Background
Melanoma is the most aggressive form of skin cancer, with a global incidence of approximately 200,000 new cases per year. Although it represents only 4% of all skin cancers, melanoma is correlated with approximately 80% of skin cancer-related deaths [
1]. Survival rates depend on the clinical stage at the diagnosis, with 5-year survival ranging from 15% to 60% in patients with distant and local metastases [
2].
Approximately 50% of melanomas harbor an active mutation in BRAF, most commonly BRAF
V600E mutation [
3]. RAF kinases are components of the mitogen-activated protein kinase (MAPK) pathway. BRAF
V600E mutation renders the kinase constitutively active and entails enhanced growth and invasion of melanoma cells [
4]. The MAPK pathway is initiated by receptor tyrosine kinases (RTK), cytokine receptors, or G proteins, which activate a class of intracellular protein serine/threonine kinases including RAF [
5], which dimerizes and phosphorylates/activates MEK1/2, which in turn phosphorylates and activates ERK1/2. The MAPK signaling cascade leads to the phosphorylation of c-Jun, resulting in transcriptional activation of cyclin D1 [
6], which triggers melanocyte proliferation and angiogenesis [
7]. Moreover, MAPK can also influence other cellular processes including apoptosis [
8] and cell migration and invasion [
9,
10]. However, the regulatory mechanism of the MAPK signaling pathway itself and the impact of such regulation on melanoma carcinogenesis require further exploration.
JMJD6 was originally identified as a membrane protein and a putative receptor for phosphatidylserine acting in phagocytosis [
11]. Subsequent investigations including studies by our own lab indicate that this jumonji C domain-containing protein also functions in the nucleus where it acts as a histone arginine demethylase or lysyl oxidase to target histones [
12] or non-histone proteins including the tumor suppressor p53 [
13]. Interestingly, a more recent study showed that JMJD6 catalyzes lysyl-5-hydroxylation of the splicing factor U2AF65, leading to the alteration of alternative RNA splicing of a set of the endogenous genes [
14].
Jmjd6 ablation in mice results in early postnatal lethality, growth retardation and multiple developmental abnormalities due to impaired differentiation during embryogenesis [
15‐
17]. These findings support a multifaceted and important role for JMJD6 in cell biology and animal development. Correspondingly, JMJD6 has been implicated in various pathological states including cancers [
13,
18,
19]. However, a functional role of JMJD6 in melanoma remains to be explored.
Alternative splicing is a process by which different combinations of exons can be joined together to produce multiple mRNA isoforms from a single transcript, generating proteins differing in structure, function, and localization [
20]. In humans, >95% of multi-exonic protein-coding genes undergo alternative splicing [
21]. Given that alternative splicing plays a key role in the regulation of gene expression, aberrant splicing has thus been implicated in a wide range of human diseases [
22]. Alterations in alternative splicing are commonly reported in various cancers with involving genes exemplified by p53 and PTEN [
23], BRCA1 [
24], and PRMT2 [
25] in breast cancer, TIMP1 and CD44 in colon cancer [
26], Bcl-xL and CD44 [
27] in lung cancer, and calpain 3 in melanoma [
28]. As a prominent etiological factor, whether or not the MAPK signaling is regulated via alternative splicing in melanoma is currently unknown.
In the current study, we found that JMJD6 is markedly up-regulated in melanoma, and that high expression of JMJD6 is closely correlated with advanced clinicopathologic stage, aggressiveness, and poor prognosis of melanoma. We showed that JMJD6 regulates the alternative splicing of a collection of transcripts including that encoding for PAK1, a key component in the MAPK signaling pathway. We showed that JMJD6 positively regulates the MAPK signaling and promotes the melanogenesis, proliferation, angiogenesis, and invasion of melonama cells. We demonstrated that JMJD6 is transcriptionally activated by c-Jun, generating a feedforward loop to drive the development and progression of melanoma.
Methods
Cell cultures
Human melanoma A375, SK-MEL-1 cell lines and murine melanoma B16F10 cell line were obtained from the American Tissue Culture Collection (ATCC). Human melanoma 451Lu cell line was obtained from the Beijing Cancer Hospital. Cells were cultured in Dulbecco’s Modified Eagle Medium (HyClone) supplemented with 1% penicillin-streptomycin and 10% fetal bovine serum (FBS). HUVECs were cultured in Endothelial Cell Medium (ECM, ScienCell) supplemented with 1% penicillin-streptomycin and 1% endothelial cell growth factors. Cells were incubated at 37 °C in a CO2 incubator with a humidified atmosphere containing 5% CO2.
Transfection
The A375 and 451Lu cells were grown in a 6-well plate to almost 70%-80% confluence, and transfected with 2.5 μg empty vector (pCMV-Tag 2B), FLAG-JMJD6, FLAG-JMJD6H187A/D189A (JMJD6m), FLAG-c-Jun, FLAG-PAK1 or FLAG-PAK1Δ15 plasmids using PEI reagent (Polysciences) according to manufacturer’s instructions. JMJD6m was generated by using QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent). The A375 and 451Lu cells were grown in a 6-well plate to almost 30%-40% confluence, siRNA oligonucleotides were transfected into cells using RNAiMAX (Invitrogen) with the final concentration at 25 nM. The sequences of siRNAs were: siJMJD6#1, 5′-GAGGGAACCAGCAAGACGA-3′; siJMJD6#2, 5′-GUGUGGUGAGGAUAACGAU-3′; siBRAF#1, 5′-CAUGAAGACCUCACAGUAA-3′; siBRAF#2, 5′-UCAGUAAGGUACGGAGUAA-3′; siBRAF#3, 5′-AGACGGGACUCGAGUGAUG-3′; sic-Jun#1, 5′-GAUGGAAACGACCUUCUAU-3′; sic-Jun#2, 5′-CUGAUAAUCCAGUCCAGCA-3′ and siControl, 5′-UUCUCCGAACGUGUCACGU-3′. All of the siRNAs were synthesized by GeneChem Inc. (Shanghai, China).
Retroviral and Lentiviral production and infection
The retroviral plasmid vector, pBABE-JMJD6, pBABE-JMJD6m, pBABE-PAK1, or pBABE-PAK1Δ15, together with pVSV-G and pGag-Pol were co-transfected into the packaging cell line 293T. Viral supernatants were collected 48 h later, clarified by filtration, and concentrated by ultracentrifugation. Lentiviruses carrying control shRNA (shControl), PAK1 shRNA (shPAK1), JMJD6 shRNAs (shJMJD6) and Jmjd6 shRNAs (shJmjd6) were purchased from Genepharma Inc. The virus was used to infect 5 × 105 cells (30%-40% confluent) in a 6-cm dish with 8 μg/ml polybrene. Infected cells were selected by 5 μg/ml puromycin (Merck). The sequences of shRNAs were: shPAK1: 5′-CCGGGGTTTCAAGTGTTTAGTAACTCTCGAGAGTTACTAAACACTTGAAACCTTTTTG-3′, shJMJD6#1: 5′-CCGGGGAAAGGGCAGATGCTTTACACTCGAGTGTAAAGCATCTGCCCTTTCCTTTTTG-3′, shJMJD6#2: 5′-CCGGGGTGGCATGTTGTCCTCAATCCTCGAGGATTGAGGACAACATGCCACCTTTTTG-3′; shJmjd6#1: 5′- CCGGGGAGAGAGCTGATGCCTTACACTCGAGTGTAAGGCATCAGCTCTCTCCTTTTTG -3′; shJmjd6#2: 5′-CCGGGCGTTCTGGAACTGGGATTCACTCGAGTGAATCCCAGTTCCAGAACGCTTTTTG-3′ and shControl: 5′-CCGGGAATCGTCGTATGCAGTGAAACTCGAGTTTCACTGCATACGACGATTCTTTTTG-3′.
Immunohistochemical analysis
Malignant melanoma microarray, containing 128 cases of primary malignant melanoma and 64 metastatic malignant melanoma, was purchased from US Biomax (Catalog number: ME2082b). Antigen retrieval was performed by incubating the samples in 0.01 M sodium citrate buffer at high pressure. Subsequently, the samples were blocked in 10% normal goat serum in PBS and then incubated with primary antibody solution containing anti-JMJD6 (1:100) at 4 °C overnight. After washing with 0.01 M PBS buffer, the samples were incubated with HRP-conjugated goat anti-mouse secondary antibodies for 30 min at 25 °C, developed with DAB (3,3′-diaminobenzidine tetrahydrochloride), and counterstained with hematoxylin. All specimens were examined by two pathologists who were blinded to the clinical data. In case of discrepancies, a final score was established by reassessment on a double-headed microscope. In scoring JMJD6 expression, both the intensity and extent of immunopositivity were considered. Intensity of immunopositivity was scored as follows: 0, negative; 1, weak; 2, moderate; and 3, strong. Extent of immunopositivity was quantified according to the percentage of positively stained tumor cells: 0, <5%; 1, >5%-25%; 2, >25%-50%; 3, >50%-75%; and 4, >75%. The final score was determined by multiplying the intensity scores and the extent scores, which yielded a range from 0 to 12.
Total RNA extraction and RT-PCR analysis
Total RNA was isolated from cells using TRIzol reagent (Invitrogen). First strand cDNA was synthesized using 1 μg of total RNA, with the EasyScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech). Quantification of all gene transcripts was done by qPCR using Power SYBR Green PCR Master Mix (Roche) and an ABI PRISM 7500 sequence detection system (Applied Biosystems). GAPDH was used as the internal control. Primer sequences for human genes are as follows: JMJD6 forward: 5′-AAACTTTTGGAAGACTACAAGGTGC-3′ and reverse: 5′-CCCAGAGGGTCGATGTGAATC-3′; GAPDH forward: 5′-CCCACTCCTCCACCTTTGAC-3′ and reverse: 5′-CATACCAGGAAATGAGCTTGACAA-3′ and MITF forward: 5′-CCACCAAGTACCACATACAG-3′ and reverse: 5′-ACATCATCCATCTGCATACAG-3′. Primer sequences for mouse genes are as follows: Jmjd6 forward: 5′-GGAGATATTACAGAAACCAGGAG-3′ and reverse: 5′-CTCCTGTTTCAAGATCCTATACC-3′; and Gapdh forward: 5′-GACAACTTTGGCATTGTGGA-3′ and reverse: 5′-CATCATACTTGGCAGGTTTCTC-3′. PAK1 forward: 5′-CACCAATGGGACCCCAGAACTT-3′ and reverse: 5′-GCAGTTCTCTTCAATGCTGGACACA-3′ for splice-specific RT-PCR. For quantification of PAK1 and PAK1Δ15 mRNA expressions, TaqMan assays were performed using TaqMan PAK1 probes or PAK1Δ15 probes together with PAK1 specific primers. PAK1 TaqMan probe: 5′-FAM-TGCTACAGGTGAGAAAACTG-MGB-3′, PAK1Δ15 TaqMan probe: 5′-FAM-TGCTGCTACAGCATCAATTC-MGB-3′, PAK1 forward: 5′-GAAAACCCTCTGAGAGCCTTGTACC-3′ and reverse: 5′-ATCAGTGGAGTGAGGCTGGAGA-3′ for TaqMan assays. Each independent experiment was performed at least three times.
RNA-seq analysis
In brief, A375 cells were treated with control siRNA or JMJD6 siRNAs. After transfection for 48 h, total RNA was isolated from the cells. For RNA-seq, mRNA-Seq Sample Prep Kit (Illumina) was used to prepare the complementary DNA (cDNA) libraries according to the manufacturer’s protocol. After selecting cDNA fragments of approximately 200 bp by agarose gel electrophoresis, the DNA fragments were ligated with Illumina paired-end sequencing adapters and performed with PCR amplification. Finally, Illumina HiSeqTM 2000 system was used to perform RNA-seq.
Western blotting analysis
Cells were lysed with RIPA buffer (1% NP40, 50 mM Tris-HCl (pH 7.4), 1 mM EDTA, and 150 mM NaCl) containing a protease inhibitor cocktail. The BCA Protein Assay Kit (Thermo Fisher Scientific) was used to determine the protein concentration. Equal amounts of protein were resolved using 10% SDS-PAGE gels and transferred onto polyvinylidene fluoride (PVDF) membranes (Roche). The PVDF membranes were blocked with 5% skim milk for 1 h at room temperature. Subsequently, PVDF membranes were incubated with the appropriate antibodies overnight at 4 °C. After washed with PBST solution the membranes were incubated with secondary antibodies for 1 h at room temperature. Western blotting luminol reagent (Santa Cruz) was used to visualize the immunoreactive bands according to the manufacturer’s protocol.
RNA Immunoprecipitation (RIP) assay
107 A375 cells were harvested and resuspended in 2 ml PBS, 2 ml nuclear isolation buffer (40 mM Tris-HCl pH 7.5, 4% Triton X-100, 1.28 M sucrose, 20 mM MgCl2), and 6 ml water on ice for 30 min with frequent mixing. Nuclei were pelleted by centrifugation at 3000 g for 10 min. Nuclear pellet was resuspended in 1 ml RIP buffer (150 mM KCl, 25 mM Tris pH 7.4, 9 μg/ml leupeptin, 5 mM EDTA, 9 μg/ml pepstatin, 10 μg/ml chymostatin, 0.5% NP40, 3 μg/ml aprotinin, 1 mM PMSF, 0.5 mM DTT, 100 U/ml RNase inhibitor). Resuspended nuclei were mechanically sheared using a dounce homogenizer with 20 strokes. Nuclear membrane and debris were pelleted by centrifugation at 13000 g for 10 min. The supernatant was split into three fractions for IP (JMJD6 or IgG) and input. 5 μg anti-JMJD6 antibody (mouse monoclonal, sc-28348; Santa Cruz) or 5 μg anti-mouse IgG (sc-2025; Santa Cruz) was added to IP fractions, and was incubated for 2 h at 4 °C with gentle rotation. 40 μl protein G beads were added and incubated for 1 h at 4 °C with gentle rotation. Beads were pelleted at 2000 g for 1 min, the supernatant was removed, and beads were washed with RIP buffer three times, followed by one wash in PBS. Beads were resuspended in 1 ml of TRIzol, and bound RNA was then detected by qRT-PCR. The primers were the following: PAK1#1 forward: 5′-AAATAACACCACTCCACCAG-3′ and reverse: 5′-AAGCCTACGACCAGCAAATC-3′; and PAK1#2 forward: 5′-ATTGGACAAGGGTTAGTAGG-3′ and reverse: 5′-GTAATTTGGGAAGTTGGTTT-3′.
Measurement of melanin content
B16F10 cells were infected with viruses and subsequently were treated with α-MSH (100 nM) for 18-24 h. The cells were washed with PBS solution and dissolved in 1 M NaOH containing 10% DMSO for 1 h at 90 °C. The melanin content was measured at 475 nm using VARIOSKAN FLASH (Thermo Fisher Scientific). To accurately measure the melanin content in each sample, the melanin measurement was normalized to the protein concentration. Each independent experiment was performed at least three times.
Colony formation assay was used to determine the function of JMJD6 in cell proliferation. In brief, A375 cells were infected with viruses carrying JMJD6 shRNA, and/or PAK1, PAK1Δ15, JMJD6, or JMJD6m. Then, 5 × 103 cells were seeded onto 6-well culture plates. After incubation for 14 days, cells were washed three times with cold phosphate-buffered saline (PBS) solution and fixed with 4% paraformaldehyde. Finally, the colonies were stained with 0.5% crystal violet solution. Colonies were counted using a light microscope. Each independent experiment was performed at least three times.
Cell proliferation analysis
The cell viability rate of A375 was evaluated using Cell Counting Kit-8 (CCK-8 Kit, Beyotime Institute of Biotechnology). A375 cells were infected, and a total of 2500 cells were seeded onto 96-well plates with 200 μl of DMEM. Every 12 h, the cells were treated with 20 μl of CCK-8 solution and incubated for another 30 min. The absorbance of each well was measured at 450 nm using VARIOSKAN FLASH (Thermo Fisher Scientific). The blank controls contained 20 μl of CCK-8 solution in 200 μl of DMEM. The blank absorbance was subtracted, and the cell proliferation curve was drawn. Each independent experiment was performed at least three times.
Transwell assay
In vitro invasion assay was performed using Transwell migration chambers (8 μm pore size, BD Biosciences). The filters were coated with 100 μl Matrigel (BD Biosciences) and incubated in a 5% CO2 atmosphere at 37 °C for 30 min for gelling. The bottom chambers were filled with 500 μl DMEM medium containing 10% FBS. A total of 2 × 104 cells were resuspended in 100 μl DMEM serum-free medium and seeded in the upper chamber, and then incubated at 37 °C with 5% CO2 atmosphere for 12 h. Cells were then fixed with 4% paraformaldehyde and stained with 0.5% crystal violet for 20 min. The top surface of the membrane was gently scrubbed with a pipette tip or cotton tipped applicator, the cells that had migrated to the lower side were counted under the microscope and the numbers of migrated cells were calculated as the mean ± standard deviation (SD) in 10 different fields of view. Each independent experiment was performed at least three times.
Bioluminescence imaging
For bioluminescence imaging, each mouse was first anesthetized and then given 150 μg/g of D-luciferin in PBS by intraperitoneal injection. After 20 min, bioluminescence images were obtained with a charge-coupled device camera (IVIS; Xenogen). Bioluminescence was calculated manually from the relative optical intensity, and the data were expressed as photon flux (photons·sec−1·cm−2·Steradian−1) and normalized to background photon flux, which was defined as the relative optical intensity of a mouse that was not injected with luciferin.
Subcutaneous tumor growth model and pulmonary metastasis model
B16F10 cells that were infected with lentiviruses carrying control shRNA or Jmjd6 shRNAs were collected and washed three times with cold PBS solution. Cellular viability was assessed by staining the cells in 0.4% trypan blue followed by hemocytometer quantification according to the manufacturer’s protocol and was standardized at a minimum of 95% viability for subsequent experiments. For subcutaneous tumor growth analysis, 3 × 105 live cells were injected subcutaneously on the right flank of C57BL/6 mice (n = 6). The tumor volume was measured every 2 days and calculated by the following formula: tumor volume = width2 × length × π/6. For pulmonary metastasis analysis, 5 × 105 live cells were intravenously injected into C57BL/6 mice (n = 6) via the tail vein. All mice were euthanized, and the tumors were removed.
Angiogenesis was detected in vitro using HUVECs and Basement Membrane Matrix (BD Biosciences). A total of 200 μl of Basement Membrane Matrix was coated on each well of the 24-well cell culture plates, and the Basement Membrane Matrix was polymerized at 37 °C for at least 1 h. HUVECs (5 × 104 cells/well) infected with viruses carrying JMJD6 shRNA, or PAK1 shRNA, and/or PAK1, PAK1Δ15, JMJD6m, or cultured with CM from A375 cells that were infected with viruses carrying corresponding plasmids were added onto the solidified extracellular matrix gel in 700 μl of ECM, and were treated with or without 20 ng/ml VEGF (Abcam). After 6-18 h of incubation, the number of endothelial cell tubes was quantified under a light microscope. Each independent experiment was performed at least three times.
Chicken yolk sac membrane (YSM) assay
Fertilized eggs were incubated at 38 °C and cracked on day 3. On day 8, gelatin sponges were cut to a size of 1 mm3 and placed on top of the YSM under sterile conditions. The gelatin sponges were presoaked in A375 cell suspensions (approximately 3 × 105 cells/sponge) that were infected with viruses carrying JMJD6 shRNA, and/or PAK1, PAK1Δ15, JMJD6, or JMJD6m. On day 12, the vessels of the YSM were detected and counted under a light microscope. Each independent experiment was performed at least three times.
Matrigel plug assay
The Matrigel plug analysis was performed as previously described [
29]. Briefly, 200 μl of matrigel only (BD Biosciences) or matrigel that was mixed with A375 cells (2 × 10
5 cells) that were infected with lentiviruses carrying control shRNA or JMJD6 shRNA were subcutaneously injected into the left flank of 6-week-old BALB/c female mice (
n = 6). Seven days after injection, all mice were sacrificed and the Matrigel plugs were retrieved; then, the Matrigel plugs were fixed with 4% paraformaldehyde and stained with Masson’s trichrome and H&E. Each independent experiment was performed at least three times.
Luciferase reporter analysis
The promoter region (−1057 to +100) of JMJD6 was cloned into pGL3 plasmid. The QuikChange Lightning Site-Directed Mutagenesis kit (Agilent Technologies, USA) was used to mutate the promoter region of JMJD6. A375 cells were transfected with JMJD6-Luc or Mut-JMJD6-Luc, together with c-Jun and renilla. 24 h after transfection, the luciferase activity of the cells was detected using a luciferase assay kit (Promega). Each independent experiment was performed at least three times.
ChIP and qChIP analysis
ChIP assays were performed in A375 cells. The enrichment of the DNA template was analyzed by conventional PCR using the following primers: forward: 5′-CAAGAAGGGGAAAGCCCAGAT-3′ and reverse: 5′-TGTTGGGAAGGTCACGTCG-3′, which were specific for the JMJD6 gene promoter. qChIP analysis was performed using the TransStart Top Green qPCR supermix (TransGen Biotech). The qChIP primers were the following: JMJD6#1 forward: 5′-CTACAGGCACAAGCCACGAT-3′ and reverse: 5′-GGGACCAGGAGTTCCAGACC-3′; and JMJD6#2 forward: 5′-CGCGCAGAACTGGCAAC-3′ and reverse: 5′-TACTCCTTCACATACGGCGG-3′. Each independent experiment was performed at least three times.
Statistical analyses
All data were analyzed using SPSS 18.0. All data were shown as the mean ± SD, unless declared, and each independent experiment was performed at least three times. Paired-sample t tests based on a bi-directional hypothesis for continuous variables were used to assess the comparisons between adjacent normal tissue and cancer tissue. The various clinicopathological characteristics of JMJD6 expression were examined by the chi-square test in 88 melanoma specimens of melanoma microarray for whom the complete information on age, sex, pathological characteristics and TNM staging is available. The relationship between JMJD6 expression and the clinical staging was assessed by two-tailed unpaired t test in these 88 cases. *p < 0.05 was considered statistically significant.
Discussion
The understanding of the cellular activity and biological function of the jumonji C domain-containing protein JMJD6 continues to evolve. This protein was initially reported as a cell surface protein that enhances the recruitment of phagocytic cells to sites of apoptosis. Subsequent studies describe JMJD6 as either a histone arginine demethylase that removes methyl moieties from histone molecules [
12] or a lysine hydroxylase to target histone or non-histone proteins [
14]. Specifically, we showed previously that JMJD6 acts as a lysyl hydroxylase to modulate p53 activity [
13], and, recently, JMJD6 has been shown to hydroxylate RNA splicing factor U2AF65 and influence alternative splicing [
14].
JMJD6 null mice manifest early postnatal lethality, growth retardation, and multiple developmental abnormalities due to impaired differentiation during embryogenesis [
15‐
17]. Clearly, JMJD6 exerts a multifaceted and important role in cell biology and animal development. Consistently, JMJD6 has been implicated in various pathological states including cancers [
13,
18,
19]. We report in the current study that JMJD6 is up-regulated in a variety of cancers, including melanoma, thyroid cancer, ovarian cancer, breast cancer, prostate cancer, lung adenocarcinomas, liver cancer, and colorectal cancer. We found that the protein level of JMJD6 was significantly higher in melanomas than in normal tissues, and that high expression of JMJD6 was positively correlated with the clinicopathological stage, aggressiveness, and poor prognosis of melanoma.
To understand the mechanistic role of JMJD6 in melanoma carcinogenesis, we performed RNA-seq in melanoma cells and found that the alternative splicing of a panel of genes including that encoding for PAK1, a key component of the MAPK signaling pathway, is regulated by JMJD6. PAK1 acts to phosphorylate RAF and MEK [
32‐
34], thereby positively regulating the MAPK signaling pathway. We showed that JMJD6 promotes the production of the full-length PAK1 and inhibits the generation of PAK1Δ15
. Significantly, our experiments indicate that PAK1Δ15 represents a catalytically inactive isoform of PAK1 unable to phosphorylate RAF and MEK and to activate the MAPK signaling.
The MAPK signaling pathway is known to be critically implicated in the molecular pathogenesis of melanoma. Consistent with this, it has been reported that approximately 50% of melanomas carry an active mutation in
BRAF, which renders the MAPK signaling pathway constitutively active [
4]. Upon activation of the cascade, phosphorylation of the downstream effector kinases (ERK1/2) leads to transcriptional activation of cyclin D1, degradation of CDK inhibitor p27, and activation of p90 ribosomal S6 kinase (p90RSK), which in turn inactivates the cell cycle-inhibitory protein myelin transcription factor 1 (MYT1) [
47,
48]. It is now abundantly clear that the MAPK signaling pathway represents a main cellular system controlling cell cycle progression and cell proliferation [
47]. Thus, the regulation of PAK1 alternative splicing by JMJD6 is of significant importance to the MAPK signaling and cell proliferation. Indeed, we showed that ectopic expression of JMJD6 promoted the proliferation of melanoma cells, an effect that was dependent on the lysyl hydroxylase activity of JMJD6 and was through the regulation of the alternative splicing of PAK1.
In addition to cell proliferation, the MAPK pathway has also been implicated in the regulation of an array of cellular processes such as EMT, angiogenesis, and melanogenesis in melanoma. It is even reported that BRAF
V600E is a catalyst for EMT in thyroid carcinoma and melanoma [
49]. Meanwhile, a recent study reported that JMJD6 promotes EMT in breast cancer [
50]. In the current study, we demonstrated that JMJD6 promotes EMT and metastasis in melanoma, and we showed that JMJD6 does so, through its lysyl hydroxylase activity and via its regulation of the alternative splicing of PAK1. Our results provide a functional link between JMJD6 and the MAPK signaling pathway in the regulation of EMT and metastasis of melanoma. In support of the regulation of PAK1 thus the MAPK signaling by JMJD6, our experiments also revealed that JMJD6 regulates melanogenesis and angiogenesis in melanoma cells.
In the MAPK signaling cascade, activation of ERK1/2 leads to phosphorylation and activation of transcription factor c-Jun. Remarkably, we found in the current study that JMJD6 is transactivated by c-Jun. In light of our findings that JMJD6 is up-regulated in melanoma and the MAPK signaling is modulated by JMJD6 via regulation of the alternative splicing of PAK1 and the reported observation that a large proportion of melanoma carry BRAF
V600E mutation rendering the MAPK signaling constitutive active [
4], there appears existing a feedforward regulatory loop between JMJD6 and the MAPK signaling pathway in which genetic mutation of BRAF results in hyperactive MAPK signaling, which, in turn, leads to the activation of c-Jun. Activated c-Jun transactivates JMJD6, which, in turn, through regulation of the alternative splicing of PAK1, enhances the MAPK signaling (Fig.
6f). Such a self-enhancing molecular system will surely favor the development and progression of melanoma.