two isoforms, NOS1 interacts with target proteins through its unique PDZ domain, which ensures the effectiveness and selectivity of the NOS1 function [
18,
19]. Our study showed that NOS1 bound with the key enzyme of glycolysis and modulated metabolic rewiring in ovary cancer progression [
20]. In melanoma, we found NOS1 expression correlated negatively with phosphorylation of STAT1 in IFN
\(\upalpha \) signal of patients PBMCs and predicted poor response to adoptive T cell therapy [
21]. Recently, we found that NOS1 inhibited the IFN
\(\upalpha \) response through binding and S-nitrolating histone deacetylase HDAC2 [
22].
Here, we generated NOS1-knockout melanoma cells to explore the role of NOS1 on melanoma growth and interferon response, and provide possible mechanisms through global transcription analysis.
Methods
Cell culture
Human melanoma A375 cell line and murine melanoma B16 cell line were maintained in our laboratory. Cells were cultured in RPMI-1640 medium (Gibco, Gaithersburg, MD, USA) supplemented with 10% fetal bovine serum (BI, Salt Lake City, UT, USA), and maintained at \(37\;^{\circ }\hbox {C}\) in a humidified atmosphere of 5% CO2.
Plasmid construction
CRISPR/Cas9 Plasmid p2u6 was approved by Zhili Rong, Ph.D. [
23] The gRNAs were designed using the online software (
http://crispr.mit.edu). The gRNAs were amplified by PCR using Q5 High-Fidelity DNA Polymerase (NEB). To construct plasmids, PCR products and Plasmid p2u6 linearized by BaeI digestion were used for Gibson assembly (NEBuilder HiFi DNA Assembly Master Mix). The sequence of gRNAs is listed in Table
1.
Table 1
Sequences of the single guide RNAs (gRNAs)
gRNA1 | CAGCGCGAGGCATTCCGCC |
gRNA2 | CTATCAGATGATGGTCACG |
DNA extraction and genotyping
The genomic DNA was extracted from the cell using an SDS lysis buffer. The genomic DNA was subjected to PCR amplification to identify the mutations. The mutation was confirmed by sequencing the PCR product, and the primers used are listed in Table
2.
Table 2
Sequence of the primers used for genotyping
NOS1 | CCCACATGGAAAGGCTGGAA | AGAGCTGGCTGTGATCTTGG |
Western blotting
Total protein was extracted by a Protein Extraction Kit (Fude, Hangzhou, CN). The concentration in each sample was determined using the Bradford assay (Beyotime, Shanghai, CN). Equal amounts of proteins were separated on 8–15% SDS-PAGE. Then the samples were transferred to PVDF membranes (Millipore, USA) and blocking with 5% BSA for 1h. Before corresponding with HRP-conjugated secondary antibodies, the membranes were incubated with the primary antibodies, anti-NOS1 (Abcam, Cambridge, MA, USA) at a 1:1000 dilution and GAPDH (Proteintech, Wuhan, CN) at a 1:5000 dilution, respectively. Then, the immunoreactive bands were visualized by chemiluminescence (Bio-Rad, USA).
MTT assay
Cells were implanted into 96-well plates and cultured overnight. The next day, 10 \(\upmu \)l 5 mg/ml MTT (Sigma-Aldrich, St. Louis, USA) was added to each well. After incubated for 2–4 h at 37 \(^{\circ }\hbox {C}\), 100\(\upmu \)l of DMSO was added to each well. Swirl gently for 15min at RT. After purple precipitate was fully dissolved, record absorbance at 490nm by BioTek Instruments (Winooski, VT, USA).
Cells were implanted into 6-well plates. Fresh medium was added to plates every 3 days. On day 10, cells were stained with 0.005% crystal violet and photographed after fixed with 4% paraformaldehyde for 15min.
EdU assay
Cells were implanted into 96-well plates and cultured overnight. The next day, \(50 \; \upmu \)M EdU was added to each well for 2h at \(37 \; ^{\circ }\hbox {C}\). Subsequently, the cells were fixed with 4% paraformaldehyde for 30min. Then, incorporated EdU was detected using the Cell-Light EdU Apollo 567 in Vitro Kit (RiboBio, Guangzhou, CN).
Flow cytometry cell cycle analysis
Cells were pelleted and washed with ice-cold PBS buffer, then incubated with PI staining solution at \(4 \; ^{\circ }\hbox {C}\) for 30min. The cell-cycle distribution was determined by FACS Aria Flow cytometer (Beckton Dickson, San Jose, CA, USA). PI staining solution: 25mg PI + 25mg Sodium Citrate + 5 mg RNase A + 750 ml Triton X-100 in 250 ml ddH\({}_2\)O.
Animal experiments
All animals in this study, C57BL/6 mice and BALB/c-nu mice (Female, 6weeks old), were all purchased from Guangdong Medical Laboratory Animal Center.
Tumor xenograft assay was performed as described below. Briefly, \(5\times 10{}^6\) A375 cells (NOS1 KO or WT) were injected subcutaneously into BALB/c-nu mice(\(\hbox {n}=5\)). Tumor size was measured by caliper every 3 days. And tumor volume was calculated according to the following equation: tumor volume (mm\({}^3\)) = (length (mm) \(\times \) width\({}^2\) (mm\({}^2\))) \(\times \; 0.5\). The xenograft experiment was terminated when tumors were no more than 1400 mm\({}^3\) in volume.
To construct lung metastasis models of melanoma, \(5\times 10{}^5\) B16 cells (NOS1 KO or WT) were intravenously injected into C57BL/6 mice (\(\hbox {n}=7\)). Mice were euthanized on day 11 post-injection, and lung tissue was isolated and photographed. Paraffin sections 5 (\(\upmu \hbox {m}\)) were stained with H&E, examined by microscopy and photographed.
Real-time PCR
Total RNA was isolated using an RNAiso Plus reagent (Takara, Shiga, Japan) and reverse-transcribed using a PrimeScript RT kit (Takara). Then, TB Green Premix Ex Taq II (Takara) and LightCycler 96 System (Roche Life Science) were performed on quantitative real-time PCR (qPCR) analyses. Gene expressions were calculated using the comparative
\(2{}^{-\Delta \Delta CT}\) method. The primer sequences for qPCR are listed in Table
3.
Table 3
Sequence of the primers used for verifying JAK-STAT pathway
GAPDH | CTCCAAAATCAAGTGGGGCG | TGGTTCACACCCATGACGAA |
IL13RA2 | AAAGTTCAGGATATGGATTGCGT | GAAGTACACCTATGCCAGGTTTC |
SPRY4 | TCTGACCAACGGCTCTTAGAC | GTGCCATAGTTGACCAGAGTC |
PIK3R3 | TACAATACGGTGTGGAGTATGGA | TCATTGGCTTAGGTGGCTTTG |
LIF | CCAACGTGACGGACTTCCC | TACACGACTATGCGGTACAGC |
IFNAR2 | TCATGGTGTATATCAGCCTCGT | AGTTGGTACAATGGAGTGGTTTT |
CCND1 | GCTGCGAAGTGGAAACCATC | CCTCCTTCTGCACACATTTGAA |
IL24 | CACACAGGCGGTTTCTGCTAT | TCCAACTGTTTGAATGCTCTCC |
EPOR | ACCTTGTGGTATCTGACTCTGG | GAGTAGGGGCCATCGGATAAG |
IRF9 | GCCCTACAAGGTGTATCAGTTG | TGCTGTCGCTTTGATGGTACT |
IFNGR2 | CTCCTCAGCACCCGAAGATTC | GCCGTGAACCATTTACTGTCG |
IFNAR1 | AACAGGAGCGATGAGTCTGTC | TGCGAAATGGTGTAAATGAGTCA |
JAK1 | CTTTGCCCTGTATGACGAGAAC | ACCTCATCCGGTAGTGGAGC |
Total RNA was extracted by TRIzol (Invitrogen, CA) and purified with NucleoSpin miRNA (Macherey-Nagel, Duren, DE). Target preparation for microarray processing was carried out according to the GeneChip WT PLUS Reagent Kit. A total of 500 ng RNA was used for a double-round of cDNA synthesis. The cDNAs were fragmented, biotinylated, and hybridized to the Affymetrix Clariom S Assay human (Affymetrix, Santa Clara, CA). Following hybridization, the microarrays were washed and stained with Streptavidin Phycoerythrin on the Affymetrix Fluidics Station 450. Microarrays were scanned by using Affymetrix GeneChip Command Console (AGCC, Thermo Fisher Scientific, Inc) which installed in GeneChip Scanner 3000 7G. The microarray data are deposited in the GEO database with the accession GSE166287.
The data were analyzed with Robust Multichip Analysis (RMA) algorithm using default analysis settings and global scaling as normalization method Values presented are log2 RMA signal intensity. Normalized data were further analyzed using a moderated t-test to screen out the DEGs (differentially expressed genes) with Fold Change
\(>1.2\) or
\(<-1.2\),
\(\hbox {FDR}<0.05\). The volcano plot was constructed using the R studio web server iBio Tools v5.0. Kyoto Encyclopaedia of Genes and Genomes pathway enrichment analyses of DEGs were performed by the KOBAS online database(
http://kobas.cbi.pku.edu.cn/kobas3). Cluego plug-in in Cytoscape software (3.8 version) was used for showing the ClueGO network diagram. GSEA software(
https://www.gsea-msigdb.org/gsea/index.jsp) was used to perform the gene set enrichment analysis. A normalized enrichment score (NES) and p-value
\(<0.05\) were used to determine statistical significance.
Total RNA was extracted using TRIzol (Invitrogen) and genomic DNA was removed using DNase I (TaKara). A total of
\(1 \;\upmu \hbox {g}\) mRNA was isolated following the TruSeq RNA sample preparation kit (Illumina, San Diego, CA). The double-stranded cDNA was synthesized using a SuperScript double-stranded cDNA synthesis kit (Invitrogen, CA). Then, the synthesized cDNA was degraded and selected. After quantified by TBS380, paired-end RNA-seq sequencing library was sequenced with the Illumina HiSeq xten/NovaSeq 6000 sequencer. The RNA-seq data are deposited in the SRA database with the accession PRJNA700578. The raw paired-end reads were analyzed by SeqPrep (
https://github.com/jstjohn/SeqPrep) and Sickle (
https://github.com/najoshi/sickle) with default parameters. Then clean reads were separately aligned using TopHat (
http://tophat.cbcb.umd.edu/, version2.0.0) software.
Statistical analysis
The Student’s t-test was used to analyze the two-sample comparison. A p-value \(<0.05\) was considered to be statistically significant. The values are expressed as the mean values ±S.D. All the statistical analyses were performed using Prism software, version 8.0 (GraphPad, Inc, San Diego, CA, USA).
Discussion
Nitric oxide is a soluble endogenous gas working as a critical metabolic regulator in metabolism reprogramming of tumorgenesis [
25]. NO-induced S-nitrosation activates oncogenic signaling cascades or directly alters activities of metabolic enzymes [
26]. Our previous study showed that NOS1 expression in ovarian cancer promoted tumor glycolysis and growth through S-nitrasylation of the key enzyme (PFK1) [
20]. In this study, we also observed that metabolic reprogramming is the major alteration in NOS1 deleted melanoma cells. NOS1 high-expression accompanies with up-regulation of multiple metabolic pathways for macromolecule synthesis and down-regulation of mitochondrial respiration [
27,
28]. Thus, NOS1 expression might shift metabolism of redirect nutrients into anabolic pathways to maintain biomass production for supporting uncontrolled proliferation of cancer cells. Our data showed that NOS1 upregulated the regeneration of arginine. It has been indicated that arginine is a strong inducer of histone acetylation and deprivation of arginine leads to high histone methylation such as H3K9me3 and H3K27me3 [
29], contributing the silencing of genes involved in mitochondrial functions including OXPHOS, purine and pyrimidine synthesis, DNA repair, etc [
30‐
32]. Whether regulation of the arginine regeneration is a causal mechanism for NOS1 related global enhanced expression of metabolic, mitochondrial and pyrimidine synthesis needs to be further studied.
Innate immunity is crucial for immune-surveillance and anti-tumor therapy [
33,
34]. NO generated by tumor cells impairs the TLR signaling pathway in anti-tumor immunity [
21]. In this study, NOS1 deletion in melanoma up-regulated the expression of IFN
\(\upalpha \) regulating genes. NOS1 related immune response genes prognosis poor chemotherapy efficacy and shorter overall survival of melanoma patients. It is noticed that NOS1 induced a significant alteration of transcription profiles only under condition of IFN
\(\upalpha \) stimulation but not in basal levels, indicating that NOS1 impaired the activity of immune regulatory signaling. Most NOS1-repressing interferon-response genes are cytokines and chemokines downstream of the JAK-STAT and TOLL–LIKE signaling pathways. The releases of these molecules play a critical role in the activation of interferon-induced antitumor immune-response. It was confirmed by the observation of the increased recruitment of CD3+ cells in NOS1-deleted tumors. Deletion of NOS1 leads to down-regulation of innate immune and switching “cold” tumors to “hot”, suggesting NOS1 could be a potential target for tumor immune therapy.
Arginine metabolism has recently emerged as a critical pathway for controlling immune cell function [
35]. In addition to epigenetical regulation of gene transcription, arginine is a precursor for polyamine synthesis [
36]. In cancer cells, polyamine metabolism is frequently dysregulated, which promotes transformation and tumor progression [
37,
38]. Inhibition of polyamine synthesis induces autonomous cancer cell death and enhances immune response [
37,
39]. However, the causal relationship between polyamine synthesis and NOS1-induced downregulation of innate immune signaling needs to be further studied.
Acknowledgements
We thank Zhili Rong, Ph.D. for the approval of CRISPR/Cas9 Plasmid p2u6. And we thank for the support from the Cancer Research Institute of Southern Medical University, National Demonstration Center for Experimental Education of Basic Medical Sciences (Southern Medical University) and the Pingshan District People’s Hospital of Shenzhen.
Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (
http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.