Skip to main content
Erschienen in: BMC Infectious Diseases 1/2012

Open Access 01.12.2012 | Research article

Pandemic influenza A/H1N1 virus infection and TNF, LTA, IL1B, IL6, IL8, and CCLpolymorphisms in Mexican population: a case–control study

verfasst von: Guadalupe Morales-García, Ramcés Falfán-Valencia, Román Alejandro García-Ramírez, Ángel Camarena, Alejandra Ramirez-Venegas, Manuel Castillejos-López, Martha Pérez-Rodríguez, César González-Bonilla, Concepción Grajales-Muñíz, Víctor Borja-Aburto, Juan Manuel Mejía-Aranguré

Erschienen in: BMC Infectious Diseases | Ausgabe 1/2012

Abstract

Background

Some patients have a greater response to viral infection than do others having a similar level of viral replication. Hypercytokinemia is the principal immunopathological mechanism that contributes to a severer clinical course in cases of influenza A/H1N1. The benefit produced, or damage caused, by these cytokines in severe disease is not known. The genes that code for these molecules are polymorphic and certain alleles have been associated with susceptibility to various diseases. The objective of the present study was to determine whether there was an association between polymorphisms of TNF, LTA, IL1B, IL6, IL8, and CCL1 and the infection and severity of the illness caused by the pandemic A/H1N1 in Mexico in 2009.

Methods

Case–control study. The cases were patients confirmed with real time PCR with infection by the A/H1N1 pandemic virus. The controls were patients with infection like to influenza and non-familial healthy contacts of the patients with influenza. Medical history and outcome of the disease was registered. The DNA samples were genotyped for polymorphisms TNF rs361525, rs1800629, and rs1800750; LTA rs909253; IL1B rs16944; IL6 rs1818879; IL8 rs4073; and CCL1 rs2282691. Odds ratio (OR) and the 95% confidence interval (95% CI) were calculated. The logistic regression model was adjusted by age and severity of the illness in cases.

Results

Infection with the pandemic A/H1N1 virus was associated with the following genotypes: TNF rs361525 AA, OR = 27.00; 95% CI = 3.07–1248.77); LTA rs909253 AG (OR = 4.33, 95% CI = 1.82–10.32); TNF rs1800750 AA (OR = 4.33, 95% CI = 1.48–12.64); additionally, LTA rs909253 AG showed a limited statistically significant association with mortality (p = 0.06, OR = 3.13). Carriers of the TNF rs1800629 GA genotype were associated with high levels of blood urea nitrogen (p = 0.05); those of the TNF rs1800750 AA genotype, with high levels of creatine phosphokinase (p=0.05). The IL1B rs16944 AA genotype was associated with an elevated number of leukocytes (p <0.001) and the IL8 rs4073 AA genotype, with a higher value for PaO2 mm Hg.

Conclusion

The polymorphisms of genes involved in the inflammatory process contributed to the severity of the clinical behavior of infection by the pandemic influenza A/H1N1 virus.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1471-2334-12-299) contains supplementary material, which is available to authorized users.
Guadalupe Morales-García, Román Alejandro García-Ramírez contributed equally to this work.

Competing interests

The authors declare that they have no conflict of interests.

Authors’ contributions

GMG, RFV, RAGR, AC, and MCL carried out the study and participated in its design and co-ordination, in the molecular assays, and in the preparation of the manuscript. ARV participated in the design and co-ordination of the study, compiled data, and helped prepare the manuscript. MPR, CGB, CGM, VBA, and JMMA participated in the design and co-ordination of the study, carried out the study and the statistical analysis, and helped prepare the manuscript. All authors read and approved the final version of the manuscript.
Abkürzungen
AHC
Asymptomatic healthy contacts
ARDS
Acute respiratory distress syndrome
BMI
Body mass index
BUN
Blood urea nitrogen
CCL1
Chemokine (C-C motif) ligand 1
CDC
U.S: Centers for Disease Control and Prevention
CI
95% Confidence interval
CPK
Creatine phosphokinase
CRP
C- reactive protein
GLR
Global lethal rate
ICU
Intensive Care Unit
IFN
Interferon
IL
Interleukin
ILI
Influenza-like illness
LDH
Lactate dehydrogenase
LTA
Lymphotoxin α
OR
Odds ratio
PaO2
Partial pressure of oxygen in arterial blood
SNP
Single nucleotide polymorphism
TNF
Tumor necrosis factor
WHO
World Health Organization.

Background

The influenza A/H1N1 virus pandemic of 2009 started in Mexico and then spread worldwide, with an alert level of pandemic phase 6 declared by the World Health Organization (WHO) in June of that year [1]. Although the majority of those infected by the influenza A/H1N1 virus presented mild symptoms that were self-limiting, a subgroup of patients followed an adverse clinical course, thus requiring a greater level of medical attention and more aggressive management [2]. In Mexico the lethal rate was estimated to be 1.2% for cases of influenza-like illness (ILI) and 5% for confirmed cases of influenza A/H1N1 [3]. Some co-morbidities (e.g., immunosuppression, pre-existing pulmonary disease, cardiac disease, diabetes, asthma that requires regular medical attention, smoking, and obesity) have been demonstrated to increase the risk of hospitalization for infection with influenza A/H1N1 [4, 5]. The risk is also augmented in the second and third trimesters of pregnancy and when treatment with oseltamivir is prescribed five days after the onset of the illness [6]. In addition, the results of certain laboratory tests (e.g., lactate dehydrogenase (LDH), >600 IU/L; hypoxemia (PaO2, <60 mm Hg); C-reactive protein (CRP), 10 mg/dl; and leukopenia <5000/mm3) have been associated with greater mortality from infection by influenza A/H1N1 virus [7, 8].
Through experimental and clinical studies, it has been determined that the most important pathological mechanism in this infection is systemic dysregulation of the inflammatory response, which is correlated with the severity and progression of the illness [9, 10]. The secretion of cytokines by infected cells appears to be necessary for the initiation of the immunological response that controls the replication of the virus [11]; in addition, the presence of immunopathological mechanisms, such as hypercytokinemia (“cytokine storm”), generally is considered to contribute to the severest evolution of the infection [1113]. Elevated levels of pro-inflammatory cytokines and chemokines (e.g., TNFα, IFNγ, IL-1, IL-6, IL-8, IL-9, IL-12 IL-15, and IL-17) have been found, up to ten days after the onset of symptoms, in the plasma of patients with acute respiratory distress syndrome (ARDS) caused by influenza A/H1N1 [9, 10, 14]. The genes that code for these molecules are polymorphic and certain alleles have been associated with susceptibility to various diseases that cover a wide range of pathologies, from infectious to oncological, including pulmonary and systemic diseases [1530]. The role that the polymorphisms of the genes encoding these cytokines play in the severity of the disease is not clear.
The extensive polymorphism of these molecules may be associated with the high mortality rate during the 2009 influenza A/H1N1 pandemic in Mexico. Because we think that genetic factors of the host may influence the nature and intensity of the inflammatory immune response, the objective of this study was to determine whether the polymorphisms of genes that are associated with inflammation may be associated with the development of the infection and with the clinical severity in Mexican mestizo patients with influenza A/H1N1.

Methods

The rapid QuickVue Influenza A+B test (Quidel, San Diego, CA, USA) was used to analyze the nasopharyngeal swab samples obtained from the patients in 94 cases of suspected infection by influenza A/H1N1, following the recommendations for collection and testing of the U.S. Centers for Disease Control and Prevention (CDC) and of the WHO [31, 32]. The patients were then separated into two groups: those positive for influenza A/H1N1 (A/H1N1 group) and those negative, as having influenza-like illness (ILI group). A total of 44 patients were positive for the influenza A/H1N1 virus (A/H1N1 group); the remaining 50 patients who had tested negative for the influenza A/H1N1 virus, were diagnosed as having influenza-like illness (ILI).
In addition, a group of 176 asymptomatic healthy contacts (AHC group) voluntarily participated in the study. Those in the AHC group, although not biologically related to any patient, were in personal contact with at least one of the patients during the period of the illness. To ensure that those in the AHC group had been exposed to the virus, their titers of anti-influenza A/H1N1 antibodies were determined. To evaluate the presence of antibody, we use haemagglutination inhibition technique (HAI); contacts exhibited significant titers of specific anti-A/H1N1 antibodies, supporting the fact that they were in contact with the A/H1N1 virus. By serially diluted aliquots of serum samples; those individuals with titers greater than 1:16 were considered positive for A/H1N1 infection/exposure. The two patient groups and the AHC group were Mexican mestizos (age range: 18–85 years). All patients suspected of influenza A/H1N1 infection were treated with anti-viral therapy (oseltamivir) upon admittance at the hospital.
The information collected in this study included demographic, clinical history, laboratory test data, pharmacological treatment, and follow-up. This study was approved by the Institutional Committee of Science and Bioethics of the National Institute of Respiratory Diseases (code B05-10). The study protocol was explained to all participants and signed informed consent was duly obtained from each participant. This information was obtained by means of a clinical form in accord with Official Mexican Standards Mexicana NOM-168-SSA1-1998; topics covered included age; gender; tobacco smoking; body-mass index (BMI; patients with BMI >30 k/m2); and disease morbidity (pulmonary, hepatic, renal, cardiac, neurological diseases, diabetes mellitus, hypertension, and cancer). The symptoms evaluated were fever, cough, rhinorrhea, dyspnea, nasal congestion, thoracic pain, headache, diarrhea, and vomiting. The begin of anti-viral therapy was evaluated in relation to the days with previous symptomatology. The laboratory parameters included were leukocyte titer; lactate dehydrogenase (LDH); creatine phosphokinase (CPK); blood urea nitrogen (BUN); and arterial gases (with PaO2 <60 mm Hg defined as severe disease). Pneumonia was verified by radiological findings. All patients admitted to the intensive care unit (ICU) and those put on assisted mechanical ventilation (AMV) were identified.

Genotyping of allelic variants (single nucleotide polymorphism, SNPs)

The DNA samples were genotyped for polymorphisms TNF rs361525, rs1800629, and rs1800750; LTA rs909253; IL1B rs16944; IL6 rs1818879; IL8 rs4073; and CCL1 rs2282691 using Taqman commercial probes (Apliedd Biosystems, USA) the primers listed in Table 1. In brief, the procedure for the real time PCR was the following: 15 ng DNA; 15 μL of Taqman universal PCR master mix (Roche NJ, USA) and 6.5 μL of each probes. The conditions for amplification were the following: 94°C (3 min), 61°C (1 min), and 72°C (1 min); followed by 35 cycles of 94°C (1 min), 61°C (1 min), and 72°C (1 min,); and a final cycle of 94°C (1 min), 61°C (1 min), and 72°C (5 min). The genetic data for the SNPs were analyzed and are listed in Table 2.
Table 1
DNA samples were genotyped by using Taqman commercial probes
Gene (reference SNP)
Probe
TNF (rs1800750)
GAGGCAATAAGACCCCCCTCGGAATC[A/G]GAGCAGCTGTCAATTGCAGGAGCT
TNF (rs1800629)
GAGGCAATAGGTTTTGAGGGGCATG[A/G]GGACGGGGTTCAGCCTCCAGGGTCC
TNF (rs361525)
GGCCCAGAAGACCCCCCTCGGAATC[A/G]GAGCAGGGAGGATGGGGAGTGTGA
LTA (rs909253)
AAGCCTTAAAACCTAGGGCATACA[C/T]TTGATAATTCACCCTCCAGGGTCCGTT
IL1B (rs16944)
TACCTTGGGTGCTGTTCTCTGCCTC[G/A]GGAGCTCTCTGTCAATTGCAGGAGC
IL6 (rs1818879)
AGACGAGCTGGGCGCAGTGGCTCAC[A/G]CCTATAATCCCAGCACTTTGGGAGG
IL8 (rs4073)
TTATCTAGAAATAAAAAAGCATACA[A/T]TTGATAATTCACCAAATTGTGGAGC
CCL1 (rs2282691)
AAAAAGCCTTAAAATACTGACTGGT[A/T]TGTGAAAGCTACTCCAATTAAGTTT
SNP Single nucleotide polymorphisms.
Table 2
Genetic data of the single nucleotide polymorphisms (SNPs) analyzed
SNP
Gene
 
Symbol
Location
Position
Alleles
rs1800750
TNF
−376
Promoter
G/A
rs1800629
−308
Promoter
G/A
rs361525
−238
Promoter
G/A
rs909253
LTA
+252
Intronic
C/T
rs16944
IL1B
−511
Promoter
G/A
rs1818879
IL6
5845
3UTR
A/G
rs4073
IL8
−251
Promoter
A/T
rs2282691
CCL1
29712422
Intronic
A/T

Analysis

When the polymorphisms were evaluated, the ancestral genotype was used for comparison. The odds ratio (OR) and the 95% confidence interval (95% CI) were calculated. In the logistic regression model, the OR was adjusted by age and severity of the illness. The χ2 test was used to evaluate the differences between the proportions of the groups. The differences among the clinical parameters, continuous variables, and polymorphisms were evaluated by using the Mann–Whitney U test. Software packages SPSS 19 (IBM, Chicago, IL) and Epi-Info 6.04b were used (Atlanta, CDC).

Results

The patients were separated into two groups depending whether they were positive or negative for influenza A/H1N1, thereby forming the groups, influenza A/H1N1 and ILI, respectively. In both the A/H1N1 and ILI groups, the majority was male (68.0% and 58.0%, respectively), whereas in the AHC group, 61.93% were female. The mean age of the A/H1N1 and ILI groups was <45 years (68.18% and 60.0%, respectively), compared to that of the AHC group, 56.82% of who were 45–64 years of age.
The data concerning the demographics, co-morbidities, and symptomatology for both groups of patients are presented in Table 3. Interestingly, the mortality was higher for patients with infection by influenza A/H1N1 than for those with ILI (34.09% vs. 4.0%, respectively; P<0.001); similarly, hospitalization in the ICU was more frequent for the influenza A/H1N1 group (54.55% vs. 30.0%, respectively; p = 0.01). No statistically significant differences were found for any of the other variables analyzed. Of the influenza A/H1N1 patients, 93.3% had radiographic signs of pulmonary compromise, with a statistically significant difference between the two groups of patients (p = 0.043; data not shown).
Table 3
Demographical and clinical characteristics of influenza A/H1N1 patients, influenza-like illness (ILI) patients, and healthy control subjects
Characteristic
A/H1N1 patients
ILI patients
Healthy controls
p
 
(Total: 44)
(Total: 50)
(Total: 176)
 
 
n (%)
n (%)
n (%)
 
Sex
    
Male
30 (68.18)
29 (58.0)
67 (38.07)
 
Female
14 (31.82)
21 (42.0)
109 (61.93)
 
Age
    
<45
30 (68.18)
30 (60.0)
54 (30.68)
 
45-64
11 (25.00)
13 (26.0)
100 (56.82)
 
≥65
3 (6.82)
7 (14.0)
22 (12.50)
 
BMI ≥30
18 (40.91)
21 (42.0)
46 (26.42)
 
Mortality
15 (34.09)
2 (4.0)
 
<0.001*
P a O 2 <60 mm Hg (severe)
19 (43.18)
24 (48.0)
  
ICU
24 (54.55)
15 (30.0)
 
0.01*
Co-morbidities
    
Neurological disease
25 (56.82)
22 (44.0)
  
Asthma
2 (4.55)
6 (12.0)
  
Cancer
1 (2.27)
2 (4.0)
  
Hypertension
8 (18.18)
7 (14.0)
  
Smoking
21 (47.73)
29 (58.0)
  
Symptomatology
    
Fever (>38°C)
33 (75.00)
42 (84.0)
  
Cough
23 (52.27)
31 (62.0)
  
Nasal Congestion
5 (11.36)
2 (4.0)
  
Rhinorrhea
12 (27.27)
20 (40.0)
  
Dyspnea
33 (75.00)
35 (70.0)
  
*When comparing A/H1N1 patients vs. ILI patients. BMI: Body mass index; PaO2: partial pressure of oxygen in arterial blood; ICU: Intensive Care Unit. Results were considered statistically significant when P was <0.05.

Analysis of genetic association

Genotyping was carried out for eight SNPs from six genes, the protein products of which have been associated with inflammatory processes. The genetic information of the polymorphisms that were evaluated is presented in Table 4. An appreciation of the genetic contribution to the risk of infection by influenza A/H1N1 was obtained by evaluating genotype and alleles of both patient groups and comparing the frequencies of the genotypes and alleles with those of the AHC group.
Table 4
Genetic frequency of the genotypes of eight SNPs in six genes and their association with infection by influenza A/H1N1 virus
Gene and genotype
Genetic frequency
 
A/H1N1 group
AHC group
p
OR
95% CI
ILI group
p
OR
95% CI
CCL1 rs2282691
         
AA
0.643
0.402
0.0085
2.67
1.26-5.81
0.630
0.0096
2.53
1.23-5.30
TA
0.286
0.456
   
0.304
   
TT
0.071
0.142
   
0.065
   
IL1B rs16944
         
GA
0.535
0.449
   
0.583
   
GG
0.442
0.364
   
0.375
   
AA
0.023
0.188
0.015
0.10
0.00-0.66
0.042
0.024
0.19
0.02-0.79
IL8 rs4073
         
AT
0.659
0.445
0.0231
2.40
1.12-5.32
0.500
   
AA
0.244
0.396
   
0.386
   
TT
0.098
0.159
   
0.114
   
IL6 rs1818879
         
GG
0.439
0.268
   
0.381
   
AG
0.390
0.530
   
0.452
   
AA
0.171
0.202
   
0.167
   
LTA rs909253
         
CT
0.535
0.244
0.0004
3.56
1.68-7.54
0.540
0.00014
3.63
1.79-7.38
TT
0.302
0.488
0.0432
0.45
0.20-0.97
0.320
0.0517*
0.49
0.24-1.00
CC
0.163
0.267
   
0.140
   
TNF
         
  rs361525
         
GG
0.818
0.884
   
0.894
   
AA
0.136
0.006
0.00031
27.0
3.07-1248.77
0.000
   
GA
0.045
0.110
   
0.106
   
  rs1800629
         
GG
0.932
0.946
   
0.911
   
GA
0.068
0.054
   
0.089
   
AA
0.000
0.000
       
  rs1800750
         
GG
0.789
0.949
0.0035
0.20
0.06-0.66
0.830
0.0116
0.26
0.08-0.84
AA
0.158
0.028
0.005
6.41
1.51-27.92
0.128
0.0128
5.00
1.20-21.61
GA
0.053
0.023
   
0.043
   
A/H1N1 group: patient infected with influenza A/H1N1 virus; AHC group: asymptomatic, healthy contacts; ILI group: patients with influenze-like illness; OR: odds ratio; CI: confidence interval. Results were considered statistically significant when p was <0.05.
For the A/H1N1 and AHC groups, of the eight SNPs used, 24 genotype products were generated; in the ILI group, only 23 genotypes were determined, as the genotype AA does not exist for the rs361525 of the gene TNF. For the A/H1N1 group, five genotypes associated with risk were identified (p <0.05; OR >2.0). Of particular interest was the finding of homozygous A genotype in SNPs rs361525 and rs1800750 in TNF, both with values of OR >5.0. In addition, the genotypes rs2282691 AA, rs4073 AT, and rs909253 CT (CCL1, IL8, and LTA, respectively) demonstrated statistically significant association with risk. For the ILI group, three of the five associations previously reported for the A/H1N1 group were found. It is of note that these associations, which coincided in both patient groups, showed statistically significant data (p values and OR) that were very similar. On the other hand, our findings demonstrated the existence of three genotypes with association to protection (p <0.05; OR ≤1.0): IL1B rs16944 AA, LTA rs909253, and TNF rs1800750 GG, in both patient groups, as compared to the AHC group (Table 4).
In the analysis of alleles, two signs that showed statistically significant association with risk were found: allele A of rs2282691 of CCL1 was shown to be increased in both patient groups (A/H1N1, p <0.05; ILI, p <0.01), when the allelic frequency (AF) of each patient group was compared with that of the AHC group (OR = 2.15 and 2.11, respectively). Also, rs1800750 allele A, one of the three polymorphisms evaluated for TNF, showed a similar behavior, that is, an association with risk in both patient groups (A/H1N1, p <0.01; ILI, p <0.01). No other association was found for the remaining six SNPs analyzed (Table 5).
Table 5
Risk of influenza A/H1N1 infection in relation to the different polymorphisms studied
Gen/allele
Risk of influenza A/H1N1 infection
 
p
OR (95% CI)
OR allelic (95% CI)
CCL1
  
2.31 (1.25-4.31)
  rs2282691
   
AT
0.85
1.14 (0.29-4.38)
 
AA
0.12
2.75 (0.78-9.72)
 
IL1B
  
1.62 (0.92-2.88)
  rs16944
   
GG
0.04
8.57 (1.11-66.46)
 
AG
0.06
7.33 (0.95-56.41)
 
IL8
  
1.45 (0.80-2.63)
  rs4073
   
TT
0.96
0.97 (0.29-3.28)
 
AT
0.17
1.73 (0.79-3.74)
 
IL6
  
1.01 (0.59-1.71)
  r1818879
   
AG
0.2
0.61 (0.29-1.30)
 
AA
0.45
0.69 (0.26-1.82)
 
LTA
  
0.72 (0.42-1.26)
  rs909253
   
GG
0.66
1.25 (0.46-3.41)
 
AG
<0.001
3.3 (1.51-7.20)
 
TNF
  
1.25 (0.79-1.99)
  rs1800750
   
AG
0.27
2.54 (0.49-13.24)
 
AA
0.02
3.52 (1.24-10.03)
 
  rs1800629
  
1.10 (0.30-3.91)
AG
0.88
1.1 (0.30-4.02)
 
  rs361525
  
3.34 (1.56-7.08)
AG
0.37
0.5 (0.11-2.24)
 
AA
<0.001
34.8 (4.06-297.87)
 
OR: odds ratio; CI: confidence interval; allelic OR: comparison with ancestral gene. Results were considered statistically significant when P was <0.05.

Association of genotypes with clinical variables

Mortality

The genotype AG of rs909253 in LTA showed a tendency to be associated with mortality (OR = 3.13), with p = 0.06 just above the limit of statistical significance. Table 6 presents the data for the different genotypes evaluated with respect to mortality. The data corresponding to the allelic OR were carried out for both alleles; however, only those carried out for the ancestral allele are shown. No data for the remaining alleles or genotypes studied were statistically significant. The logistic regression analysis, after adjusting for levels of PaO2 and for admission to the ICU, showed no statistically significant association between the genotypes and mortality.
Table 6
Risk of death from influenza A/H1N1 in relation to the different polymorphisms studied
Gen/allele
p
OR (CI 95%)
OR allelic (CI 95%)
CCL1 rs2282691
  
1.63 (0.63-4.40)
AT
0.40
0.4 (0.07-2.79)
 
AA
0.90
1.1 (0.22-5.31)
 
IL1B rs16944
  
1.55 (0.56-4.50)
GG
0.70
1.6 (0.17-14.40)
 
AG
0.30
2.8 (0.35-23.02)
 
IL8 rs4073
  
1.41 (0.53-3.78)
TT
0.70
0.7 (0.07-6.11)
 
AT
0.40
1.7 (0.51-5.76)
 
IL6 rs1818879
  
0.96 (0.40-2.28)
AG
0.30
0.5 (0.15-1.70)
 
AA
0.50
0.5 (0.10-2.76)
 
LTA rs909253
  
0.46 (0.16-1.27)
GG
0.50
0.5 (0.05-4.27)
 
AG
0.06
3.1 (0.93-10.53)
 
TNF
   
rs1800750
  
1.21 (0.55-2.61)
AG
0.30
3.5 (0.39-31.76)
 
AA
0.20
2.9 (0.58-14.51)
 
rs1800629
  
2.39 (0.51-11.03)
AG
0.30
2.5 (0.51-12.26)
 
rs361525
  
0.95 (0.21-4.16)
AG
1.00
  
AA
0.40
2.8 (0.31-24.74)
 
OR: odds ratio; CI: confidence intervals; allelic OR: comparison with ancestral gene. Results were considered statistically significant when P was <0.05.

Polymorphisms and laboratory tests

No changes in laboratory parameters were found with respect to the genotypes of the SNPs in TNF rs361525, LTA rs909253, CCL1 rs2282691, or IL6 rs1818879 ( Additional file 1: Table S1). For the homozygous genotype AA of rs16944 in IL1B, an elevated number of leukocytes was found (mean: 44.9 × 103/mm3), whereas for the heterozygous genotype AG and the homozygous genotype GG, the mean titer values were 8.62 ×103/mm3 and 6.96 ×103/mm3, respectively (p <0.001). The genotype AG in rs1800629 in TNF was associated with elevated levels of BUN (33mg/dl), whereas for the genotype GG, the BUN levels were lower (p =0.05) (Additional file 1: Table S1). The genotype AA of rs1800750 in TNF showed high levels of CPK (mean: 2246.25 IU/L), whereas the genotypes GG and AG had mean values of 366.32 IU/L and 450.00 IU/L, respectively (p=0.05).

Discussion

Although it has been reported that some of the genes involved in inflammation are associated with pulmonary and infectious diseases [16, 17, 21, 2528], to date, no direct association between these polymorphisms and infection by influenza A/H1N1 virus has been reported. In the present study, the logistic regression analysis of cases and controls showed that TNF rs361525 (AA), rs1800750 (AA), and LTA rs909253 (AG) were associated with high risk of infection by pandemic influenza A/H1N1. Although mortality of the A/H1N1 patients was greater than that of the ILI patients (p <0.001), only genotype AG of LTA rs909253 demonstrated an association with mortality (p = 0.06) just missing being statistically significant. This finding may indicate that being a carrier of genotype AG LTA at rs909253 entails a poorer prognosis for this illness.
Some biomarkers, such as CRP, LDH, leukopenia, and hypoxemia [7, 8] have been considered as predictors for severe illness by influenza A/H1N1 virus. In this study, we found that elevated values of laboratory test parameters (BUN, CPK, and leukocyte titer) were associated with TNF (rs1800629 AG, rs1800750 AA), and IL1B (genotype AA). These results may indicate that being a carrier of these polymorphisms in particular may be associated with severer organic damage by infection by influenza A/H1N1 virus. However, in the case of IL8, the homozygous AA appeared to offer a certain degree of protection against severe illness; this may be explained, in part, by the association of a higher concentration of oxygen in the blood (PaO2 >60 mm Hg) with this genotype.
Although susceptibility for presenting an adverse clinical course (i.e., sepsis, septic shock, multiples organ failure, or death) varies due to different degrees of inflammatory response [30], genetic factors of the host may influence the nature and intensity of this response. The present study is the first to demonstrate that the polymorphisms in genes related to the inflammatory response may, in some manner, be influencing the risk of infection by influenza A/H1N1 virus and of death from this illness. One possible mechanism may be the formation of disequilibria in the bond between alleles, creating haplotypes that differentially affect the expression and activity of cytokines and chemokines, thereby resulting in a severer clinical course for the infection.
To avoid variability in our results, we studied a homogeneous population of Mexican mestizos. Although the sampling size was a limitation in our study, we were able to demonstrate statistically significant differences in the distribution of genotypes in terms of infection, mortality, and biomarkers between cases and controls, thus suggesting a strong association with the illness. However, infection by influenza A/H1N1 virus is a very complex illness that involves not only the association of environmental factors and the genetic make-up and biology of the individual per se, but also the presence of co-morbidities that may contribute to a greater severity of the illness [4, 5].
We had limitations. For example, contacts exhibited significant titers of specific anti-A/H1N1 antibodies, supporting the fact that they were in contact with the A/H1N1 virus. Additionally is necessary clear that is not a patients group, we just include unrelated contacts in this study (e.g. family in law persons, home workers, etc.). They were in close contact with patients when the latter exhibited acute respiratory illness. None of these household contacts developed respiratory illness. However, the presence of antibody would not confirm infection with A/H1N1 virus because there is the likelihood of cross-reactivity [33]. But, when a person with positivity of antibodies that had contact with an A/H1N1 virus infected patient, the infection cannot be excluded [34]. The gold standard for identifying the infection to A/H1N1 virus is real time PCR test; however to identify the presence of the virus in symptomatic patients is necessary that the patients be assessed during the first days from the beginning of the disease, the probability of identifying the virus by molecular test in asymptomatic patients is very low and not practical [35].
With the high mortality rate from the 2009 influenza A/H1N1 pandemic in Mexico [31], the approach used in this work could acquire great importance, as the study of polymorphisms may be useful in predicting the conduct that the infection would follow during future outbreaks of influenza A/H1N1 in Mexico.

Conclusions

The TNF polymorphisms studied were associated with risk of infection by influenza A/H1N1 virus during the pandemic in Mexico in 2009. These genetic variants may contribute to the severest clinical manifestations in Mexican mestizos.

Acknowledgments

This study was funded by the Consejo Nacional de Ciencia y Tecnología (CONACyT), México and by CONACyT-Básica, SALUD2009-C02-127089. and CONACyT-FOSIS SALUD2009-C02-126699. The authors thank Veronica Yakoleff for translating the original Spanish manuscript and for helpful comments. The authors thank the Coordinación de Investigación en Salud of the IMSS for covering the cost of the translation and publication.
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no conflict of interests.

Authors’ contributions

GMG, RFV, RAGR, AC, and MCL carried out the study and participated in its design and co-ordination, in the molecular assays, and in the preparation of the manuscript. ARV participated in the design and co-ordination of the study, compiled data, and helped prepare the manuscript. MPR, CGB, CGM, VBA, and JMMA participated in the design and co-ordination of the study, carried out the study and the statistical analysis, and helped prepare the manuscript. All authors read and approved the final version of the manuscript.
Literatur
1.
Zurück zum Zitat Bautista E, Chotpitayasunondh T, Gao Z, Harper SA, Shaw M, Uyeki TM, Zaki SR, Hayden FG, Hui DS, Kettner JD, Kumar A, Lim M, Shindo N, Penn C, Nicholson KG: Clinical aspects of pandemic 2009 influenza A (H1N1) virus infection. N Engl J Med. 2010, 362: 1708-1719.CrossRefPubMed Bautista E, Chotpitayasunondh T, Gao Z, Harper SA, Shaw M, Uyeki TM, Zaki SR, Hayden FG, Hui DS, Kettner JD, Kumar A, Lim M, Shindo N, Penn C, Nicholson KG: Clinical aspects of pandemic 2009 influenza A (H1N1) virus infection. N Engl J Med. 2010, 362: 1708-1719.CrossRefPubMed
2.
Zurück zum Zitat Singanayagam A, Singanayagam A, Wood V, Chalmers JD: Factors associated with severe illness in pandemic 2009 influenza A (H1N1) infection: implications for triage in primary and secondary care. J Infect. 2011, 63: 243-251.CrossRefPubMed Singanayagam A, Singanayagam A, Wood V, Chalmers JD: Factors associated with severe illness in pandemic 2009 influenza A (H1N1) infection: implications for triage in primary and secondary care. J Infect. 2011, 63: 243-251.CrossRefPubMed
3.
Zurück zum Zitat Chowell G, Echeverría-Zuno S, Viboud C, Simonsen L, Tamerious J, Miller MA, Borja-Aburto VH: Characterizing the epidemiology of the 2009 influenza A/H1N1 pandemic in Mexico. PLoS Med. 2011, 8: e1000436-CrossRefPubMedPubMedCentral Chowell G, Echeverría-Zuno S, Viboud C, Simonsen L, Tamerious J, Miller MA, Borja-Aburto VH: Characterizing the epidemiology of the 2009 influenza A/H1N1 pandemic in Mexico. PLoS Med. 2011, 8: e1000436-CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Ward KA, Spokes PJ, McAnulty JM: Case–control study of risk factors for hospitalization caused by pandemic (H1N1) 2009. Emerg Infect Dis. 2011, 17: 1409-1416.PubMedPubMedCentral Ward KA, Spokes PJ, McAnulty JM: Case–control study of risk factors for hospitalization caused by pandemic (H1N1) 2009. Emerg Infect Dis. 2011, 17: 1409-1416.PubMedPubMedCentral
5.
Zurück zum Zitat Fezeu L, Julia C, Henegar A, Bitu J, Hu FB, Grobbee DE, Kengne AP, Hercberg S, Czernichow S: Obesity is associated with higher risk of intensive care unit admission and death in influenza A (H1N1) patients: a systematic review and meta-analysis. Obes Rev. 2011, 12: 653-659.CrossRefPubMed Fezeu L, Julia C, Henegar A, Bitu J, Hu FB, Grobbee DE, Kengne AP, Hercberg S, Czernichow S: Obesity is associated with higher risk of intensive care unit admission and death in influenza A (H1N1) patients: a systematic review and meta-analysis. Obes Rev. 2011, 12: 653-659.CrossRefPubMed
6.
Zurück zum Zitat Yu H, Feng Z, Uyeki TM, Liao Q, Zhou L, Feng L, Ye M, Xiang N, Huai Y, Yuan Y, Jiang H, Zheng Y, Gargiullo P, Peng Z, Feng Y, Zheng J, Xu C, Zhang Y, Shu Y, Gao Z, Yang W, Wang Y: Risk factors for severe illness with 2009 pandemic influenza A (H1N1) virus infection in China. Clin Infect Dis. 2011, 52: 457-465.CrossRefPubMedPubMedCentral Yu H, Feng Z, Uyeki TM, Liao Q, Zhou L, Feng L, Ye M, Xiang N, Huai Y, Yuan Y, Jiang H, Zheng Y, Gargiullo P, Peng Z, Feng Y, Zheng J, Xu C, Zhang Y, Shu Y, Gao Z, Yang W, Wang Y: Risk factors for severe illness with 2009 pandemic influenza A (H1N1) virus infection in China. Clin Infect Dis. 2011, 52: 457-465.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Reyes S, Montulla B, Martínez R, Córdoba J, Molina JM, Martí V, Martínez A, Ramírez P, Menéndez R: Risk factors of H1N1 etiology in pneumonia and impact on mortality. Respir Med. 2011, 105: 1404-1411.CrossRefPubMed Reyes S, Montulla B, Martínez R, Córdoba J, Molina JM, Martí V, Martínez A, Ramírez P, Menéndez R: Risk factors of H1N1 etiology in pneumonia and impact on mortality. Respir Med. 2011, 105: 1404-1411.CrossRefPubMed
8.
Zurück zum Zitat Wen Y, Deng BC, Zhou Y, Wang Y, Cui W, Wang W, Liu P: Immunological features in patients with pneumonitis due to influenza A H1N1 infection. J Investig Allergol Clin Immunol. 2011, 21: 44-50.PubMed Wen Y, Deng BC, Zhou Y, Wang Y, Cui W, Wang W, Liu P: Immunological features in patients with pneumonitis due to influenza A H1N1 infection. J Investig Allergol Clin Immunol. 2011, 21: 44-50.PubMed
9.
Zurück zum Zitat To KK, Hung IF, Li IW, Lee KL, Koo CK, Yan WW, Liu R, Ho KY, Chu KH, Watt CL, Luk WK, Lai KY, Chow FL, Mok T, Buckley T, Chan JF, Wong SS, Zheng B, Chen H, Lau CC, Tse H, Cheng VC, Chan KH, Yuen KY: Delayed clearance of viral load and marked cytokine activation in severe cases of pandemic H1N1 2009 influenza virus infection. Clin Infect Dis. 2010, 50: 850-859.CrossRefPubMed To KK, Hung IF, Li IW, Lee KL, Koo CK, Yan WW, Liu R, Ho KY, Chu KH, Watt CL, Luk WK, Lai KY, Chow FL, Mok T, Buckley T, Chan JF, Wong SS, Zheng B, Chen H, Lau CC, Tse H, Cheng VC, Chan KH, Yuen KY: Delayed clearance of viral load and marked cytokine activation in severe cases of pandemic H1N1 2009 influenza virus infection. Clin Infect Dis. 2010, 50: 850-859.CrossRefPubMed
10.
Zurück zum Zitat Bermejo-Martin JF, de Lejarazu RO, Pumarola T, Rello J, Almansa R, Ramirez P, Martin-Loeches I, Varillas D, Gallegos MC, Serón C, Micheloud D, Gomez JM, Tenorio-Abreu A, Ramos MJ, Molina ML, Huidobro S, Sanchez E, Gordón M, Fernández V, Del Castillo A, Marcos MA, Villanueva B, López CJ, Rodríguez-Domínguez M, Galan JC, Cantón R, Lietor A, Rojo S, Eiros JM, Hinojosa C: Th1 and Th17 hypercytokinemia as early host response signature in severe pandemic influenza. Crit Care. 2009, 13: R201-10.1186/cc8208.CrossRefPubMedPubMedCentral Bermejo-Martin JF, de Lejarazu RO, Pumarola T, Rello J, Almansa R, Ramirez P, Martin-Loeches I, Varillas D, Gallegos MC, Serón C, Micheloud D, Gomez JM, Tenorio-Abreu A, Ramos MJ, Molina ML, Huidobro S, Sanchez E, Gordón M, Fernández V, Del Castillo A, Marcos MA, Villanueva B, López CJ, Rodríguez-Domínguez M, Galan JC, Cantón R, Lietor A, Rojo S, Eiros JM, Hinojosa C: Th1 and Th17 hypercytokinemia as early host response signature in severe pandemic influenza. Crit Care. 2009, 13: R201-10.1186/cc8208.CrossRefPubMedPubMedCentral
11.
Zurück zum Zitat Michaelis M, Doerr HW, Cinatl J: Of chickens and men: avian influenza in humans. Curr Mol Med. 2009, 9: 131-151.CrossRefPubMed Michaelis M, Doerr HW, Cinatl J: Of chickens and men: avian influenza in humans. Curr Mol Med. 2009, 9: 131-151.CrossRefPubMed
12.
Zurück zum Zitat de Jong MD, Simmons CP, Thanh TT, Hien VM, Smith GJ, Chau TN, Hoang DM, Chau NV, Khanh TH, Dong VC, Qui PT, Cam BV, Ha DQ, Guan Y, Peiris JS, Chinh NT, Hien TT, Farrar J: Fatal outcome of human influenza A (H5N1) is associated with high viral load of human influenza A. Nat Med. 2006, 12: 1203-1207.CrossRefPubMedPubMedCentral de Jong MD, Simmons CP, Thanh TT, Hien VM, Smith GJ, Chau TN, Hoang DM, Chau NV, Khanh TH, Dong VC, Qui PT, Cam BV, Ha DQ, Guan Y, Peiris JS, Chinh NT, Hien TT, Farrar J: Fatal outcome of human influenza A (H5N1) is associated with high viral load of human influenza A. Nat Med. 2006, 12: 1203-1207.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Mainers TR, Szretter KJ, Perrone L, Belser JA, Bright RA, Zeng H, Tumpey TM, Katz JM: Pathogenesis of emerging avian influenza viruses in mammals and the host innate immune response. Immunol Rev. 2008, 225: 68-84.CrossRef Mainers TR, Szretter KJ, Perrone L, Belser JA, Bright RA, Zeng H, Tumpey TM, Katz JM: Pathogenesis of emerging avian influenza viruses in mammals and the host innate immune response. Immunol Rev. 2008, 225: 68-84.CrossRef
14.
Zurück zum Zitat Hagau N, Slavcovici A, Gonganau DN, Oltean S, Dirzu DS, Brezoszki ES, Maxim M, Ciuce C, Mlesnite M, Gavrus RL, Laslo C, Hagau R, Petrescu M, Studnicska DM: Clinical aspects and cytokine response in severe H1N1 influenza A virus infection. Crit Care. 2010, 14: R203-10.1186/cc9324.CrossRefPubMedPubMedCentral Hagau N, Slavcovici A, Gonganau DN, Oltean S, Dirzu DS, Brezoszki ES, Maxim M, Ciuce C, Mlesnite M, Gavrus RL, Laslo C, Hagau R, Petrescu M, Studnicska DM: Clinical aspects and cytokine response in severe H1N1 influenza A virus infection. Crit Care. 2010, 14: R203-10.1186/cc9324.CrossRefPubMedPubMedCentral
15.
Zurück zum Zitat Wang B, Wang J, Zheng Y, Zhou S, Zhen J, Wang F, Ma X, Zeng Z, HBV Study Consortium: TNF-alpha-238 and −308 polymorphisms with different outcomes of persistent hepatitis B virus infection in china. Pathology. 2010, 42: 674-680.CrossRefPubMed Wang B, Wang J, Zheng Y, Zhou S, Zhen J, Wang F, Ma X, Zeng Z, HBV Study Consortium: TNF-alpha-238 and −308 polymorphisms with different outcomes of persistent hepatitis B virus infection in china. Pathology. 2010, 42: 674-680.CrossRefPubMed
16.
Zurück zum Zitat Alssani B, Ogwaro KM, Shrestha S, Tang J, Breen EC, Wong HL, Jacobson LP, Rabkin CS, Ambinder RF, Martinez-Maza O, Kaslow RA: The major histocompatibility complex conserved extended haplotype 8.1 in AIDS-related non-Hodgkin lymphoma. J Acquir Immune Defic Syndr. 2009, 52: 170-179.CrossRef Alssani B, Ogwaro KM, Shrestha S, Tang J, Breen EC, Wong HL, Jacobson LP, Rabkin CS, Ambinder RF, Martinez-Maza O, Kaslow RA: The major histocompatibility complex conserved extended haplotype 8.1 in AIDS-related non-Hodgkin lymphoma. J Acquir Immune Defic Syndr. 2009, 52: 170-179.CrossRef
17.
Zurück zum Zitat Gaudet MM, Egan KM, Lissowska J, Newcomb PA, Brinton LA, Titus-Ernstoff L, Yeager M, Chanock S, Welch R, Peplonska B, Trentham-Dietz A, Garcia-Closas M: Genetic variation in tumor factor and lymphotoxin-alpha (TNA-LTA) and breast cancer risk. Human Genet. 2007, 121: 483-490.CrossRef Gaudet MM, Egan KM, Lissowska J, Newcomb PA, Brinton LA, Titus-Ernstoff L, Yeager M, Chanock S, Welch R, Peplonska B, Trentham-Dietz A, Garcia-Closas M: Genetic variation in tumor factor and lymphotoxin-alpha (TNA-LTA) and breast cancer risk. Human Genet. 2007, 121: 483-490.CrossRef
18.
Zurück zum Zitat Partida-Rodriguez O, Torres J, Flores-Luna L, Camorlinga M, Nieves-Ramirez M, Lazcano E, Perez-Rodriguez M: Polymorphism in TNF and HSP-70 show a significant association with gastric cancer and duodenal ulcer. Int J Cancer. 2010, 126: 1861-1868.PubMed Partida-Rodriguez O, Torres J, Flores-Luna L, Camorlinga M, Nieves-Ramirez M, Lazcano E, Perez-Rodriguez M: Polymorphism in TNF and HSP-70 show a significant association with gastric cancer and duodenal ulcer. Int J Cancer. 2010, 126: 1861-1868.PubMed
19.
Zurück zum Zitat Ned RM, Yesupriya A, Imperatore G, Smelser D, Moonesinghe R, Chang MH, Dowling NF: nflammation gene variants and susceptibility to albuminuria in U.S. population: analysis in the Third National Health and Nutrition Examination Survey (NHANES III), 1991–94. BMC Med Genet. 2010, 11: 155-CrossRefPubMedPubMedCentral Ned RM, Yesupriya A, Imperatore G, Smelser D, Moonesinghe R, Chang MH, Dowling NF: nflammation gene variants and susceptibility to albuminuria in U.S. population: analysis in the Third National Health and Nutrition Examination Survey (NHANES III), 1991–94. BMC Med Genet. 2010, 11: 155-CrossRefPubMedPubMedCentral
20.
Zurück zum Zitat Martinez-Carrillo DN, Garza-Gonzalez E, Betancout-Linares R, Mónico-Manzano T, Antúnez-Rivera C, Roman-Roman A, Flores-Alfaro E, Illades-Aguiar B, Fernández-Tilapa G: Association of ILB -511C/-31T haplotypes and Helicobacter Pylori VacA genotypes with gastric ulcer and chronic gastritis. BMC Gastroenterol. 2010, 10: 126-CrossRefPubMedPubMedCentral Martinez-Carrillo DN, Garza-Gonzalez E, Betancout-Linares R, Mónico-Manzano T, Antúnez-Rivera C, Roman-Roman A, Flores-Alfaro E, Illades-Aguiar B, Fernández-Tilapa G: Association of ILB -511C/-31T haplotypes and Helicobacter Pylori VacA genotypes with gastric ulcer and chronic gastritis. BMC Gastroenterol. 2010, 10: 126-CrossRefPubMedPubMedCentral
21.
Zurück zum Zitat Vazarova B, Fernádez-Real JM, Knoweler WC, Gallart L, Hanson RL, Guber JD, Ricart W, Vendrell J, Richart C, Tataranni PA, Wolford JK: The interleukin-6 (−174) G/C promoter polymorphism is associated with type-2 diabetes mellitus in Native Americans and Caucasians. Hum Genet. 2003, 112: 409-413. Vazarova B, Fernádez-Real JM, Knoweler WC, Gallart L, Hanson RL, Guber JD, Ricart W, Vendrell J, Richart C, Tataranni PA, Wolford JK: The interleukin-6 (−174) G/C promoter polymorphism is associated with type-2 diabetes mellitus in Native Americans and Caucasians. Hum Genet. 2003, 112: 409-413.
22.
Zurück zum Zitat Qi L, Zhang C, van Dam RM, Hu FB: Interleukin-6 genetic variability and adiposity: association in two prospective cohorts and systematic review in 26,944 individuals. J Clin Endocrinol Metab. 2007, 92: 3618-3625.CrossRefPubMed Qi L, Zhang C, van Dam RM, Hu FB: Interleukin-6 genetic variability and adiposity: association in two prospective cohorts and systematic review in 26,944 individuals. J Clin Endocrinol Metab. 2007, 92: 3618-3625.CrossRefPubMed
23.
Zurück zum Zitat Cheng CH, Lee YS, Tsau YK, Lin TY: Genetic polymorphisms and susceptibility to parenchymal renal infection among pediatric patients. Pediatr Infect Dis J. 2011, 30: 309-314.CrossRefPubMed Cheng CH, Lee YS, Tsau YK, Lin TY: Genetic polymorphisms and susceptibility to parenchymal renal infection among pediatric patients. Pediatr Infect Dis J. 2011, 30: 309-314.CrossRefPubMed
24.
Zurück zum Zitat Heinzmann A, Ahlert I, Kurtz T, Berner R, Deichmann KA: Association study suggests opposite effects of polymorphism within IL8 on bronchial asthma and respiratory syncytial virus bronchiolitis. J Allergy Clin Immunol. 2004, 114: 671-676.CrossRefPubMed Heinzmann A, Ahlert I, Kurtz T, Berner R, Deichmann KA: Association study suggests opposite effects of polymorphism within IL8 on bronchial asthma and respiratory syncytial virus bronchiolitis. J Allergy Clin Immunol. 2004, 114: 671-676.CrossRefPubMed
25.
Zurück zum Zitat Hacking D, Knight JC, Rockett K, Brown H, Frampton J, Kwiatkowski DP, Hull J, Udalova IA: Increased in vivo transcription of an IL-8 haplotype associated with respiratory syncytial virus disease-susceptibility. Genes Immun. 2004, 5: 274-282.CrossRefPubMed Hacking D, Knight JC, Rockett K, Brown H, Frampton J, Kwiatkowski DP, Hull J, Udalova IA: Increased in vivo transcription of an IL-8 haplotype associated with respiratory syncytial virus disease-susceptibility. Genes Immun. 2004, 5: 274-282.CrossRefPubMed
26.
Zurück zum Zitat Hull J, Thomson A, Kwiatkowski D: Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax. 2000, 55: 1023-1027.CrossRefPubMedPubMedCentral Hull J, Thomson A, Kwiatkowski D: Association of respiratory syncytial virus bronchiolitis with the interleukin 8 gene region in UK families. Thorax. 2000, 55: 1023-1027.CrossRefPubMedPubMedCentral
27.
Zurück zum Zitat Takabatake N, Shibata Y, Abe S, Wada T, Machiva J, Igarashi A, Tokairin Y, Ji G, Sato H, Sata M, Takeishi Y, Emi M, Muramatsu M, Kubota I: A single nucleotide polymorphism in the CCL1 gene predicts acute exacerbations in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2006, 174: 875-885.CrossRefPubMed Takabatake N, Shibata Y, Abe S, Wada T, Machiva J, Igarashi A, Tokairin Y, Ji G, Sato H, Sata M, Takeishi Y, Emi M, Muramatsu M, Kubota I: A single nucleotide polymorphism in the CCL1 gene predicts acute exacerbations in chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 2006, 174: 875-885.CrossRefPubMed
28.
Zurück zum Zitat Camarena A, Juárez AM, Estrada A, Carrillo G, Falfán R, Zuñiga J, Navarro C, Granados J, Selman M: Major histocompatibility complex and tumor necrosis factor-α polymorphisms in pigeon breeder’s disease. Am J Respir Crit Care Med. 2001, 163: 1528-1533.CrossRefPubMed Camarena A, Juárez AM, Estrada A, Carrillo G, Falfán R, Zuñiga J, Navarro C, Granados J, Selman M: Major histocompatibility complex and tumor necrosis factor-α polymorphisms in pigeon breeder’s disease. Am J Respir Crit Care Med. 2001, 163: 1528-1533.CrossRefPubMed
29.
Zurück zum Zitat Nieves ME, Partida O, Alegre P, Tapia MC, Pérez M: Characterization of single-nucleotide polymorphisms in the tumor necrosis factor α promoter region and lymphotoxin α in squamous intraepithelial lesion, precursors of cervical cancer. Transl Oncol. 2011, 4: 336-344.CrossRef Nieves ME, Partida O, Alegre P, Tapia MC, Pérez M: Characterization of single-nucleotide polymorphisms in the tumor necrosis factor α promoter region and lymphotoxin α in squamous intraepithelial lesion, precursors of cervical cancer. Transl Oncol. 2011, 4: 336-344.CrossRef
30.
Zurück zum Zitat Paskullin DD, Fallavena P, Paludo F, Borges T, Picanco J, Dias F, Alho C: TNF -308G > a promoter polymorphism (rs1800626) and outcome from critical illness. Braz J Infec Dis. 2011, 15: 231-238.CrossRef Paskullin DD, Fallavena P, Paludo F, Borges T, Picanco J, Dias F, Alho C: TNF -308G > a promoter polymorphism (rs1800626) and outcome from critical illness. Braz J Infec Dis. 2011, 15: 231-238.CrossRef
31.
Zurück zum Zitat Echevarría-Zuno S, Mejía-Aranguré JM, Mar-Obeso AJ, Grajales-Muñiz C, Robles-Pérez E, González-León M, Ortega-Alvarez MC, Gonzalez-Bonilla C, Rascón-Pacheco RA, Borja-Aburto VH: Infection and death from influenza A H1N1 virus in Mexico: a retrospective analysis. Lancet. 2009, 374: 2072-2079.CrossRefPubMed Echevarría-Zuno S, Mejía-Aranguré JM, Mar-Obeso AJ, Grajales-Muñiz C, Robles-Pérez E, González-León M, Ortega-Alvarez MC, Gonzalez-Bonilla C, Rascón-Pacheco RA, Borja-Aburto VH: Infection and death from influenza A H1N1 virus in Mexico: a retrospective analysis. Lancet. 2009, 374: 2072-2079.CrossRefPubMed
33.
Zurück zum Zitat Hancock K, Veguilla V, Lu X, Zhong W, Butler EN, Sun H, Liu F, Dong L, DeVos JR, Gargiullo PM, Brammer TL, Cox NJ, Tumpey TM, Katz JM: Cross-reactive antibody responses to the 2009 pandemic H1N1 influenza virus. N Engl J Med. 2009, 361: 1945-1952.CrossRefPubMed Hancock K, Veguilla V, Lu X, Zhong W, Butler EN, Sun H, Liu F, Dong L, DeVos JR, Gargiullo PM, Brammer TL, Cox NJ, Tumpey TM, Katz JM: Cross-reactive antibody responses to the 2009 pandemic H1N1 influenza virus. N Engl J Med. 2009, 361: 1945-1952.CrossRefPubMed
34.
Zurück zum Zitat Baguelin M, Hoschler K, Stanford E, Waight P, Hardelid P, Andrews N, Miller E: Age-specific incidence of A/H1N1 2009 influenza infection in England from sequential antibody prevalence data using likelihood-based estimation. PLoS One. 2011, 6: e17074-CrossRefPubMedPubMedCentral Baguelin M, Hoschler K, Stanford E, Waight P, Hardelid P, Andrews N, Miller E: Age-specific incidence of A/H1N1 2009 influenza infection in England from sequential antibody prevalence data using likelihood-based estimation. PLoS One. 2011, 6: e17074-CrossRefPubMedPubMedCentral
35.
Zurück zum Zitat Papenburg J, Baz M, Hamelin MÈ, Rhéaume C, Carbonneau J, Ouakki M, Rouleau I, Hardy I, Skowronski D, Roger M, Charest H, De Serres G, Boivin G: Household transmission of the 2009 pandemic A/H1N1 influenza virus: elevated laboratory-confirmed secondary attack rates and evidence of asymptomatic infections. Clin Infect Dis. 2010, 51: 1033-1041.CrossRefPubMed Papenburg J, Baz M, Hamelin MÈ, Rhéaume C, Carbonneau J, Ouakki M, Rouleau I, Hardy I, Skowronski D, Roger M, Charest H, De Serres G, Boivin G: Household transmission of the 2009 pandemic A/H1N1 influenza virus: elevated laboratory-confirmed secondary attack rates and evidence of asymptomatic infections. Clin Infect Dis. 2010, 51: 1033-1041.CrossRefPubMed
Metadaten
Titel
Pandemic influenza A/H1N1 virus infection and TNF, LTA, IL1B, IL6, IL8, and CCLpolymorphisms in Mexican population: a case–control study
verfasst von
Guadalupe Morales-García
Ramcés Falfán-Valencia
Román Alejandro García-Ramírez
Ángel Camarena
Alejandra Ramirez-Venegas
Manuel Castillejos-López
Martha Pérez-Rodríguez
César González-Bonilla
Concepción Grajales-Muñíz
Víctor Borja-Aburto
Juan Manuel Mejía-Aranguré
Publikationsdatum
01.12.2012
Verlag
BioMed Central
Erschienen in
BMC Infectious Diseases / Ausgabe 1/2012
Elektronische ISSN: 1471-2334
DOI
https://doi.org/10.1186/1471-2334-12-299

Weitere Artikel der Ausgabe 1/2012

BMC Infectious Diseases 1/2012 Zur Ausgabe

Leitlinien kompakt für die Innere Medizin

Mit medbee Pocketcards sicher entscheiden.

Seit 2022 gehört die medbee GmbH zum Springer Medizin Verlag

Echinokokkose medikamentös behandeln oder operieren?

06.05.2024 DCK 2024 Kongressbericht

Die Therapie von Echinokokkosen sollte immer in spezialisierten Zentren erfolgen. Eine symptomlose Echinokokkose kann – egal ob von Hunde- oder Fuchsbandwurm ausgelöst – konservativ erfolgen. Wenn eine Op. nötig ist, kann es sinnvoll sein, vorher Zysten zu leeren und zu desinfizieren. 

Umsetzung der POMGAT-Leitlinie läuft

03.05.2024 DCK 2024 Kongressbericht

Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.

Proximale Humerusfraktur: Auch 100-Jährige operieren?

01.05.2024 DCK 2024 Kongressbericht

Mit dem demographischen Wandel versorgt auch die Chirurgie immer mehr betagte Menschen. Von Entwicklungen wie Fast-Track können auch ältere Menschen profitieren und bei proximaler Humerusfraktur können selbst manche 100-Jährige noch sicher operiert werden.

Die „Zehn Gebote“ des Endokarditis-Managements

30.04.2024 Endokarditis Leitlinie kompakt

Worauf kommt es beim Management von Personen mit infektiöser Endokarditis an? Eine Kardiologin und ein Kardiologe fassen die zehn wichtigsten Punkte der neuen ESC-Leitlinie zusammen.

Update Innere Medizin

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.