Background
Obesity, a growing health concern worldwide, is a result of excess energy intake and insufficient exercise. Obesity is associated with increased risk of diseases with high mortality, such as ischemic heart disease, stroke, and cancer [
1]. In particular, the risk of colorectal cancer (CRC), which is the third most common malignancy in men and the second in women, globally [
2], is especially higher when combined with obesity [
3]-[
5]. The five-year survival for early stage CRC is 80–90% but decreases to 65% for all stages [
6]. Therefore, in addition to early detection and treatment, chemoprevention with effective agents is considered extremely important for the comprehensive management of CRC [
7],[
8].
Several pathophysiological mechanisms linking obesity and the development of CRC have been elucidated, including the emergence of insulin resistance, imbalance of adipokines, induction of oxidative stress, and a state of chronic inflammation [
3]-[
5]. Obese and diabetic mice are susceptible to chemically induced colon tumorigenesis [
9]. Diet-induced obesity significantly promotes colon tumor development in mice [
10]. On the other hand, recent studies have demonstrated that certain types of phytochemicals such as curcumin and (−)-epigallocatechin gallate inhibit the development of obesity-related colorectal carcinogenesis in mice by attenuating chronic inflammation [
11],[
12]. Administration of angiotensin-converting enzyme inhibitor also suppresses the early phase of colorectal carcinogenesis in diabetic and hypertensive rats by attenuating inflammation and oxidative stress [
13]. These reports suggest that targeting obesity-related metabolic abnormalities including chronic inflammation and oxidative stress using phytochemicals and specific agents is an effective strategy for preventing CRC development in obese individuals [
3].
Astaxanthin, a conventional red-colored xanthophyll, is an oxygenated carotenoid derivative occurring naturally in a wide variety of living organisms including microalgae, fungi, salmon, trout, shrimp, and some birds [
14],[
15]. Astaxanthin has been shown to exert numerous pharmacological effects due to its antioxidant, anti-inflammatory, antidiabetic, and antineoplastic properties [
8],[
14],[
15]. Supplementation with astaxanthin actually decreased oxidative stress and inflammation in a clinical trial [
16]. In preclinical animal studies, dietary astaxanthin was found to significantly inhibit chemically induced colorectal [
17],[
18], urinary bladder [
19], and oral carcinogenesis [
20]. In particular, anti-inflammatory activity is one of the key mechanisms by which astaxanthin prevents colitis-related CRC development [
17],[
18].
C57BL/KsJ-
db/db (
db/db) mice, which lack the long form of the leptin receptor, develop hyperphagic obesity and diabetes [
21]. Interestingly, the development of colonic premalignant lesions induced by azoxymethane (AOM), a colonic carcinogen widely used to produce preneoplastic and neoplastic colonic lesions that mimic those observed human colon, is significantly enhanced in
db/db mice [
22]. A preclinical animal model using AOM and
db/db mice [
22] has proved useful in investigating specific agents for their ability to prevent inflammation-related colorectal carcinogenesis caused by obesity [
11],[
12],[
23]-[
25]. In the present study, we investigated the effects of astaxanthin on the development of colonic premalignant lesions, i.e., aberrant crypt foci (ACF) and β-catenin accumulated crypts (BCAC) [
26]-[
28], using this obesity-related colorectal carcinogenesis model, with special focus on the reduction of oxidative stress and the attenuation of inflammation.
Methods
Animals and chemicals
Four-week-old male db/db mice were purchased from Japan SLC, Inc. (Shizuoka, Japan) and were maintained humanely at the Gifu University Life Science Research Center in accordance with the Institutional Animal Care Guidelines. AOM was purchased from Sigma-Aldrich (St. Louis, MO, USA). Astaxanthin from Haematococcus pluvialiswas was supplied by Fuji Chemical Industry (Toyama, Japan).
Experimental procedure
All experimental protocols involving animals were approved by the Animal Research Committee, Gifu University Graduate School of Medicine. Forty male
db/db mice were divided into the following 4 groups: untreated control (n = 10); 200 ppm astaxanthin alone (n = 10); AOM alone (n = 10); and, AOM and 200 ppm astaxanthin (n = 10). At 5 weeks of age, mice in AOM alone group and AOM + astaxanthin group were injected with AOM (15 mg/kg body weight) subcutaneously once a week for 4 weeks. None treatment group and AOM alone group were fed the basal diet CRF-1 (the formula of Charles River, Oriental Yeast, Tokyo, Japan) throughout the experiment. The composition of the CRF-1 diet was as follows: 8.1 g/100 g water, 22.6 g/100 g protein, 5.6 g/100 g fat, 6.6 g/100 g minerals, 3.3 g/100 g fiber, and 53.8 g/100 g carbohydrates. Astaxanthin alone group and AOM + astaxanthin group were fed the basal diet supplemented with 200 ppm astaxanthin for 8 weeks, starting 1 week after the last injection of AOM. The dosage of astaxanthin was determined according to a previous report [
18]. Food intakes in all groups were measured daily, while body weights were recorded once a week during the study. At the termination of the study (17 weeks of age), all mice were killed, and the development of ACF and BCAC was analyzed.
Identification and quantification of ACF and BCAC
The numbers of ACF and BCAC were determined according to standard procedures [
12],[
23],[
24],[
29]. After fixing flat in 10% buffered formalin for 24 hours, we stained the colons with methylene blue (0.5% in distilled water) to count ACF. The number of ACF was recorded along with the number of aberrant crypts (ACs) in each focus. The data are expressed per colon. The distal parts of the colon (1 cm from anus; mean area, 0.7 cm
2/colon) were then resected and embedded in paraffin, and a total of 20 serial sections (each 4 μm thick) per mouse were cut by an
en face preparation to identify BCAC intramucosal lesions [
12],[
23],[
24].
Immunohistochemical analyses for β-catenin, proliferating cell nuclear antigen, and nuclear factor-κB
Immunohistochemistry for β-catenin was performed using the labeled streptavidin-biotin method (LSAB Kit; DAKO, Glostrup, Denmark) to count the number of BCAC [
12],[
23],[
24]. The primary antibody for β-catenin (BD Transduction Laboratories, San Jose, CA, USA) was used at a final dilution of 1:1000. Immunohistochemical staining for proliferating cell nuclear antigen (PCNA), which is a G
1-to-S phase marker, and for phospho-nuclear factor-κB (NF-κB) p65 were run on histological sections to estimate cell proliferative activity and NF-κB activity, respectively, in the colonic crypts [
11],[
23], using the LSAB Kit (DAKO) with primary antibodies, anti-PCNA antibody (a final dilution of 1:100, Santa Cruz Biotechnology, Dallas, TX, USA) and anti-phospho-NF-κB p65 antibody (a final dilution of 1:50, Ser276; Cell Signaling Technology, Danvers, MA, USA). The PCNA-labeling index (%) and positive cell index (%) for phospho-NF-κB p65 were determined based on previous methods [
11],[
23].
RNA extraction and quantitative real-time reverse transcription-PCR analysis
Total RNA was isolated from scraped colonic mucosa of experimental mice using the RNeasy Mini Kit (QIAGEN, Venlo, Netherlands). The cDNA was synthesized from 0.2 μg of total RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). A quantitative real-time reverse transcription-PCR (RT-PCR) analysis was performed using a LightCycler Nano (Roche Diagnostics, Indianapolis, IN, USA) with FastStart Essential DNA Green Master (Roche Diagnostics). The PCR cycling conditions were 95°C for 10 min, followed by 45 cycles of 95°C for 10 s, 60°C for 10 s, and 72°C for 15 s. The sequences of specific primers amplifying
tumor necrosis factor (TNF)-α,
interleukin (IL)-1β,
IL-6,
F4/80,
chemokine (C-C motif) ligand (CCL)2,
chemokine (C-X-C motif) ligand (CXCL)2,
glutathione peroxidase (GPx)1,
superoxide dismutase (SOD)1,
catalase (CAT) and
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were obtained from Primer-BLAST (
http://www.ncbi.nlm.nih.gov/tools/primer-blast/; Table
1). The expression levels of
TNF-α,
IL-1β,
IL-6,
F4/80,
CCL2,
CXCL2,
GPx1,
SDO1, and
CAT genes were normalized to the
GAPDH gene expression levels.
Table 1
Primers sequences
TNF-α | forward | TGTCCCTTTCACTCACTGGC |
reverse | CATCTTTTGGGGGAGTGCCT |
IL-1β | forward | GACTTCACCATGGAACCCGT |
reverse | GGAGACTGCCCATTCTCGAC |
IL-6 | forward | TCCAGTTGCCTTCTTGGGAC |
reverse | AGTCTCCTCTCCGGACTTGT |
F4/80 | forward | CTGAACATGCAACCTGCCAC |
reverse | TTCACAGGATTCGTCCAGGC |
CCL2 | forward | GTGCTGACCCCAAGAAGGAA |
reverse | GTGCTGAAGACCTTAGGGCA |
CXCL2 | forward | GGAAGCCTGGATCGTACCTG |
reverse | TGAAAGCCATCCGACTGCAT |
GPx1 | forward | GATCCCCAGAGCGTTACTCG |
reverse | GTTGTGGAAACTCACACGCC |
CAT | forward | GAAGGACCGTGTTTGGTTGC |
reverse | CCGCTGGCGCTTTTCTTGTT |
SOD1 | forward | CTTGACCCTGGATTGCAGCC |
reverse | GTTTCGTGAGGAAGCCAGGA |
GAPDH | forward | GGACCTCATGGCCTACATGG |
reverse | TAGGGCCTCTCTTGCTCAGT |
Clinical chemistry
Blood samples were collected from the inferior vena cava at sacrifice after 6 hours of fasting for chemical analyses. The serum concentrations of insulin (Shibayagi, Gunma, Japan), glucose (BioVision Research Products, Mountain View, CA, USA), adiponectin (R&D Systems, Minneapolis, MN, USA), leptin (R&D Systems), triglyceride (Wako, Osaka, Japan), and TNF-α (R&D Systems) were determined using an enzyme immunoassay, according to the manufacturer’s protocol.
Oxidative stress analysis
Urine 8-hydroxy-2’-deoxyguanosine (8-OHdG) levels were measured using an enzyme-linked immunosorbent assay kit (NIKKEN SEIL, Shizuoka, Japan). Serum levels of hydroperoxide, a marker for oxidative stress, were determined using the derivatives of reactive oxygen metabolites (d-ROMs) test (FREE Carpe Diem, Diacron International s.r.l., Grosseto, Italy) [
30].
Statistical analyses
The measures are presented as mean ± SD and were statistically analyzed using the GraphPad InStat software program, Version 3.05 (GraphPad Software, San Diego, CA, USA) for Macintosh. One-way analysis of variance (ANOVA) was used to compare groups. If the ANOVA analysis indicated significant differences, the Tukey–Kramer multiple comparisons test was performed to compare the mean values among the groups. The differences were considered significant when the two-sided P value was less than 0.05.
Discussion
Obesity, which is one of the most serious healthcare problems worldwide, is a significant risk factor for the development of CRC [
4],[
5]. Oxidative stress and chronic inflammation are key mechanisms linking obesity and colorectal carcinogenesis [
37],[
38]. In particular, increased adipose tissue creates an oxidative environment that can upregulate the expression of various pro-inflammatory cytokines including TNF-α and IL-6, and this is critically associated with CRC development because these cytokines stimulate tumor growth and progression [
31],[
39]. The results of the present study show that astaxanthin exerts preventive effects on the development of the AOM-induced colonic premalignant lesions ACF [
26],[
27] and BCAC [
28] in
db/db obese mice, mainly through the reduction of oxidative stress and attenuation of inflammation.
Saturated fatty acids from obesity-induced lipolysis are capable of activating macrophages and thereby activating NF-κB signaling, which in turn leads to transcriptional activation of genes encoding pro-inflammatory factors including IL-1β and IL-6 [
39]. IL-1β plays a key role in obesity-induced inflammation [
39] and inflammation-related carcinogenesis by modulating the gene expression involved in proliferation, survival, and angiogenesis [
40]. The expression of CCL2, which is associated with infiltration and migration of tumor-related macrophages, has been demonstrated in several tumor tissues including CRC [
32],[
33]. In addition, CXCL2, an inflammatory cytokine, has been shown to participate in the early phase of colorectal carcinogenesis [
34]. In the present study, the expression levels of IL-1β, IL-6, F4/80, CCL2, and CXCL2 mRNA were decreased by astaxanthin in the experimental mice. These findings indicate that overexpression of these inflammatory mediators, which connect obesity and carcinogenesis, may be one of the critical targets of astaxanthin in preventing the development of obesity-related CRC. These findings are also consistent with those from a previous study showing that feeding with astaxanthin significantly suppressed colitis and colitis-related colorectal carcinogenesis by inhibiting NF-κB activation, decreasing the expression of IL-1β and IL-6, and suppressing cell proliferation in mice [
18]. In particular, NF-κB signaling pathway is regarded as one of the key targets of astaxanthin to exert chemopreventive effects [
41].
Obesity and chronic inflammation are often accompanied with increased generation of reactive oxygen species (ROS), which are derivatives of molecular oxygen such as superoxide and hydrogen peroxide. These derivatives can induce mutagenic changes and may damage DNA repair proteins, resulting in cancer development [
40],[
42]. Cancer cells are also known to cause oxidative stress by generating ROS and modulating antioxidant enzymes [
43]. In the present study, oxidative stress markers, including urinary levels of 8-OHdG and serum levels of d-ROMs, were significantly suppressed, while the expression levels of
GPx1,
SOD1, and
CAT mRNA, which encode antioxidant enzymes, in the colonic mucosa were increased by astaxanthin intake in AOM-injected
db/db mice. These results strongly indicate that attenuation of oxidative stress and recuperation from high oxidation state via antioxidative effects are critical mechanisms by which astaxanthin suppressed the occurrence of premalignant lesions, ACF and BCAC, in obese mice. It should be mentioned that astaxanthin has even been called a super-antioxidant because it is a superior antioxidant and scavenger of free radicals as compared with other carotenoids such as β-carotene [
44].
Epidemiologically, it is still unclear whether the intake of carotenoids such as astaxanthin is associated with a reduced risk of CRC development. The results of randomized trials using β-carotene supplementation provided no evidence to support an effect of carotenoids on CRC chemoprevention [
45],[
46]. Rather, intervention trials using high-dose β-carotene supplements showed an increase in the incidence of lung cancer in high-risk patients, like smokers and/or workers exposed to asbestos [
47],[
48]. On the other hand, astaxanthin has been demonstrated to be safe in several human clinical trials [
16],[
49],[
50]. Moreover, astaxanthin supplementation has positive effects on lipid profiles and oxidative stress in overweight and obese subjects, at least in part by activating the antioxidant defense system [
49],[
50]. Taken together, these observations suggest that obese individuals, who are at high-risk of developing CRC and colorectal adenomas [
5], may be appropriate subjects for interventional trials using astaxanthin for the prevention of colorectal tumorigenesis.
Previous reports using metabolic syndrome animal models have shown that astaxanthin reduces insulin resistance, recovers insulin sensitivity, and increases serum levels of adiponectin [
51],[
52]. A double-blind randomized controlled trial also reported that astaxanthin consumption significantly increases blood adiponectin levels [
53]. Furthermore, targeting insulin resistance and adipokine imbalance are suggested to be effective methods of preventing obesity-related colorectal tumorigenesis [
3]. Therefore, we initially expected that astaxanthin would inhibit the development of ACF and BCAC in the AOM-treated
db/db mice by ameliorating insulin resistance and improving adipokine imbalance. However, abnormalities in serum levels of glucose, insulin, adiponectin, and leptin were not improved by astaxanthin administration in this study. We suggest that this was likely due to the duration of the experiment (8 weeks) and the particular animal model studied, because previous studies demonstrating effects of astaxanthin on insulin sensitivity were long-term studies (22 weeks) [
51] and the animals were not genetically obese [
51],[
52]. Our results were consistent with another study investigating the effect of astaxanthin on the apoptosis of retinal ganglion cells using
db/db mice, in which insulin resistance was not improved by astaxanthin, but apoptosis of retinal ganglion cells was attenuated via the suppression of oxidative stress [
54]. Future long-term studies should be conducted to confirm that astaxanthin inhibits the early phase of obesity-related colon tumorigenesis by improving insulin resistance and the imbalance of adipokines in several animal models. In our experimental model, astaxanthin suppressed the development of obesity-related colorectal tumorigenesis by targeting oxidative stress, inflammation, and cell proliferation.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
TK, MS, TT, and HM conceived of the study, participated in its design, and drafted the manuscript. TK, TS, and YS performed in vivo experiment. MK performed statistical analysis. All authors read and approved the final manuscript.