Materials and methods
Materials and reagents
The following reagents were employed for the transduction of E6 and E7 oncogenes in HaCaT cells: PCR system kit (cat. no. 11 732 650 001; Roche Applied Science), pGEM‑T easy cloning vector (cat. no. A1360; Promega Corporation, Madison, WI, USA), pLVX‑Puro lentiviral expression vector (cat. no. 632164; Clontech Laboratories, Inc., Mountain View,CA, USA), Lenti‑X 293T cells (cat. no. 632180; Clontech Laboratories, Inc.), Lenti‑X Lentiviral Expression system (Clontech Laboratories,Inc.), Lenti‑X GoStix (Clontech Laboratories, Inc.), RNeasy Plus Mini kit (Cat. 74136; QIAGEN Mexico, S. de R.L. de C.V., San Ángel, Mexico). For RT-qPCR we employed TRIzol reagent (Invitrogen, Carlsbad, CA), Transcriptor First Strand cDNA Synthesis kit (Roche Applied Science), LightCycler® FastStart DNA Master PLUS SYBR Green I kit (Roche Applied Science) and the LightCycler 2.0 instrument (Roche Applied Science). The cell culture medium employed was the Dulbecco's modified Eagle's medium (DMEM) high glucose supplement with GlutaMAX™, 10% of fetal bovine serum (FBS) or 10% of charcoal stripped FBS, penicillin G and streptomycin, all obtained from Gibco; Thermo Fisher Scientific, Inc. (Waltham, MA, USA); the stimuli were done with 17β-estradiol E8875, and prolactin human recombinant L4021 both from Sigma‑Aldrich; Merck KGaA (Darmstadt, Germany). Finally, the antibodies PRL-R sc-20992 rabbit polyclonal IgG, ER-α sc-542 rabbit polyclonal IgG, ERβ sc-373853 mouse monoclonal IgG2b, β-Actin sc-47778 mouse monoclonal, goat anti-rabbit IgG-HRP sc-2004, goat anti-mouse IgG-HRP sc-2005 1:10,000 all from Santa Cruz Biotechnology and Anti-G-protein (ab39742) coupled receptor 30 antibody from Abcam were employed for western blot and immunofluorescence.
Cell culture conditions
Cervical cancer cell lines (HeLa and SiHa), were obtained from the American Type Culture Collection (Manassas, VA, USA); and non-tumorigenic human keratinocytes (HaCaT) cell line was kindly provided by Dr. Petra Boukamp from the German Cancer Research Center (DKFZ, Heidelberg, Germany). Cells were cultured in a water-jacketed incubator at 37 °C under an atmosphere of 95% air and 5% CO2 in culture medium and grown to 80% confluence. The growth culture medium consisted in DMEM medium supplemented with 10% FBS, penicillin (100 U/ml), streptomycin (100 μg/ml); when experiments involving hormonal stimuli were performed, supplemented media were prepared with FBS charcoal-stripped (10%).
HaCaT cells transduced with E6 or E7 from HPV-16 and -18
The HaCaT cell lines transduced with E6 and E7 oncogenes and pLVX control were provided for the Drs. Luis Felipe Jave Suárez and Cristina Artaza Irigaray from Centro de Investigación Biomédica de Occidente (CIBO).
E6 and E7 cloning were performed by endpoint PCR for amplifying E6 and E7 open reading frame (ORF) from genomic DNA samples obtained from biopsies of patients infected with HPV-16 or -18. The following primer sets were employed: HPV 16 E6, forward: 5′ CAG ACA TTT TAT GCA CCA AA 3′, and reverse: 5′ CTC CAT GCA TGA TTA CAG C 3′; HPV 16 E7, forward: 5′ TAG AGA AAC CCA GCT GTA ATC A 3′, and reverse: 5′ AGG ATC AGC CAT GGT AGA TTA T 3′; HPV 18 E6, forward: 5′ AAT ACT ATG GCG CGC TTT GA 3′, and reverse: 5′ TTG CCT TAG GTC CAT GCA TAC T; and HPV 18 E7, forward: 5′ CGC AGA GAA ACA CAA GTA TAA T 3′ and reverse: 5′ GAT CAG CCA TTG TTG CTT A 3′. The four amplified products were independently cloned into a pGEM‑T Easy cloning vector and were employed for the transformation of TOP10 Chemically Competent E. coli by the technique of heat shock, the transformed bacteria were selected and then a restriction analysis with EcoRI was carried out and the genomes of the oncoproteins were sequenced and corroborated with the reference sequences reported in GenBank (HPV 16, accession no. K02718; HPV 18, accession no. AY262282;
https://www.ncbi.nlm.nih.gov/genbank/); only HPV 16 E6 exhibited a substitution described in the AF402678 HPV 16 sequence (268T > G). Finally, the ORFs of the oncogenes were subcloned into a pLVX‑Puro lentiviral expression vector.
As for HaCaT cells infection, Lenti‑X 293T cells were employed to produce infectious viral particles through the Lenti‑X Lentiviral Expression system. These cells were independently transfected with pLVX‑Puro empty vector, pLVX‑HPV16E6, pLVX‑HPV16E7, pLVX‑HPV18E6 or pLVX‑HPV18E7 vectors, using the Lenti‑X HTX Packaging system. After 48 h post‑transfection, the supernatants with infectious viral particles were collected, the presence of the virus particles was determined using Lenti‑X GoStix. HaCaT cells were individually infected with 100 μl of each viral supernatant and then the transduced cells were selected with 1 μg/ml puromycin. The E6 and E7 expression levels in HaCaT cells were determined with reverse transcription‑quantitative PCR (RT‑qPCR) using the same primers used for cloning. For the RNA extraction, the RNeasy Plus Mini kit was used according to the manufacturer's protocol and then followed the procedure described in RT-qPCR.
Hormone stimuli
The cells were grown into 6-well plates with DMEM medium supplemented with 10% charcoal stripped fetal bovine serum at approximately 80% confluence, after the hormones were added (17β-estradiol, 10 nM; and prolactin, 200 ng/ml) and stored in a water‑jacketed incubator at 37˚C in an atmosphere containing 5% CO2 for 4 h.
Total RNA isolation and RT-qPCR
Total RNA was isolated using the phenol–chloroform technique with TRIzol reagent according to the manufacturer’s instructions. The quality and quantification were determined with spectrophotometric reading at 260, 280 and 230 nm using a NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific, Inc.). Retrotranscription using 5 μg of total RNA was achieved using the Transcriptor First Strand cDNA Synthesis kit primed with Oligo dT, according to the manufacturer's protocol. cDNA was used to confirm E6, E7, ERα, ERβ, GPER and PRLR expression using the LightCycler® FastStart DNA Master PLUS SYBR Green I kit on a LightCycler 2.0 instrument, according to the manufacturer's protocol. To normalize qPCR reactions, RPL32 expression was employed for HeLa and SiHa cells and ACTB for HaCaT transduced cells; the primers used to amplify the sequences are in Table
1. Thermocycling conditions were the following: One denaturation step at 95 °C for 10 min, followed by an amplification program of 40 cycles consisting of 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 12 s, finally a final extension step at 72 °C for 10 min. The relative expression was calculated using the 2
−ΔΔCq and 2
−ΔCq methods.
Table 1
Primers employed in qPCR
E6 HPV 16 | 5′ CAGACATTTTATGCACCA AA 3' | 5′ CTCCATGCATGATTACAGC 3' |
E7 HPV 16 | 5′ TAGAGAAACCCAGCTGTAATCA 3' | 5′ AGGATCAGCCATGGTAGATTAT 3' |
E6 HPV 18 | 5′ AATACTATGGCCGCTTTGA 3' | 5′ TTGCCTTAGGTCCATGCATACT 3' |
E7 HPV 18 | 5′ CGCAGAGAAACACAAGTATAAT 3' | 5′ GATCAGCCATTGTTGCTTA 3' |
RPL32 | 5′ GCATTGACAACAGGGTTCGTA G 3' | 5′ ATTTAAACAGAAAACGTGCACA 3' |
ESR1 | 5′-CCGGCTCCGTAAATGCTACG-3′ | 5′-TCCAGCAGACCCCACTTCAC-3’ |
ESR2 | 5′-TCGGAAGTGTTACGAAGTGGGAATGG-3′ | 5′-GCACTTCTCTGTCTCCGCACAA-3′ |
GPER | 5′ AGTCGGATGTGAGGTTCAG 3′ | 5′ TCTGTGTGAGGAGTGCAA G 3′ |
PRLR | 5´-AGTGAACTTCTGATACATTTCCTGC-3´ | 5´-TTGCAGATGCCACATTTTCCT-3´ |
ACTB | 5′-CATGTACGTTGCTATCCAGGC-3’ | 5′-CTCCTTAATGTCACGCACGAT-3’ |
Western blotting
40 µg of total protein extract from all cell lines (pLVX and cell lines transduced with the oncogenes) were mixed with loading buffer and denatured at 95 °C for 5 min. Afterward, electrophoresis was performed on 10% SDS polyacrylamide gels for proteins to be resolved. Transference to PVDF membranes was carried out for 1.5 h followed by a 24-h blocking step. Membranes were incubated in a primary antibody solution, diluted 1:500 and they were kept overnight. After incubation with secondary antibody (1:5000) membranes were revealed by a chemiluminescence system. MicroChemi 6.0 was used to reveal membranes and GelQuant software was used to analyze optical densitometry.
Fluorescence immunocytochemistry
20,000 cells of each pLVX and cells transduced with the oncogenes were placed on 8-cell slides for 48 h. Cells were washed with PBS (0.2% albumin) and fixed with 4% paraformaldehyde for 10 min at room temperature. The cells were permeabilized with PBS (0.2% tween 20) for 10 min at 37 °C. Subsequently, the blocking step was carried out with PBS (10% FBS, 1% BSA) for 1 h at 37 °C. Antibodies were added with the following dilutions: PRL-R 1:50, ER-α 1:25, and ERβ 1:25. The incubation with the primary antibody was performed overnight, and then with the secondary antibody (1:2500) for 2 h and lastly, the nucleus was stained with DAPI (1:20,000) for 10 min and protected from light. Slides were observed under an Axio Imager 2 fluorescence microscope (Carl Zeiss, Gôttingen, Germany), using filters with the following excitation ranges: Alexa Fluor excitation: 495 nm, emission: 519 nm; DAPI excitation: 351 nm; emission: 461 nm. This analysis was performed with 2 independent assays for each cell line and at least 5 different fields were taken for each sample.
Statistical analysis
Statistical assessment was conducted using GraphPad Prism 6 (GraphPad Software, Inc., La Jolla, CA, USA) statistical software. Data obtained from three independent tests were analyzed using a Kruskal Wallis test followed by unpaired t-test. The data are presented as the means ± standard deviation and statistically significant differences were considered for p-values < 0.05.
Discussion
HPV is considered the main causal agent for the development of CC and despite this, it is known that infection with this virus is insufficient for the development of this disease. Therefore, other factors are required, among them the hormonal ones that cooperate for their permanence and the beginning of the malignant transformation [
4].
While most murine models confirm that cervical carcinomas are addicted to estrogens, and especially to their ERα, few human studies show that their expression declines in cancer [
4,
5,
7,
18,
19]. However, we have recently observed that both, ERα and ERβ, nuclear receptors are overexpressed in CC and its precursor lesions, and their expression increases gradually as lesions progress to CC [
8]. Likewise, the GPER expression is also increased in CC in comparison with premalignant lesions; the location of this receptor was predominantly in the cytoplasm, although it was also evidenced in the nucleus of the epithelial cells [
14]. Other reports had shown that the GPER is located in the membrane and cytoplasm of CC tissue samples; however, its location in the nucleus was not observed [
10]. In the case of breast tumors, an expression of GPER in the cytoplasm was associated with low-stage histological subtypes and the nuclear location was associated with poorly differentiated carcinomas, which leads to conclude that nuclear location may have unfavorable tumor properties [
20]. On the other hand, the expression of PRL at a systemic level in patients with CC also reveals contradictory results. We recently identified a 60 kDa PRL secreted by cells derived from CC that is bioactive [
12]. In addition, we observed high expression of PRLR in CC as opposed to premalignant lesions [
11].
Although there are not many studies that demonstrate the participation of estrogen and prolactin in cervical carcinogenesis, these have also been related to the development of mammary tumors and their receptors are an important therapeutic target in breast cancer. It has been found that, as in CC, there is an autocrine secretion of prolactin in the tumor cells, and the activation of PRLR triggers the signaling pathway of Src-ERK-AKT and phosphorylate the ERα inducing the activation and recruitment of the receptor to the ERE [
20,
24‐
26]. On the other hand, it is known that the alone expression of ERα or PRLR is not related to affect the progression of the tumor, whereas the co-expression of both receptors is associated to the induction of invasion and a reduced response to estrogen antagonists. In CC, PRLR and ERα are also co-expressed, which indicates that there may be an interaction between both receptors [
13,
27‐
29].
E2 and 60 kDa PRL have no direct effect on cell survival as assessed by the processes of proliferation and apoptosis; however, both hormones have an effect on the cellular metabolism of cell lines derived from CC positive for HPV infection [
8].
Although the estrogen and prolactin receptors are co-expressed in CC, a persistent HPV infection is present in almost all cases of this type of cancer [
8]. For this reason, it is interesting to evaluate the interaction between these hormones with HPV and its involvement in modulating the expression of their receptors, as well as evaluating how these hormones may be cooperating with HPV to modify its regulation and favor the persistence of infection and tumor progression.
E2 increases the transcription of important oncogenes of the HPV, resulting in the degradation of p53 and cell cycle alterations [
17]; however, the role that PRL could have on this process is unknown. Here we show that both, E2 and PRL, have the capacity to increase the expression of E6 and E7 oncogenes in SiHa and HeLa cells that have an infection by HPV 16 and 18, respectively.
It is known that the genome of HPV 16 has two sites of EREs [
17]; however, its functional significance remains to be elucidated.
Viral oncogenes directly deregulate ER coactivators by altering gene expression [
21]. We demonstrated that E6 and E7 oncogenes from HPV 16 and 18 are able to increase the expression and modify the location of hormone receptors. In the case of estrogen receptors, the oncogenes locate them in the nucleus and cytoplasm, and they increase the expression and cytoplasmic localization of the PRLR.
These changes in the location of the receptors lead us to suppose that signaling pathways related to metabolic and hormonal regulation could be activated, as well as HPV oncogenes activation. However, further analyses are necessary to find this out.
The physiological relationship between estrogen and prolactin has been well demonstrated [
15,
16]; however, the impact of this relationship on cancer has been little explored. Numerous studies have accepted the synergism between estrogen and PRL in the promotion of breast cancer and the ability of PRL to activate ERα in the absence of its natural ligand [
14,
15]. This leads us to suppose that one of the ways that PRL could use to activate the E6/E7 oncogenes of HPV would be through the activation of ERα. It is known that E2 through ERα is essential for the transition to cancer observed in a model of mice infected with the E6 and E7 oncogenes of HPV16 [
7].
Publisher's Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.