Skip to main content
Erschienen in: BMC Cancer 1/2013

Open Access 01.12.2013 | Research article

Involvement of nitric oxide synthase in matrix metalloproteinase-9- and/or urokinase plasminogen activator receptor-mediated glioma cell migration

verfasst von: Thompson Zhuang, Bharath Chelluboina, Shivani Ponnala, Kiran Kumar Velpula, Azeem A Rehman, Chandramu Chetty, Eleonora Zakharian, Jasti S Rao, Krishna Kumar Veeravalli

Erschienen in: BMC Cancer | Ausgabe 1/2013

Abstract

Background

Src tyrosine kinase activates inducible nitric oxide synthase (iNOS) and, in turn, nitric oxide production as a means to transduce cell migration. Src tyrosine kinase plays a key proximal role to control α9β1 signaling. Our recent studies have clearly demonstrated the role of α9β1 integrin in matrix metalloproteinase-9 (MMP-9) and/or urokinase plasminogen activator receptor (uPAR)-mediated glioma cell migration. In the present study, we evaluated the involvement of α9β1 integrin-iNOS pathway in MMP-9- and/or uPAR-mediated glioma cell migration.

Methods

MMP-9 and uPAR shRNAs and overexpressing plasmids were used to downregulate and upregulate these molecules, respectively in U251 glioma cells and 5310 glioma xenograft cells. The effect of treatments on migration and invasion potential of these glioma cells were assessed by spheroid migration, wound healing, and Matrigel invasion assays. In order to attain the other objectives we also performed immunocytochemical, immunohistochemical, RT-PCR, Western blot and fluorescence-activated cell sorting (FACS) analysis.

Results

Immunohistochemical analysis revealed the prominent association of iNOS with glioblastoma multiforme (GBM). Immunofluorescence analysis showed prominent expression of iNOS in glioma cells. MMP-9 and/or uPAR knockdown by respective shRNAs reduced iNOS expression in these glioma cells. RT-PCR analysis revealed elevated iNOS mRNA expression in either MMP-9 or uPAR overexpressed glioma cells. The migration potential of MMP-9- and/or uPAR-overexpressed U251 glioma cells was significantly inhibited after treatment with L-NAME, an inhibitor of iNOS. Similarly, a significant inhibition of the invasion potential of the control or MMP-9/uPAR-overexpressed glioma cells was noticed after L-NAME treatment. A prominent reduction of iNOS expression was observed in the tumor regions of nude mice brains, which were injected with 5310 glioma cells, after MMP-9 and/or uPAR knockdown. Protein expressions of cSrc, phosphoSrc and p130Cas were reduced with simultaneous knockdown of both MMP-9 and uPAR.

Conclusions

Taken together, our results from the present and earlier studies clearly demonstrate that α9β1 integrin-mediated cell migration utilizes the iNOS pathway, and inhibition of the migratory potential of glioma cells by simultaneous knockdown of MMP-9 and uPAR could be attributed to the reduced α9β1 integrin and iNOS levels.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1471-2407-13-590) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

JSR and KK Veeravalli were involved in the conception, hypotheses delineation, and design of the study. TZ conducted wound healing assay, spheroid migration assay, immunocytochemical, immunohistochemical and Western blot analysis. BC performed an assay that detects nitric oxide in cancer cells. SP performed Matrigel invasion assay, tissue array and RT-PCR analysis. CC involved in animal-related experiments. AAR and KK Velpula conducted FACS and Western blot analysis. The above-mentioned authors conducted the required experiments, performed the acquisition of the data or analyzed such information. BC and KK Veeravalli drafted the manuscript. EZ involved in the review of the manuscript prior to its submission. All authors read and approved the final manuscript.
Abkürzungen
MMP
Matrix metalloproteinase
UPAR
Urokinase plasminogen activator receptor
iNOS
Inducible nitric oxide synthase
NO
Nitric oxide
GBM
Glioblastoma multiforme
ECM
Extracellular matrix
PKG
Protein kinase G
L-NAME
L-NG-Nitroarginine methyl ester
GC
Guanylyl cyclase
cGMP
Cyclic guanosine monophosphate
RT-PCR
Reverse transcription polymerase chain reaction
PBS
Phosphate buffered saline
CMV
Cytomegalovirus
DAB
3,3′-Diaminobenzidine
DAF-2DA
Diaminofluorescein-2 Diacetate.

Background

High grade gliomas invariably recur due in a large part to tumor cells penetrating the normal brain in an inaccessible, diffuse manner. Further, the tendency of glioblastoma multiforme (GBM) cells to migrate and invade normal brain tissue renders surgical interventions ineffective [1]. Glioma cell migration and invasion is generally separated into three phases. First, the glioma cells attach to proteins located in the extracellular matrix (ECM) with the aid of cell adhesion receptors. Subsequently, ECM proteins are degraded by proteases secreted by the glioma cells, such as MMPs and serine proteases. ECM degradation provides opportunity for active glioma cell migration through the intercellular space. In human glioma cells, MMP-9 and uPAR have been found to be overexpressed. MMP-9 has been implicated in ECM degradation, angiogenesis, and subsequent tumor growth and invasion [2, 3]. A strong relationship exists between MMP-9 levels and cell migratory/invasive potential due to the crucial role of MMPs in proteolysis of the ECM. Of the MMPs, MMP-9 was found to be most closely linked to tumor grade [47]. In addition to MMPs, the serine protease uPA has been established to be active in the degradation of the ECM. The binding of uPA to uPAR is essential both in vitro and in vivo for cancer cell metastasis, invasion, and migration. Inhibition of uPAR prevented cancer cell metastasis. Elevated levels of both uPA and uPAR were observed in human carcinoma cells, elucidating uPAR’s critical role in cancer cell migration. Silencing MMP-9 and/or uPAR decreased cell adhesion to ECM proteins—a process known to promote tumor cell migration and invasion [8]. MMP-9 and/or uPAR gene silencing also reduced invasive/migratory potential and growth of glioma cells [8]. Our recent studies clearly demonstrated the involvement of α9β1 integrin in MMP-9-/uPAR-mediated glioma cell migration [9]. Integrin α9β1 regulates inducible nitric oxide synthase (iNOS) activity via Src tyrosine kinase; Src coordinates subsequent signaling pathways through activation of FAK and tyrosine phosphorylation of the adaptor protein p130Cas [10].
Inducible nitric oxide synthase and nitric oxide (NO) are closely linked to tumor growth, proliferation, and poor prognosis in humans with malignant glioma. NO is a heme co-factor that activates soluble guanylyl cyclase (GC) to produce cGMP, which regulates cell migration in both a protein kinase G (PKG) dependent and independent fashion [11, 12]. NO, derived from tumor iNOS, is an important modulator of tumor progression and angiogenesis in C6 glioma cells [13]. Tumor-derived NO may also promote invasiveness through the induction of MMP-9 expression by tumor cells. Tumors with MMP-9 overexpression had significantly higher iNOS activity and cGMP levels compared with tumors that had absent or focal expression of MMP-9 in head and neck squamous cell carcinoma [14]. Recently, it was reported that α9β1 integrin regulates iNOS activity, which resulted in increased NO production and NO-induced cell migration [10]. Because α9β1 integrin plays a crucial role in MMP-9 and uPAR-mediated cell migration in glioma, we hypothesized that MMP-9 and uPAR utilize iNOS via α9β1 integrin to arbitrate cell migration. In the present study, we investigated the involvement of the α9β1 integrin-iNOS pathway in MMP-9- and/or uPAR- mediated glioma cell migration.

Methods

Ethics statement

The Institutional Animal Care and Use Committee of the University of Illinois College of Medicine at Peoria, Peoria, IL approved all surgical interventions and post-operative animal care.

Chemicals and reagents

L-NG-Nitroarginine methyl ester (L-NAME) was obtained from Sigma (St. Louis, MO). Recombinant human uPAR was obtained from R&D Systems (Minneapolis, MN). Anti-α9β1 integrin, anti-NOS2, anti-cSRC and anti-p130Cas antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-phosphoSRC (Tyr 416) antibody was obtained from Cell Signaling (Boston, MA). Anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody was obtained from Novus Biologicals (Littleton, CO). Diaminofluorescein-2 Diacetate (DAF-2DA) was obtained from Enzo Life Sciences (Farmingdale, NY).

Construction of shRNA- and gene-expressing plasmids

Plasmid shRNAs for MMP-9 (M-sh), uPAR (U-sh) and MMP-9-uPAR (MU-sh) were designed in our laboratory [15] and used to transfect the cells. Briefly, a pCDNA-3 plasmid with a human cytomegalovirus (CMV) promoter was used to construct the shRNA-expressing vectors. A pCDNA3-scrambled vector with an imperfect sequence, which does not form a perfect hairpin structure, was used as a control (SV-sh). MMP-9 human cDNA cloned in pDNR-CMV vector in our laboratory was used for full-length MMP-9 (M-fl) overexpression. We used uPAR human cDNA cloned in pCMV6-AC vector (Origene, Rockville, MD) for full-length uPAR (U-fl) overexpression.

Cell culture and transfection conditions

U251 human glioma cells obtained from the National Cancer Institute (NCI) (Frederick, MD) were grown in DMEM supplemented with 10% fetal bovine serum (FBS) (Hyclone, Logan, UT) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA). 5310 human glioma xenograft cells were kindly provided by Dr. David James at the University of California, San Francisco. These xenografts were generated and maintained in mice and are highly invasive in the mouse brain [16]. 5310 xenografts were maintained in RPMI 1640 supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37°C in a humidified atmosphere containing 5% CO2. U251 and 5310 cells were transfected with SV-sh, M-sh, U-sh, MU-sh, M-fl, or U-fl using Fugene® HD reagent obtained from Roche Diagnostics, (Indianapolis, IN) according to the manufacturer’s instructions.

Wound healing assay

To study cell migration, we seeded U251 glioma cells at a density of 1.5 × 106 or 2 × 106 in a 6-well plate and transfected the cells with M-fl, or U-fl for 72 hrs. Then, a straight scratch was made in individual wells with a 200 μl pipette tip. This point was considered the “0 hr,” time point and the width of the wound was photographed under the microscope. Again at the 21st hr, the cells were checked for wound healing and photographed under the microscope. Wound healing was measured by calculating the reduction in the width of the wound after incubation. The involvement of the iNOS pathway on M-fl- or U-fl-mediated glioma cell migration was assessed by adding L-NAME (1 mM final concentration) at “0 hr” to the appropriate wells containing glioma cells transfected with M-fl, or U-fl.

Spheroid migration assay

U251 glioma cells were cultured in 96-well plates coated with 1% agar. Briefly, 3 × 104 cells/well were seeded and cultured on a shaker at 100 rpm for 48 hr in a humidified atmosphere containing 5% CO2 at 37°C. After the formation of spheroids, they were transfected with M-fl or U-fl overexpressing plasmids. 48 hr after transfection, the spheroids were transferred to 24-well plates at a density of one spheroid/well and incubated at 37°C. At this time point, a few spheroids from each group were treated with L-NAME at a final concentration of 1 mM. Twenty-four hours after incubation, the spheroids were fixed and stained with Hema-3. Cell migration from the spheroids was assessed using light microscopy. The migration of cells from spheroids to monolayers was used as an index of cell migration and was measured using a microscope calibrated with a stage and ocular micrometer.

Matrigel invasion assay

U251 and 5310 glioma cells were transfected with M-fl or U-fl for 72 hr. Cells were trypsinized and 5 × 104 cells were placed onto Matrigel-coated transwell inserts of 8-mm pore size. A few of the transwells containing untreated and M-fl- or U-fl-transfected glioma cells were then subjected to L-NAME (1 mM) treatment. Cells were allowed to migrate through the Matrigel for 24 to 48 hr. Then, cells in the upper chamber were removed with a cotton swab. The cells that adhered on the outer surface of the transwell insert and had invaded through the matrigel were fixed, stained with Hema-3, and counted under a light microscope as described earlier (Veeravalli et al., [8]).

Intracranial administrations in nude mice

5310 glioma xenograft cells were trypsinized and re-suspended in serum-free medium at a concentration of 0.2 × 105 cells/μL. Nude mice were injected intracerebrally with 10 μL aliquot (0.2 × 105 cells/μL) under isofluorane anesthesia with the aid of a stereotactic frame. After two weeks, mice were separated into four groups. The first group served as control. The second, third, and fourth groups served as M-sh-treated (150 μg), U-sh-treated (150 μg), and MU-sh-treated (150 μg) groups, respectively. M-sh, U-sh and MU-sh plasmid DNAs were injected into the brains of nude mice using Alzet mini pumps at the rate of 0.2 μL/hr. The concentration of the plasmid solution was 2 μg/μL (100 μl per mouse, six mice in each group). After 5 weeks, the mice were sacrificed by intracardiac perfusion, first with PBS and then with 4% paraformaldehyde in normal saline. The brains were removed, stored in 4% paraformaldehyde, processed, embedded in paraffin, and sectioned (5 μm thick) using a microtome. Paraffin-embedded sections were processed for immunohistochemical analysis.

Immunohistochemical analysis

Paraffin-embedded brain sections (5 μm thick) from control and treatment groups were de-paraffinized following standard protocol. The sections were rinsed with PBS and treated with 1% BSA in PBS to prevent non-specific staining and incubated with anti-iNOS antibody (1:100 dilution) at 4°C overnight. The sections were then washed in PBS and incubated with the appropriate HRP-conjugated secondary antibody for 1 hr at room temperature. After 1 hr, the sections were washed in PBS and incubated in DAB for 30 min. The slides were further washed with sterile water, stained with hematoxylin and dehydrated. The slides were then covered with glass cover slips and photomicrographs were obtained. Immunohistochemical analysis for iNOS protein expression was also performed on the slide tissue microarrays (obtained from US Biomax, Inc., Rockville, MD) of clinical GBM samples according to the manufacturer’s instructions.

Immunocytochemical analysis

U251 and 5310 cells (1 × 104) were seeded on 2-well chamber slides, incubated for 24 h, and transfected with SV-sh, M-sh, U-sh, or MU-sh for 72 hrs. Then, cells were fixed with 10% buffered formalin phosphate and incubated with 1% bovine serum albumin in PBS at room temperature for 1 hr to avoid non-specific staining. After the slides were washed with PBS, anti-iNOS antibody was added at a concentration of 1:100. The slides were incubated overnight at 4°C and washed three times with PBS to remove excess primary antibody. Cells were then incubated with Alexa Fluor® 594 (goat anti-mouse IgG, red) fluorescent-labeled secondary antibody for 1 hr at room temperature. The slides were then washed another three times with PBS, exposed to DAPI containing mounting media, covered with glass coverslips, and fluorescent photomicrographs were obtained.

Reverse transcription PCR analysis

Total cell RNA was isolated from untreated U251 and 5310 glioma cells and from those transfected with M-fl, or U-fl. Approximately 1 μg of total RNA from each sample was synthesized into cDNA following the manufacturer’s instructions using the Transcriptor First Strand cDNA Synthesis Kit obtained from Roche Diagnostics (Indianapolis, IN). We used the following sequences for the forward and reverse primers:
  •  for iNOS, 5′cgqiztgtggaagcggtaacaaagga3′ (forward) and 5′tgccattgttggtggagtaa3′ (reverse);
  •  for βActin, 5′ggcatcctcaccctgaagta3′ (forward) and 5′ggggtgttgaaggtctcaaa3′ (reverse).
Reverse transcription - polymerase chain reaction (RT-PCR) was set up using the following PCR cycle: 95°C for 5 min, (95°C for 30 sec, 55–60°C for 30 sec, and 72°C for 30 sec) × 35 cycles, and 72°C for 10 min. PCR products were resolved on a 1.6% agarose gel, visualized, and photographed under UV light.

Western blot analysis

U251 and 5310 cells were transfected with SV-sh, M-sh, U-sh, M-fl and U-fl for 72 hrs. Cells were collected and lysed in RIPA buffer [50 mmol/mL Tris–HCl (pH 8.0), 150 mmol/mL NaCl, 1% IGEPAL, 0.5% sodium deoxycholate, 0.1% SDS] containing 1 mM sodium orthovanadate, 0.5 mM PMSF, 10 μg/mL aprotinin, 10 μg/mL leupeptin and resolved via SDS-PAGE. After overnight transfer onto nitrocellulose membranes, blots were blocked with 5% non-fat dry milk in PBS and 0.1% Tween-20. Blots were then incubated with primary antibody, followed by incubation with HRP-conjugated secondary antibody. Immunoreactive bands were visualized using chemiluminescence ECL Western blotting detection reagents on Hyperfilm-MP autoradiography film obtained from Amersham (Piscataway, NJ). GAPDH (housekeeping gene) antibody was used to verify that similar amounts of protein were loaded in all lanes.

FACS analysis

U251 and 5310 cells were seeded on 100-mm tissue culture plates. Cells were transfected with M-fl, transfected with M-fl and blocked with α9β1 antibody, treated with recombinant uPAR or treated with recombinant uPAR and blocked with α9β1 antibody. 48–72 hrs after transfection or 1–2 hrs after recombinant uPAR treatment, cells were treated with 50 mM EDTA, washed with PBS, pelleted at 1000 rpm for 5 min, and re-suspended in PBS in an appendorff tube at a concentration of 1 × 106 cells/mL. Cells were then incubated with HRP-conjugated iNOS antibody for 1 hr on ice, pelleted, and washed three times with PBS to remove excess primary antibody. Cells were then re-suspended in 1 ml of PBS and incubated with Alexa Fluor® 594 (goat anti-mouse IgG, red) fluorescent labeled secondary antibody for 1 hr on ice. After three more washes in PBS, cell pellet was re-suspended in 10% buffered formalin and analyzed on a Coulter EPICS XL AB6064 flow cytometer (Beckman Coulter, Fullerton, CA).

Detection of NO in 5310 glioma cells

DAF-2DA is a non-fluorescent cell permeable reagent that can measure free NO in living cells. Once inside the cell, the diacetate groups of the DAF-2DA reagent are hydrolyzed by cytosolic esterases, thus releasing DAF-2 and sequestering the reagent inside the cell. Production of NO in the cell, if any, converts the non-fluorescent dye, DAF-2, to its fluorescent triazole derivative, DAF-2 T. 5310 glioma xenograft cells cultured in 12-well plates were transfected with MMP-9 or uPAR overexpressing plasmids (M-fl or U-fl, respectively) or MU-sh plasmid shRNA. Seventy two hours after transfection, a few wells containing M-fl or U-fl transfected 5310 cells were treated with L-NAME (1 mM). In order to demonstrate that MMP-9 and uPAR-mediated glioma cell migration utilizes nitric oxide, four hours after treatment with L-NAME, 5310 glioma cells from all the treatment groups including controls were treated with DAF-2DA reagent and the cells were incubated for 60 min at 37°C. To remove the excess dye and stain, the nucleus for quantitative analysis, samples were washed with PBS and resuspended in PBS containing DAPI. Green fluorescence and the respective DAPI images were captured by using a fluorescent microscope.

Densitometry

Densitometry was performed using Image J Software (National Institutes of Health) to quantify the band intensities obtained from Western blot analysis. Data represent average values from three separate experiments.

Statistical analysis

Statistical comparisons were performed using Graph Pad Prism software (version 3.02). Quantitative data from Western blot analysis, wound healing assay, spheroid migration assay and matrigel invasion assays were evaluated for statistical significance using one-way ANOVA. Bonferroni’s post hoc test (multiple comparison tests) was used to compare any statistical significance between groups. Differences in the values were considered significant at p < 0.05.

Results and discussion

Effect of inhibition of iNOS on cell migration and invasion

Recently, it was reported that treatment with NO donor, sodium nitroprusside significantly induced motility of glioma cell lines [17]. In addition application of the iNOS inhibitor, L-NAME, to these glioma cell lines impaired their movement. In the present study, prominent and significant reduction in wound healing (indicative of decreased migration potential) was noticed in L-NAME-treated control, M-fl-, and U-fl- transfected U251 glioma cells as compared to untreated cells from the respective groups (Figure 1a). In addition, our results have clearly demonstrated that the wound healing significantly increased (indicative of increased cell migration) in M-fl- and U-fl- transfected U251 glioma cells as compared to control U251 cells. This is in agreement with our earlier report wherein we showed an increased cell migration of 5310 human glioma xenograft cells after MMP-9 or uPAR overexpression [8]. Further, in the present study, we assessed the effect of iNOS inhibition on MMP-9- or uPAR-mediated glioma cell migration in U251 cells by spheroid migration assay. We noticed a significant reduction in the migration potential of M-fl- or U-fl- transfected U251 cells from their spheroids after treatment with L-NAME (Figure 1b). These results have clearly demonstrated the involvement of iNOS in the cell migration mediated by MMP-9 or uPAR in glioma cells. As expected, we noticed an increased invasion potential of both U251 glioma cells and 5310 glioma xenografts after transfection with M-fl and U-fl overexpression plasmids (Figure 2a). L-NAME treatment prominently and significantly reduced the invasion potential of untreated and M-fl- or U-fl- transfected U251 and 5310 cells (Figure 2b). In the present study, reduced invasion potential of untreated glioma cells after L-NAME treatment was also attributed to MMP-9 and uPAR involvement because simultaneous knockdown of MMP-9 and uPAR in glioma xenograft cells significantly reduced their invasion potential compared to untreated glioma cells [8].

Inducible nitric oxide synthase expression in glioma

Endogenous NO exhibits pleotropic roles within cancer cells and tumors, and studies employing inhibition or genetic deletion of endogenous NO synthases (NOSs) support a tumor-promoting role for NO [18, 19]. We noticed prominent iNOS protein expression in clinical GBM samples (Figure 2c). We also noticed prominent iNOS expression in U251 and 5310 human glioma cells that were utilized in the present study (Figure 3a). High iNOS expression correlates with decreased survival in human glioma patients, and iNOS inhibition slows glioma growth in animal models [20]. MMP-9 or uPAR knockdown by shRNA-mediated gene silencing reduced iNOS protein expression in U251 and 5310 glioma cells. Reduction of iNOS expression was prominent when these cells were simultaneously downregulated with both MMP-9 and uPAR compared to their individual knockdowns (Figure 3a). Alternatively, it is also possible that the NO generated from iNOS activation can regulate both the expression of MMP-9 and its activation through cGMP dependent or independent mechanisms [11, 12, 21]. As expected, iNOS protein expression was noticed in gliomas obtained after intracranial implantation of 5310 cells in nude mice. However, these glioma cells-implanted nude mice showed reduced iNOS expression after treatments with M-sh, U-sh or MU-sh (Figure 3b). Recently, we have reported a significant reduction of intracranial tumor growth in these nude mice after M-sh, U-sh or MU-sh treatments [8, 22]. Increased iNOS mRNA expression in MMP-9 or uPAR overexpressed glioma cells further demonstrated the interaction between MMP-9/uPAR and iNOS (Figure 3c).

Interactions among MMP-9/uPAR, α9β1 integrin and iNOS in glioma cells

Our recent studies clearly demonstrated the role played by α9β1 integrin in MMP-9-/uPAR-mediated glioma cell migration [8, 23]. α9β1 integrin ligation can activate signaling through Src and FAK-mediated tyrosine phosphorylation of multiple proteins including p130Cas and paxillin [24, 25]. In agreement with these reports, protein expression of several molecules [cSRC, pSRC (Tyr416), p130Cas] associated with α9β1-mediated cell migration were significantly affected after M-sh, U-sh, or MU-sh treatments in both U251 and 5310 cells (Figure 4a & 4b). Src activation was a proximal and dominant signaling regulating α9β1-mediated cell migration [25]. However, the molecular details of α9β1-induced Src activation remain to be elucidated. It could be possible that Src may directly interact with the cytoplasmic tail of α9, subsequently recruiting other signaling proteins to form an associated multimeric signaling complex which can activate iNOS. Recently it was shown that integrin α9β1 regulates iNOS activity via Src tyrosine kinase, resulting in increased NO production and NO-induced cell migration [25]. FACS analysis demonstrated that the overexpression of MMP-9 by transfection with MMP-9 overexpressing plasmid or treatment with recombinant uPAR in both U251 and 5310 glioma cells increased iNOS expression (Figure 5a). The increased iNOS expression in these cells has been reverted with α9β1 integrin blockade, indicating that MMP-9 or uPAR regulates iNOS via α9β1 integrin. Although the α9β1 integrin blockade in recombinant uPAR treated 5310 glioma cells did not prominently effect the iNOS expression, blockade of iNOS expression by L-NAME in uPAR overexpressed 5310 cells significantly reduced their invasion potential (Figure 5a & 2b). Further, α9β1 integrin blockade in uPAR overexpressed 5310 glioma cells significantly reduced their migration potential [8]. As expected, protein expression of iNOS was significantly increased upon MMP-9/uPAR overexpression in these glioma cells (Figure 5b & 5c). In addition to the reduced cell migration after L-NAME treatment in MMP-9 or uPAR overexpressed U251 glioma cells in the present study, increased NO production in MMP-9 or uPAR overexpressed glioma cells and the associated reduction in NO levels in those cells after L-NAME treatment clearly demonstrated the possible involvement of NO in MMP-9 or uPAR- regulated glioma cell migration (Figure 6). NO production was reduced in MMP-9 and uPAR knockdown 5310 glioma cells compared to controls (Figure 6). In the present study, although the reduced NO levels in MMP-9 and uPAR knockdown glioma cells are not significant compared to controls, the reduction in NO levels could be sufficient to significantly reduce glioma cell migration. These results allowed us to attribute the involvement of iNOS pathway in addition to other demonstrated pathways to the reduced glioma cell migration after MMP-9 and uPAR shRNA-mediated gene silencing that was demonstrated earlier [8].
Activation of iNOS can promote cancer cell migration via multiple mechanisms. NO generated from iNOS activation can act as a co-factor to GC to promote synthesis of the second messenger cGMP, which regulates cell migration in both a PKG dependent and independent fashion [11, 12]. Relevant to integrin function, NO released into the cellular microenvironment can impact the assembly of focal adhesions. NO-induced delay of focal adhesion assembly or their premature de-stabilization has significant effects on cell migratory responses. Further, the reduced NO levels after inhibition of iNOS by genetic and pharmacological approaches impede glial cell proliferation, invasiveness, and tumor growth in vivo [26]. A previous study demonstrated that the natural products with anti-inflammatory effects such as wogonin and quercetin inhibited MMP-9 activity, iNOS expression and NO production in rat glioma C6 cells [27]. The reduced glioma cell migration in the present study after MMP-9 and/or uPAR knockdown is possibly attributed to the regulation of iNOS pathway via α9β1 integrin which are downstream to both MMP-9 and uPAR (Figure 7).

Conclusions

MMP-9/uPAR overexpression enhanced the potential of glioma cell migration and invasion. L-NAME, an inhibitor of iNOS, inhibited MMP-9-/uPAR-induced glioma cell migration and invasion. iNOS expression was associated with GBM. MMP-9/uPAR overexpression increased iNOS expression and vice versa. MMP-9 and/or uPAR downregulation reduced the protein expression levels of several molecules associated with the α9β1-iNOS pathway mediated cell migration. In summary, glioma cells expressing MMP-9 and/or uPAR utilize α9β1-iNOS pathway to mediate cell migration.

Acknowledgements

This research was supported by a grant from National Institute of Neurological Disorders and Stroke, NS047699 (PI: Jasti S. Rao). The contents are solely the responsibility of the authors and do not necessarily represent the official views of National Institute of Health. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. We thank Dr. Alarcon, Professor of Pediatrics for providing access to flow cytometer, Noorjehan Ali for technical assistance, Debbie McCollum for manuscript preparation, and Diana Meister for manuscript review.
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

JSR and KK Veeravalli were involved in the conception, hypotheses delineation, and design of the study. TZ conducted wound healing assay, spheroid migration assay, immunocytochemical, immunohistochemical and Western blot analysis. BC performed an assay that detects nitric oxide in cancer cells. SP performed Matrigel invasion assay, tissue array and RT-PCR analysis. CC involved in animal-related experiments. AAR and KK Velpula conducted FACS and Western blot analysis. The above-mentioned authors conducted the required experiments, performed the acquisition of the data or analyzed such information. BC and KK Veeravalli drafted the manuscript. EZ involved in the review of the manuscript prior to its submission. All authors read and approved the final manuscript.
Literatur
1.
Zurück zum Zitat Giese A, Westphal M: Glioma invasion in the central nervous system. Neurosurgery. 1996, 39: 235-250. 10.1097/00006123-199608000-00001.CrossRefPubMed Giese A, Westphal M: Glioma invasion in the central nervous system. Neurosurgery. 1996, 39: 235-250. 10.1097/00006123-199608000-00001.CrossRefPubMed
2.
Zurück zum Zitat Ramos-DeSimone N, Hahn-Dantona E, Sipley J, Nagase H, French DL, Quigley JP: Activation of matrix metalloproteinase-9 (MMP-9) via a converging plasmin/stromelysin-1 cascade enhances tumor cell invasion. J Biol Chem. 1999, 274: 13066-13076. 10.1074/jbc.274.19.13066.CrossRefPubMed Ramos-DeSimone N, Hahn-Dantona E, Sipley J, Nagase H, French DL, Quigley JP: Activation of matrix metalloproteinase-9 (MMP-9) via a converging plasmin/stromelysin-1 cascade enhances tumor cell invasion. J Biol Chem. 1999, 274: 13066-13076. 10.1074/jbc.274.19.13066.CrossRefPubMed
3.
Zurück zum Zitat Kallakury BV, Karikehalli S, Haholu A, Sheehan CE, Azumi N, Ross JS: Increased expression of matrix metalloproteinases 2 and 9 and tissue inhibitors of metalloproteinases 1 and 2 correlate with poor prognostic variables in renal cell carcinoma. Clin Cancer Res. 2001, 7: 3113-3119.PubMed Kallakury BV, Karikehalli S, Haholu A, Sheehan CE, Azumi N, Ross JS: Increased expression of matrix metalloproteinases 2 and 9 and tissue inhibitors of metalloproteinases 1 and 2 correlate with poor prognostic variables in renal cell carcinoma. Clin Cancer Res. 2001, 7: 3113-3119.PubMed
4.
Zurück zum Zitat Kachra Z, Beaulieu E, Delbecchi L, Mousseau N, Berthelet F, Moumdjian R, del Maestro R, Beliveau R: Expression of matrix metalloproteinases and their inhibitors in human brain tumors. Clin Exp Metastasis. 1999, 17: 555-566. 10.1023/A:1006760632766.CrossRefPubMed Kachra Z, Beaulieu E, Delbecchi L, Mousseau N, Berthelet F, Moumdjian R, del Maestro R, Beliveau R: Expression of matrix metalloproteinases and their inhibitors in human brain tumors. Clin Exp Metastasis. 1999, 17: 555-566. 10.1023/A:1006760632766.CrossRefPubMed
5.
Zurück zum Zitat Raithatha SA, Muzik H, Muzik H, Rewcastle NB, Johnston RN, Edwards DR, Forsyth PA: Localization of gelatinase-A and gelatinase-B mRNA and protein in human gliomas. Neurooncol. 2000, 2: 145-150. Raithatha SA, Muzik H, Muzik H, Rewcastle NB, Johnston RN, Edwards DR, Forsyth PA: Localization of gelatinase-A and gelatinase-B mRNA and protein in human gliomas. Neurooncol. 2000, 2: 145-150.
6.
Zurück zum Zitat Rooprai HK, van Meter T, Rucklidge GJ, Hudson L, Everall IP, Pilkington GJ: Comparative analysis of matrix metalloproteinases by immunocytochemistry, immunohistochemistry and zymography in human primary brain tumours. Int J Oncol. 1998, 13: 1153-1157.PubMed Rooprai HK, van Meter T, Rucklidge GJ, Hudson L, Everall IP, Pilkington GJ: Comparative analysis of matrix metalloproteinases by immunocytochemistry, immunohistochemistry and zymography in human primary brain tumours. Int J Oncol. 1998, 13: 1153-1157.PubMed
7.
Zurück zum Zitat Rao JS, Steck PA, Mohanam S, Stetler-Stevenson WG, Liotta LA, Sawaya R: Elevated levels of M(r) 92,000 type IV collagenase in human brain tumors. Cancer Res. 1993, 53: 2208-2211.PubMed Rao JS, Steck PA, Mohanam S, Stetler-Stevenson WG, Liotta LA, Sawaya R: Elevated levels of M(r) 92,000 type IV collagenase in human brain tumors. Cancer Res. 1993, 53: 2208-2211.PubMed
8.
Zurück zum Zitat Veeravalli KK, Chetty C, Ponnala S, Gondi CS, Lakka SS, Fassett D, Klopfenstein JD, Dinh DH, Gujrati M, Rao JS: MMP-9, uPAR and cathepsin B silencing downregulate integrins in human glioma xenograft cells in vitro and in vivo in nude mice. PLoS One. 2010, 5: e11583-10.1371/journal.pone.0011583.CrossRefPubMedPubMedCentral Veeravalli KK, Chetty C, Ponnala S, Gondi CS, Lakka SS, Fassett D, Klopfenstein JD, Dinh DH, Gujrati M, Rao JS: MMP-9, uPAR and cathepsin B silencing downregulate integrins in human glioma xenograft cells in vitro and in vivo in nude mice. PLoS One. 2010, 5: e11583-10.1371/journal.pone.0011583.CrossRefPubMedPubMedCentral
10.
Zurück zum Zitat Gupta SK, Vlahakis NE: Integrin alpha9beta1: Unique signaling pathways reveal diverse biological roles. Cell Adh Migr. 2010, 4: 194-198. 10.4161/cam.4.2.10900.CrossRefPubMedPubMedCentral Gupta SK, Vlahakis NE: Integrin alpha9beta1: Unique signaling pathways reveal diverse biological roles. Cell Adh Migr. 2010, 4: 194-198. 10.4161/cam.4.2.10900.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Jadeski LC, Chakraborty C, Lala PK: Nitric oxide-mediated promotion of mammary tumour cell migration requires sequential activation of nitric oxide synthase, guanylate cyclase and mitogen-activated protein kinase. Int J Cancer. 2003, 106: 496-504. 10.1002/ijc.11268.CrossRefPubMed Jadeski LC, Chakraborty C, Lala PK: Nitric oxide-mediated promotion of mammary tumour cell migration requires sequential activation of nitric oxide synthase, guanylate cyclase and mitogen-activated protein kinase. Int J Cancer. 2003, 106: 496-504. 10.1002/ijc.11268.CrossRefPubMed
12.
Zurück zum Zitat Ridnour LA, Windhausen AN, Isenberg JS, Yeung N, Thomas DD, Vitek MP, Roberts DD, Wink DA: Nitric oxide regulates matrix metalloproteinase-9 activity by guanylyl-cyclase-dependent and -independent pathways. Proc Natl Acad Sci USA. 2007, 104: 16898-16903. 10.1073/pnas.0702761104.CrossRefPubMedPubMedCentral Ridnour LA, Windhausen AN, Isenberg JS, Yeung N, Thomas DD, Vitek MP, Roberts DD, Wink DA: Nitric oxide regulates matrix metalloproteinase-9 activity by guanylyl-cyclase-dependent and -independent pathways. Proc Natl Acad Sci USA. 2007, 104: 16898-16903. 10.1073/pnas.0702761104.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Kostourou V, Cartwright JE, Johnstone AP, Boult JK, Cullis ER, Whitley G, Robinson SP: The role of tumour-derived iNOS in tumour progression and angiogenesis. Br J Cancer. 2011, 104: 83-90. 10.1038/sj.bjc.6606034.CrossRefPubMed Kostourou V, Cartwright JE, Johnstone AP, Boult JK, Cullis ER, Whitley G, Robinson SP: The role of tumour-derived iNOS in tumour progression and angiogenesis. Br J Cancer. 2011, 104: 83-90. 10.1038/sj.bjc.6606034.CrossRefPubMed
14.
Zurück zum Zitat Franchi A, Santucci M, Masini E, Sardi I, Paglierani M, Gallo O: Expression of matrix metalloproteinase 1, matrix metalloproteinase 2, and matrix metalloproteinase 9 in carcinoma of the head and neck. Cancer. 2002, 95: 1902-1910. 10.1002/cncr.10916.CrossRefPubMed Franchi A, Santucci M, Masini E, Sardi I, Paglierani M, Gallo O: Expression of matrix metalloproteinase 1, matrix metalloproteinase 2, and matrix metalloproteinase 9 in carcinoma of the head and neck. Cancer. 2002, 95: 1902-1910. 10.1002/cncr.10916.CrossRefPubMed
15.
Zurück zum Zitat Lakka SS, Gondi CS, Dinh DH, Olivero WC, Gujrati M, Rao VH, Sioka C, Rao JS: Specific interference of uPAR and MMP-9 gene expression induced by double-stranded RNA results in decreased invasion, tumor growth and angiogenesis in gliomas. J Biol Chem. 2005, 280: 21882-21892. 10.1074/jbc.M408520200.CrossRefPubMed Lakka SS, Gondi CS, Dinh DH, Olivero WC, Gujrati M, Rao VH, Sioka C, Rao JS: Specific interference of uPAR and MMP-9 gene expression induced by double-stranded RNA results in decreased invasion, tumor growth and angiogenesis in gliomas. J Biol Chem. 2005, 280: 21882-21892. 10.1074/jbc.M408520200.CrossRefPubMed
16.
Zurück zum Zitat Giannini C, Sarkaria JN, Saito A, Uhm JH, Galanis E, Carlson BL, Schroeder MA, James CD: Patient tumor EGFR and PDGFRA gene amplifications retained in an invasive intracranial xenograft model of glioblastoma multiforme. Neurooncol. 2005, 7: 164-176. Giannini C, Sarkaria JN, Saito A, Uhm JH, Galanis E, Carlson BL, Schroeder MA, James CD: Patient tumor EGFR and PDGFRA gene amplifications retained in an invasive intracranial xenograft model of glioblastoma multiforme. Neurooncol. 2005, 7: 164-176.
17.
Zurück zum Zitat Pullen NA, Fillmore HL: Induction of matrix metalloproteinase-1 and glioma cell motility by nitric oxide. J Neurooncol. 2010, 96: 201-209. 10.1007/s11060-009-9965-6.CrossRefPubMed Pullen NA, Fillmore HL: Induction of matrix metalloproteinase-1 and glioma cell motility by nitric oxide. J Neurooncol. 2010, 96: 201-209. 10.1007/s11060-009-9965-6.CrossRefPubMed
18.
Zurück zum Zitat Fukumura D, Kashiwagi S, Jain RK: The role of nitric oxide in tumour progression. Nat Rev Cancer. 2006, 6: 521-534. 10.1038/nrc1910.CrossRefPubMed Fukumura D, Kashiwagi S, Jain RK: The role of nitric oxide in tumour progression. Nat Rev Cancer. 2006, 6: 521-534. 10.1038/nrc1910.CrossRefPubMed
19.
Zurück zum Zitat Williams EL, Djamgoz MB: Nitric oxide and metastatic cell behaviour. Bioessays. 2005, 27: 1228-1238. 10.1002/bies.20324.CrossRefPubMed Williams EL, Djamgoz MB: Nitric oxide and metastatic cell behaviour. Bioessays. 2005, 27: 1228-1238. 10.1002/bies.20324.CrossRefPubMed
20.
Zurück zum Zitat Eyler CE, Wu Q, Yan K, MacSwords JM, Chandler-Militello D, Misuraca KL, Lathia JD, Forrester MT, Lee J, Stamler JS, Goldman SA, Bredel M, McLendon RE, Sloan AE, Hjelmeland AB, Rich JN: Glioma stem cell proliferation and tumor growth are promoted by nitric oxide synthase-2. Cell. 2011, 146: 53-66. 10.1016/j.cell.2011.06.006.CrossRefPubMedPubMedCentral Eyler CE, Wu Q, Yan K, MacSwords JM, Chandler-Militello D, Misuraca KL, Lathia JD, Forrester MT, Lee J, Stamler JS, Goldman SA, Bredel M, McLendon RE, Sloan AE, Hjelmeland AB, Rich JN: Glioma stem cell proliferation and tumor growth are promoted by nitric oxide synthase-2. Cell. 2011, 146: 53-66. 10.1016/j.cell.2011.06.006.CrossRefPubMedPubMedCentral
21.
Zurück zum Zitat Babykutty S, Suboj P, Srinivas P, Nair AS, Chandramohan K, Gopala S: Insidious role of nitric oxide in migration/invasion of colon cancer cells by upregulating MMP-2/9 via activation of cGMP-PKG-ERK signaling pathways. Clin Exp Metastasis. 2012, 29: 471-492. 10.1007/s10585-012-9464-6.CrossRefPubMed Babykutty S, Suboj P, Srinivas P, Nair AS, Chandramohan K, Gopala S: Insidious role of nitric oxide in migration/invasion of colon cancer cells by upregulating MMP-2/9 via activation of cGMP-PKG-ERK signaling pathways. Clin Exp Metastasis. 2012, 29: 471-492. 10.1007/s10585-012-9464-6.CrossRefPubMed
22.
Zurück zum Zitat Chetty C, Lakka SS, Bhoopathi P, Gondi CS, Veeravalli KK, Fassett D, Klopfenstein JD, Dinh DH, Gujrati M, Rao JS: Urokinase plasminogen activator receptor and/or matrix metalloproteinase-9 inhibition induces apoptosis signaling through lipid rafts in glioblastoma xenograft cells. Mol Cancer Ther. 2010, 9: 2605-2617. 10.1158/1535-7163.MCT-10-0245.CrossRefPubMedPubMedCentral Chetty C, Lakka SS, Bhoopathi P, Gondi CS, Veeravalli KK, Fassett D, Klopfenstein JD, Dinh DH, Gujrati M, Rao JS: Urokinase plasminogen activator receptor and/or matrix metalloproteinase-9 inhibition induces apoptosis signaling through lipid rafts in glioblastoma xenograft cells. Mol Cancer Ther. 2010, 9: 2605-2617. 10.1158/1535-7163.MCT-10-0245.CrossRefPubMedPubMedCentral
23.
Zurück zum Zitat Veeravalli KK, Ponnala S, Chetty C, Tsung AJ, Gujrati M, Rao JS: Integrin alpha9beta1-mediated cell migration in glioblastoma via SSAT and Kir4.2 potassium channel pathway. Cell Signal. 2012, 24: 272-281. 10.1016/j.cellsig.2011.09.011.CrossRefPubMed Veeravalli KK, Ponnala S, Chetty C, Tsung AJ, Gujrati M, Rao JS: Integrin alpha9beta1-mediated cell migration in glioblastoma via SSAT and Kir4.2 potassium channel pathway. Cell Signal. 2012, 24: 272-281. 10.1016/j.cellsig.2011.09.011.CrossRefPubMed
24.
Zurück zum Zitat Young BA, Taooka Y, Liu S, Askins KJ, Yokosaki Y, Thomas SM, Sheppard D: The cytoplasmic domain of the integrin alpha9 subunit requires the adaptor protein paxillin to inhibit cell spreading but promotes cell migration in a paxillin-independent manner. Mol Biol Cell. 2001, 12: 3214-3225. 10.1091/mbc.12.10.3214.CrossRefPubMedPubMedCentral Young BA, Taooka Y, Liu S, Askins KJ, Yokosaki Y, Thomas SM, Sheppard D: The cytoplasmic domain of the integrin alpha9 subunit requires the adaptor protein paxillin to inhibit cell spreading but promotes cell migration in a paxillin-independent manner. Mol Biol Cell. 2001, 12: 3214-3225. 10.1091/mbc.12.10.3214.CrossRefPubMedPubMedCentral
25.
Zurück zum Zitat Gupta SK, Vlahakis NE: Integrin alpha9beta1 mediates enhanced cell migration through nitric oxide synthase activity regulated by Src tyrosine kinase. J Cell Sci. 2009, 122: 2043-2054. 10.1242/jcs.041632.CrossRefPubMedPubMedCentral Gupta SK, Vlahakis NE: Integrin alpha9beta1 mediates enhanced cell migration through nitric oxide synthase activity regulated by Src tyrosine kinase. J Cell Sci. 2009, 122: 2043-2054. 10.1242/jcs.041632.CrossRefPubMedPubMedCentral
26.
Zurück zum Zitat Jahani-Asl A, Bonni A: iNOS: a potential therapeutic target for malignant glioma. Curr Mol Med. 2013, 13: 1241-1249. 10.2174/1566524011313080002.CrossRefPubMedPubMedCentral Jahani-Asl A, Bonni A: iNOS: a potential therapeutic target for malignant glioma. Curr Mol Med. 2013, 13: 1241-1249. 10.2174/1566524011313080002.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Chen TJ, Shen SC, Lin HY, Chien LL, Chen YC: Lipopolysaccharide enhancement of 12-o-tetradecanoylphorbol 13-acetate-mediated transformation in rat glioma C6, accompanied by induction of inducible nitric oxide synthase. Toxicol Lett. 2004, 147: 1-13. 10.1016/j.toxlet.2003.10.012.CrossRefPubMed Chen TJ, Shen SC, Lin HY, Chien LL, Chen YC: Lipopolysaccharide enhancement of 12-o-tetradecanoylphorbol 13-acetate-mediated transformation in rat glioma C6, accompanied by induction of inducible nitric oxide synthase. Toxicol Lett. 2004, 147: 1-13. 10.1016/j.toxlet.2003.10.012.CrossRefPubMed
Metadaten
Titel
Involvement of nitric oxide synthase in matrix metalloproteinase-9- and/or urokinase plasminogen activator receptor-mediated glioma cell migration
verfasst von
Thompson Zhuang
Bharath Chelluboina
Shivani Ponnala
Kiran Kumar Velpula
Azeem A Rehman
Chandramu Chetty
Eleonora Zakharian
Jasti S Rao
Krishna Kumar Veeravalli
Publikationsdatum
01.12.2013
Verlag
BioMed Central
Erschienen in
BMC Cancer / Ausgabe 1/2013
Elektronische ISSN: 1471-2407
DOI
https://doi.org/10.1186/1471-2407-13-590

Weitere Artikel der Ausgabe 1/2013

BMC Cancer 1/2013 Zur Ausgabe

Nodal-negativ nach neoadjuvanter Chemo: Axilladissektion verzichtbar?

03.05.2024 Mammakarzinom Nachrichten

Wenn bei Mammakarzinomen durch eine neoadjuvante Chemotherapie ein Downstaging von nodal-positiv zu nodal-negativ gelingt, scheint es auch ohne Axilladissektion nur selten zu axillären Rezidiven zu kommen.

Wo hapert es noch bei der Umsetzung der POMGAT-Leitlinie?

03.05.2024 DCK 2024 Kongressbericht

Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.

Bestrahlung nach Prostatektomie: mehr Schaden als Nutzen?

02.05.2024 Prostatakarzinom Nachrichten

Eine adjuvante Radiotherapie nach radikaler Prostata-Op. bringt den Betroffenen wahrscheinlich keinen Vorteil. Im Gegenteil: Durch die Bestrahlung steigt offenbar das Risiko für Harn- und Stuhlinkontinenz.

Endlich: Zi zeigt, mit welchen PVS Praxen zufrieden sind

IT für Ärzte Nachrichten

Darauf haben viele Praxen gewartet: Das Zi hat eine Liste von Praxisverwaltungssystemen veröffentlicht, die von Nutzern positiv bewertet werden. Eine gute Grundlage für wechselwillige Ärzte und Psychotherapeuten.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.