Background
Approximately 5% of the world’s population carries globin gene mutations, of which 1.7% exhibit symptoms of α-thalassaemia [
1‐
3]. α-thalassaemia is one of the world’s most common hemoglobin disorders associated with deletion or point mutations in α-globin genes clusters. The cluster responsible for this disease is about 30 kb in size and located on the end of chromosome 16p13.3 in the order of 5’-ζ-ψζ-ψα1-α2-αl-θ-3’. Southeast Asian deletion (--
SEA), right deletion (-α
3.7) and left deletion (-α
4.2) are the top three deletions found responsible for α-thalassaemia, whereas Hb ConstantSpring (HBA2:C.427T>C), Hb QuongSze (HBA2:c.377T>C) and Hb Westmead (HBA2:c.369C>G) are the predominant non-deletion types discovered to date. The --
SEA, -α
3.7, -α
4.2, Hb CS and Hb QS account for about 90% of mutations in Chinese populations [
4]. In addition, rare deletions including --
JS, --
11.1, --
FIL, --
THAI, -α
27.6, -α
21.9, -α
2.4, -α
3.8 and -α
2.8 have been reported as being associated with α-thalassaemia [
5‐
16]. Gap-PCR is used to diagnose α-thalassaemia associated with these rare mutations. Multiple ligation-dependent probe amplification (MLPA) or next generation sequencing (NGS) technologies can be employed to characterize unknown mutations at the molecular level.
In this study, we investigated a Chinese family carrying α-thalassaemia and examined the molecular causes underlying the family’s phenotype. An associated novel pathogenic deletion was discovered and characterized for the first time. The proband showed a decrease of MCV and MCH levels and abnormal increase of HbH and HbBart’s levels. Thus we assume it can be an HbH disease. Finally, our results showed a novel deletional α-thalassemia range (NG-000006.1:g.29785-36746 del 6962bp) which covered all α2 gene but not α1 gene. The novel deletion of α-thalassemia also compound with --SEA deletion type, thus the genotype of the proband can described as -α6.9/--SEA.
Methods
Patients
The proband, a 36 year old male of Han nationality, and his family, were recruited for this study. The couple screened positive for α-thalassaemia. Peripheral blood samples from the couple and their son were collected and stored for further investigation.
Hematological analysis
A routine blood analysis was performed using an automated cell counter (Sysmex XS-1000i; Sysmex Co., Ltd., Kobe, Japan). The subjects’ levels of Hb A, Hb A2 and Hb F were detected with hemoglobin capillary electrophoresis (Sebia, Evry Cedex, France).
Molecular analysis
The family members’ genomic DNA was obtained at Ruibao Biological Co., Ltd. using an automatic nucleic acid extractor. The gene deletion mutation analysis of α-thalassaemia (-α
3.7, -α
4.2, --
SEA) was performed using gap-PCR [
17‐
19]. The PCR reverse dot hybridization technique (PCR-RDB) was used to diagnose the non-deletion α-thalassaemia (Hb CS, Hb QS and Hb Westmead), and 17 common mutations were found and associated with β-thalassaemia, [
20‐
22] including CD41–42 (−TCTT), IVS-II-654 (C>T), –28 (A > G), CD 71/72 (+A), CD 17 (AAG > TAG), CD 26 (GAG>AAG), CD43 (GAG>TAG), –29(A > G), CD31 (−C), –32 (C > A), IVS-I-1 (G > T), CD 27/28 (+C), –30(T > C), CD 14/15 (+G), Cap+ 40–43 (−AAAC), initiation codon (ATG > AGG) and IVS-I-5 (G > C). Six α-thalassaemia genotype-screening kits (Yaneng Biological technology Co., Ltd., Shenzhen) were utilized to detect --
THAI, -α
27.6, HKαα, fusion gene, ααα
anti4.2 and ααα
anti3.7. In order to detect unknown variants, a multiplex ligation-dependent probe amplification (MLPA) assay was employed using the SALSA MLPA probemix P140-C1HBA (MRC-Holland, Amsterdam, Netherlands).
DNA sequencing and analysis
Gap-PCR was used to identify the deletion breakpoints. According to the known DNA sequences around the breakpoints, specific primers were designed. These primer sequences were P1: GGAGAACTTGGCCCCACGTTATCTA and P2: GGCGCTGTCGGCTCGTGCA. All primers were synthesized at Invitrogen (Shanghai, China). Gap-PCR reaction system: 2 mmol dNTP 2 μL, 5 × buffer 4 μL, 25 mmol MgCl2 2 μL, Taq enzyme 1 U, 10 μmol primers 0.5 μL each, template 2 μL, and plus ultra-pure water to 20 μL. Amplification conditions: 96 °C for 5 min; 98 °C for 30 s, 60 °C for 1 min, 72 °C for 2 min, 35 cycles; and 72 °C for 10 min. Electrophoresis analysis was performed and the purified electrophoresis products then sent for Sanger sequencing. The sequenced data were analyzed with GenBank NG_000006.1 as their reference sequences.
Discussion
α-thalassaemia is an inherited disorder caused with deletion or mutation events occurring on the α-globin chain. Based on different known combinations of these mutations, α-thalassaemia can be classified into four types, as follows: the silent carrier state (heterozygous to the α
+ defect), α-thalassaemia minor (homozygous to the α
+ or α
0 defects), Hemoglobin H disease (HbH, compound heterozygous to the α
0 and α
+ defects) and Barts hydrops fetalis (homozygous to the α
0 defect) [
24,
25]. HbH disease usually produces less than 30% of the normal amount of α-globin due to a deletion of three genes (--/-α) [
26‐
28]. The predominant features in HbH disease are anemia with variable amounts of HbH (0.8-40%), and occasionally accompanied by Hb Bart's syndrome in the peripheral blood [
29].
The --
SEA, -α
3.7, -α
4.2, Hb CS and Hb QS account for about 90% of the α-thalassaemia mutations in the Chinese population. In southern China, --
SEA was the most common α
0 mutation, while -α
3.7 and -α
4.2 were the most common α
+ mutation. The combination of the –
SEA deletion and these two α
+ deletions led to the most common types of HbH disease associated with deletions [
30,
31]. Most of the patients with -α
3.7/--
SEA and -α
4.2/--
SEA HbH disease developed mild and moderate anemia, and a few had no clinical symptoms [
31]. In this study, we investigated a proband from a Chinese family who demonstrated mild anemia and a slight decrease in Hb, which is similar to the phenotypes of patients with -α
3.7/--
SEA and -α
4.2/--
SEA HbH disease [
32]. Using a routine genotyping method developed based on known mutations or deletions, the genotypes of the family members were identified as (--
SEA/--
SEA, β
N/β
N) for the proband, (--
SEA/αα, β
N/β
N) for his son and (αα/αα, β
N/β
N) for his wife, implying that the son is a minor carrier of --
SEA and the proband should be a severe Hydrops Fetalis patient. However, Hemoglobin Barts hydrops fetalis syndrome is generally a fatal clinical phenotype of α-thalassaemia observed in fetuses rather than adults. The inconsistency between the observed genotype and reported clinical phenotypes led us to deduce that an unknown or rare mutation may exist in this patient, whose mutations might be overlooked in routine genetic testing for known mutations of α-thalassaemia. By employing a combination of MLPA and gap-PCR analyses using custom primers, we located a previously unreported, novel 6.9 kb deletion (del16p13.3 g.29,785-36,746) on the patient’s α-globin chains. We named this deletion -α
6.9, and we believe this is what led in combination with --
SEA to the development of HbH disease.
It is significantly important to recognize the pathogenic α-globin gene mutations associated with α-thalassaemia in thalassaemia disease diagnosis and management. The α-globin chains are encoded with two functional alpha genes (Alpha 1 and 2) located on the α-globin gene cluster [
24]. This 6.9 kb deletion fragment in -α
6.9/--
SEA overlaps with the deletions detected in -α
3.7/--
SEA and -α
4.2/--
SEA HbH patients, which could explain the observation that α
6.9/--
SEA, -α
3.7/--
SEA and -α
4.2/--
SEA HbH have similar phenotypes. Except for the different deletion sizes of -α
6.9, -α
3.7 and -α
4.2, they all cover a single Alpha 2 gene, resulting in a decreased dosage of α-globin. Pathogenic mutations associated with one (α
+ defects) or both (α
0 defects) alpha genes (in
cis) at the α-globin gene cluster can lead to malfunctions in alpha globin synthesis and metabolism.
Further to the discovery in our study of a novel pathogenic hotspot deletion associated with α-thalassaemia, it is important to realize that routine screening can lead to the omission of rare or novel pathogenic sites. To avoid false-negative results in thalassaemia diagnosis, hematological analysis and genetic testing should be applied strategically. When the results of routine genetic testing are inconsistent with the haematological analysis, detailed genetic testing should be carried out to determine the molecular causes for phenotypes. Our research has highlighted the importance of combining different technologies in achieving accurate diagnoses. Recently, next generation sequencing (NGS) technology has also provided a new strategy for genetic diseases screening, including that for thalassaemia. The application of next-generation sequencing to thalassaemia screening not only significantly reduces the possibility for obtaining false-negative results and misdiagnoses, but also eliminates the need for repeat blood sampling and further referral tests. NGS can be a potentially widespread screening method, especially among populations with a high prevalence of thalassaemia [
30]; our group is further investigating this possibility.
Conclusions
We identified a large, novel 6.9 kb deletion, covering α2 but not α1 and causing α-thalassemia. With a series validation and analysis, a new genotype, -α6.9/--SEA, of HbH disease is proposed. Our study expands upon the spectrum of pathogenic mutations associated with α-thalassaemia, thus improving clinical practice in the diagnosis and disease management of thalassaemia.