Background
High grade gliomas invariably recur due in a large part to tumor cells penetrating the normal brain in an inaccessible, diffuse manner. Further, the tendency of glioblastoma multiforme (GBM) cells to migrate and invade normal brain tissue renders surgical interventions ineffective [
1]. Glioma cell migration and invasion is generally separated into three phases. First, the glioma cells attach to proteins located in the extracellular matrix (ECM) with the aid of cell adhesion receptors. Subsequently, ECM proteins are degraded by proteases secreted by the glioma cells, such as MMPs and serine proteases. ECM degradation provides opportunity for active glioma cell migration through the intercellular space. In human glioma cells, MMP-9 and uPAR have been found to be overexpressed. MMP-9 has been implicated in ECM degradation, angiogenesis, and subsequent tumor growth and invasion [
2,
3]. A strong relationship exists between MMP-9 levels and cell migratory/invasive potential due to the crucial role of MMPs in proteolysis of the ECM. Of the MMPs, MMP-9 was found to be most closely linked to tumor grade [
4‐
7]. In addition to MMPs, the serine protease uPA has been established to be active in the degradation of the ECM. The binding of uPA to uPAR is essential both
in vitro and
in vivo for cancer cell metastasis, invasion, and migration. Inhibition of uPAR prevented cancer cell metastasis. Elevated levels of both uPA and uPAR were observed in human carcinoma cells, elucidating uPAR’s critical role in cancer cell migration. Silencing MMP-9 and/or uPAR decreased cell adhesion to ECM proteins—a process known to promote tumor cell migration and invasion [
8]. MMP-9 and/or uPAR gene silencing also reduced invasive/migratory potential and growth of glioma cells [
8]. Our recent studies clearly demonstrated the involvement of α9β1 integrin in MMP-9-/uPAR-mediated glioma cell migration [
9]. Integrin α9β1 regulates inducible nitric oxide synthase (iNOS) activity via Src tyrosine kinase; Src coordinates subsequent signaling pathways through activation of FAK and tyrosine phosphorylation of the adaptor protein p130Cas [
10].
Inducible nitric oxide synthase and nitric oxide (NO) are closely linked to tumor growth, proliferation, and poor prognosis in humans with malignant glioma. NO is a heme co-factor that activates soluble guanylyl cyclase (GC) to produce cGMP, which regulates cell migration in both a protein kinase G (PKG) dependent and independent fashion [
11,
12]. NO, derived from tumor iNOS, is an important modulator of tumor progression and angiogenesis in C6 glioma cells [
13]. Tumor-derived NO may also promote invasiveness through the induction of MMP-9 expression by tumor cells. Tumors with MMP-9 overexpression had significantly higher iNOS activity and cGMP levels compared with tumors that had absent or focal expression of MMP-9 in head and neck squamous cell carcinoma [
14]. Recently, it was reported that α9β1 integrin regulates iNOS activity, which resulted in increased NO production and NO-induced cell migration [
10]. Because α9β1 integrin plays a crucial role in MMP-9 and uPAR-mediated cell migration in glioma, we hypothesized that MMP-9 and uPAR utilize iNOS via α9β1 integrin to arbitrate cell migration. In the present study, we investigated the involvement of the α9β1 integrin-iNOS pathway in MMP-9- and/or uPAR- mediated glioma cell migration.
Methods
Ethics statement
The Institutional Animal Care and Use Committee of the University of Illinois College of Medicine at Peoria, Peoria, IL approved all surgical interventions and post-operative animal care.
Chemicals and reagents
L-NG-Nitroarginine methyl ester (L-NAME) was obtained from Sigma (St. Louis, MO). Recombinant human uPAR was obtained from R&D Systems (Minneapolis, MN). Anti-α9β1 integrin, anti-NOS2, anti-cSRC and anti-p130Cas antibodies were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-phosphoSRC (Tyr 416) antibody was obtained from Cell Signaling (Boston, MA). Anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody was obtained from Novus Biologicals (Littleton, CO). Diaminofluorescein-2 Diacetate (DAF-2DA) was obtained from Enzo Life Sciences (Farmingdale, NY).
Construction of shRNA- and gene-expressing plasmids
Plasmid shRNAs for MMP-9 (M-sh), uPAR (U-sh) and MMP-9-uPAR (MU-sh) were designed in our laboratory [
15] and used to transfect the cells. Briefly, a pCDNA-3 plasmid with a human cytomegalovirus (CMV) promoter was used to construct the shRNA-expressing vectors. A pCDNA3-scrambled vector with an imperfect sequence, which does not form a perfect hairpin structure, was used as a control (SV-sh). MMP-9 human cDNA cloned in pDNR-CMV vector in our laboratory was used for full-length MMP-9 (M-fl) overexpression. We used uPAR human cDNA cloned in pCMV6-AC vector (Origene, Rockville, MD) for full-length uPAR (U-fl) overexpression.
Cell culture and transfection conditions
U251 human glioma cells obtained from the National Cancer Institute (NCI) (Frederick, MD) were grown in DMEM supplemented with 10% fetal bovine serum (FBS) (Hyclone, Logan, UT) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA). 5310 human glioma xenograft cells were kindly provided by Dr. David James at the University of California, San Francisco. These xenografts were generated and maintained in mice and are highly invasive in the mouse brain [
16]. 5310 xenografts were maintained in RPMI 1640 supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37°C in a humidified atmosphere containing 5% CO
2. U251 and 5310 cells were transfected with SV-sh, M-sh, U-sh, MU-sh, M-fl, or U-fl using Fugene® HD reagent obtained from Roche Diagnostics, (Indianapolis, IN) according to the manufacturer’s instructions.
Wound healing assay
To study cell migration, we seeded U251 glioma cells at a density of 1.5 × 106 or 2 × 106 in a 6-well plate and transfected the cells with M-fl, or U-fl for 72 hrs. Then, a straight scratch was made in individual wells with a 200 μl pipette tip. This point was considered the “0 hr,” time point and the width of the wound was photographed under the microscope. Again at the 21st hr, the cells were checked for wound healing and photographed under the microscope. Wound healing was measured by calculating the reduction in the width of the wound after incubation. The involvement of the iNOS pathway on M-fl- or U-fl-mediated glioma cell migration was assessed by adding L-NAME (1 mM final concentration) at “0 hr” to the appropriate wells containing glioma cells transfected with M-fl, or U-fl.
Spheroid migration assay
U251 glioma cells were cultured in 96-well plates coated with 1% agar. Briefly, 3 × 104 cells/well were seeded and cultured on a shaker at 100 rpm for 48 hr in a humidified atmosphere containing 5% CO2 at 37°C. After the formation of spheroids, they were transfected with M-fl or U-fl overexpressing plasmids. 48 hr after transfection, the spheroids were transferred to 24-well plates at a density of one spheroid/well and incubated at 37°C. At this time point, a few spheroids from each group were treated with L-NAME at a final concentration of 1 mM. Twenty-four hours after incubation, the spheroids were fixed and stained with Hema-3. Cell migration from the spheroids was assessed using light microscopy. The migration of cells from spheroids to monolayers was used as an index of cell migration and was measured using a microscope calibrated with a stage and ocular micrometer.
Matrigel invasion assay
U251 and 5310 glioma cells were transfected with M-fl or U-fl for 72 hr. Cells were trypsinized and 5 × 10
4 cells were placed onto Matrigel-coated transwell inserts of 8-mm pore size. A few of the transwells containing untreated and M-fl- or U-fl-transfected glioma cells were then subjected to L-NAME (1 mM) treatment. Cells were allowed to migrate through the Matrigel for 24 to 48 hr. Then, cells in the upper chamber were removed with a cotton swab. The cells that adhered on the outer surface of the transwell insert and had invaded through the matrigel were fixed, stained with Hema-3, and counted under a light microscope as described earlier (Veeravalli et al., [
8]).
Intracranial administrations in nude mice
5310 glioma xenograft cells were trypsinized and re-suspended in serum-free medium at a concentration of 0.2 × 105 cells/μL. Nude mice were injected intracerebrally with 10 μL aliquot (0.2 × 105 cells/μL) under isofluorane anesthesia with the aid of a stereotactic frame. After two weeks, mice were separated into four groups. The first group served as control. The second, third, and fourth groups served as M-sh-treated (150 μg), U-sh-treated (150 μg), and MU-sh-treated (150 μg) groups, respectively. M-sh, U-sh and MU-sh plasmid DNAs were injected into the brains of nude mice using Alzet mini pumps at the rate of 0.2 μL/hr. The concentration of the plasmid solution was 2 μg/μL (100 μl per mouse, six mice in each group). After 5 weeks, the mice were sacrificed by intracardiac perfusion, first with PBS and then with 4% paraformaldehyde in normal saline. The brains were removed, stored in 4% paraformaldehyde, processed, embedded in paraffin, and sectioned (5 μm thick) using a microtome. Paraffin-embedded sections were processed for immunohistochemical analysis.
Immunohistochemical analysis
Paraffin-embedded brain sections (5 μm thick) from control and treatment groups were de-paraffinized following standard protocol. The sections were rinsed with PBS and treated with 1% BSA in PBS to prevent non-specific staining and incubated with anti-iNOS antibody (1:100 dilution) at 4°C overnight. The sections were then washed in PBS and incubated with the appropriate HRP-conjugated secondary antibody for 1 hr at room temperature. After 1 hr, the sections were washed in PBS and incubated in DAB for 30 min. The slides were further washed with sterile water, stained with hematoxylin and dehydrated. The slides were then covered with glass cover slips and photomicrographs were obtained. Immunohistochemical analysis for iNOS protein expression was also performed on the slide tissue microarrays (obtained from US Biomax, Inc., Rockville, MD) of clinical GBM samples according to the manufacturer’s instructions.
Immunocytochemical analysis
U251 and 5310 cells (1 × 104) were seeded on 2-well chamber slides, incubated for 24 h, and transfected with SV-sh, M-sh, U-sh, or MU-sh for 72 hrs. Then, cells were fixed with 10% buffered formalin phosphate and incubated with 1% bovine serum albumin in PBS at room temperature for 1 hr to avoid non-specific staining. After the slides were washed with PBS, anti-iNOS antibody was added at a concentration of 1:100. The slides were incubated overnight at 4°C and washed three times with PBS to remove excess primary antibody. Cells were then incubated with Alexa Fluor® 594 (goat anti-mouse IgG, red) fluorescent-labeled secondary antibody for 1 hr at room temperature. The slides were then washed another three times with PBS, exposed to DAPI containing mounting media, covered with glass coverslips, and fluorescent photomicrographs were obtained.
Reverse transcription PCR analysis
Total cell RNA was isolated from untreated U251 and 5310 glioma cells and from those transfected with M-fl, or U-fl. Approximately 1 μg of total RNA from each sample was synthesized into cDNA following the manufacturer’s instructions using the Transcriptor First Strand cDNA Synthesis Kit obtained from Roche Diagnostics (Indianapolis, IN). We used the following sequences for the forward and reverse primers:
-
for iNOS, 5′cgqiztgtggaagcggtaacaaagga3′ (forward) and 5′tgccattgttggtggagtaa3′ (reverse);
-
for βActin, 5′ggcatcctcaccctgaagta3′ (forward) and 5′ggggtgttgaaggtctcaaa3′ (reverse).
Reverse transcription - polymerase chain reaction (RT-PCR) was set up using the following PCR cycle: 95°C for 5 min, (95°C for 30 sec, 55–60°C for 30 sec, and 72°C for 30 sec) × 35 cycles, and 72°C for 10 min. PCR products were resolved on a 1.6% agarose gel, visualized, and photographed under UV light.
Western blot analysis
U251 and 5310 cells were transfected with SV-sh, M-sh, U-sh, M-fl and U-fl for 72 hrs. Cells were collected and lysed in RIPA buffer [50 mmol/mL Tris–HCl (pH 8.0), 150 mmol/mL NaCl, 1% IGEPAL, 0.5% sodium deoxycholate, 0.1% SDS] containing 1 mM sodium orthovanadate, 0.5 mM PMSF, 10 μg/mL aprotinin, 10 μg/mL leupeptin and resolved via SDS-PAGE. After overnight transfer onto nitrocellulose membranes, blots were blocked with 5% non-fat dry milk in PBS and 0.1% Tween-20. Blots were then incubated with primary antibody, followed by incubation with HRP-conjugated secondary antibody. Immunoreactive bands were visualized using chemiluminescence ECL Western blotting detection reagents on Hyperfilm-MP autoradiography film obtained from Amersham (Piscataway, NJ). GAPDH (housekeeping gene) antibody was used to verify that similar amounts of protein were loaded in all lanes.
FACS analysis
U251 and 5310 cells were seeded on 100-mm tissue culture plates. Cells were transfected with M-fl, transfected with M-fl and blocked with α9β1 antibody, treated with recombinant uPAR or treated with recombinant uPAR and blocked with α9β1 antibody. 48–72 hrs after transfection or 1–2 hrs after recombinant uPAR treatment, cells were treated with 50 mM EDTA, washed with PBS, pelleted at 1000 rpm for 5 min, and re-suspended in PBS in an appendorff tube at a concentration of 1 × 106 cells/mL. Cells were then incubated with HRP-conjugated iNOS antibody for 1 hr on ice, pelleted, and washed three times with PBS to remove excess primary antibody. Cells were then re-suspended in 1 ml of PBS and incubated with Alexa Fluor® 594 (goat anti-mouse IgG, red) fluorescent labeled secondary antibody for 1 hr on ice. After three more washes in PBS, cell pellet was re-suspended in 10% buffered formalin and analyzed on a Coulter EPICS XL AB6064 flow cytometer (Beckman Coulter, Fullerton, CA).
Detection of NO in 5310 glioma cells
DAF-2DA is a non-fluorescent cell permeable reagent that can measure free NO in living cells. Once inside the cell, the diacetate groups of the DAF-2DA reagent are hydrolyzed by cytosolic esterases, thus releasing DAF-2 and sequestering the reagent inside the cell. Production of NO in the cell, if any, converts the non-fluorescent dye, DAF-2, to its fluorescent triazole derivative, DAF-2 T. 5310 glioma xenograft cells cultured in 12-well plates were transfected with MMP-9 or uPAR overexpressing plasmids (M-fl or U-fl, respectively) or MU-sh plasmid shRNA. Seventy two hours after transfection, a few wells containing M-fl or U-fl transfected 5310 cells were treated with L-NAME (1 mM). In order to demonstrate that MMP-9 and uPAR-mediated glioma cell migration utilizes nitric oxide, four hours after treatment with L-NAME, 5310 glioma cells from all the treatment groups including controls were treated with DAF-2DA reagent and the cells were incubated for 60 min at 37°C. To remove the excess dye and stain, the nucleus for quantitative analysis, samples were washed with PBS and resuspended in PBS containing DAPI. Green fluorescence and the respective DAPI images were captured by using a fluorescent microscope.
Densitometry
Densitometry was performed using Image J Software (National Institutes of Health) to quantify the band intensities obtained from Western blot analysis. Data represent average values from three separate experiments.
Statistical analysis
Statistical comparisons were performed using Graph Pad Prism software (version 3.02). Quantitative data from Western blot analysis, wound healing assay, spheroid migration assay and matrigel invasion assays were evaluated for statistical significance using one-way ANOVA. Bonferroni’s post hoc test (multiple comparison tests) was used to compare any statistical significance between groups. Differences in the values were considered significant at p < 0.05.
Acknowledgements
This research was supported by a grant from National Institute of Neurological Disorders and Stroke, NS047699 (PI: Jasti S. Rao). The contents are solely the responsibility of the authors and do not necessarily represent the official views of National Institute of Health. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. We thank Dr. Alarcon, Professor of Pediatrics for providing access to flow cytometer, Noorjehan Ali for technical assistance, Debbie McCollum for manuscript preparation, and Diana Meister for manuscript review.
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
JSR and KK Veeravalli were involved in the conception, hypotheses delineation, and design of the study. TZ conducted wound healing assay, spheroid migration assay, immunocytochemical, immunohistochemical and Western blot analysis. BC performed an assay that detects nitric oxide in cancer cells. SP performed Matrigel invasion assay, tissue array and RT-PCR analysis. CC involved in animal-related experiments. AAR and KK Velpula conducted FACS and Western blot analysis. The above-mentioned authors conducted the required experiments, performed the acquisition of the data or analyzed such information. BC and KK Veeravalli drafted the manuscript. EZ involved in the review of the manuscript prior to its submission. All authors read and approved the final manuscript.