DNA methylation and mRNA expression of SYN III, a candidate gene for schizophrenia

This research was undertaken following an approval from the Ethics Review Board of the University of Western Ontario. This report is based on the analysis of 82 human and 2 non-human primate DNA samples. The 82 human DNA samples represent 31 different human brain regions (from one individual) and 51 blood samples (20 schizophrenia patients [SZ1–SZ20] and 31 un affected controls [C1–C31]) from Southwestern Ontario, Canada. Each patient and control was assessed for signs and symptoms of schizophrenia using DSM IV. All diagnosis was made by Richard L. O'Reilly (Clinical Psychiatrist). The 31 brain samples representing specific brain regions were obtained from Ambion (Austin, TX) who coordinated a custom autopsy on a 63-year old Caucasian male that died of liver cancer. No information was available on the patient's treatment and medication but the donor's serology results were negative for HIV, Syphilis, HBV and HTLV. The 2 non-human primate (cynomologous monkey and baboon) blood samples were obtained from the animal care facility of the University of Western Ontario.

DNA was extracted from fresh blood using QIAamp DNA blood Maxi Kit (Qiagen; Valencia, CA) while RNA was extracted using Trizol (Invitrogen; Carlsbad, CA) following the manufacturer's instructions. DNA from 31 frozen brain tissue was extracted using DNAzol (Molecular Research Centre; Cincinnati, OH). Only 22 of the 31 specific brain regions yielded RNA using TRIzol (Invitrogen; Carlsbad, CA). cDNA synthesis from total RNA was made using Superscript II (Invitrogen; Carlsbad, CA) and purified using QIAquick PCR purification kit (Qiagen; Valencia, CA).

The SYN III sequence (Accession number Z83846) was subjected to annotation for gene organization that included exons, introns and CpG island. The closest CpG island is located ~50 kb upstream from SYN III ATG site in a putative SYN III enhancer region (Figure 1A). A portion of this region formed the focus of methylation studies using modification of genomic DNA by sodium bisulfite. PCR primers were developed for sodium bisulfite modified genomic DNA (Figure 1B) for use in amplification and sequencing of this region from all samples.

We modified a previously established method [45]. Briefly, 2 ug of each DNA sample was cut overnight with Hind III (Invitrogen; Carlsbad, CA) at 37°C. Completely digested gDNA was phenol/chloroformed and reprecipitated with 3 M sodium acetate (pH 5.1) and 100% ethanol. The pellet was vacuum dried and re-suspended in 40 uL of sterile water. The purified Hind III digested DNA was exposed to sodium bisulfite, which in theory converts unmethylated cytosine to uracil while methylated cytosines remain unaltered. The DNA was purified with a Wizard DNA Clean-up System (Promega; Madison, WI) following the manufacture's protocol. Desalted samples were reprecipitated with 3 M sodium acetate (pH 5.1) and 100% ethanol. The pellet was vacuum dried and resuspended in 100 uL of sterile water.

Two primers compatible to the sodium bisulfite converted sequence of the distal CpG island (Figure 1B) were optimized in a 25 uL PCR reaction to amplify a 157 bp fragment. Each sample was PCR amplified. The 25 uL aliquot was run on a 6% PAG, stained with ethidium bromide and photographed using an Alpha Innotech Gel Doc System.

The PCR band was excised, crushed, suspended in water and DNA eluted overnight at 37°C. The polyacrylamide was separated from the DNA aqueous using a Costar Spin X column (45 um filter). DNA was precipitated with 3 M sodium acetate (pH 5.1) and 100% ethanol. The pellet was vacuum dried and resuspended in 20 uL of water. Two 5 uL aliquots of this DNA were each diluted in 9 uL of sterile water and 5 uL (20 pmoles/uL) of the Fwd or Rev primer. These 19 uL solutions were sent for sequencing at the London Regional Genomics Sequencing Facility of the University of Western Ontario, London Ontario. PCR products were directly sequenced using dGTP chemistry and an Applied Biosystems (Foster City, CA) 377 ABI Automatic Sequencer. The resulting fluorograms allowed the identification of methylation for each cytosine in the sequence. As a further confirmation of the sequence of the sodium bisulfite PCR product was undertaken on the monozygotic twin pair, SZ19 (affected with schizophrenia) and C2 (not affected) following cloning in Promega's PGEM-T Easy Vector (Madison, WI). Six clones from each individual were sequenced to confirm the results obtained by direct sequencing of the PCR products.

Primers for Actin (5'acaatgagctgcgtgtggct3' and 5'tctccttaatgtacagcacg3'), GAPD (5'tgaaggtcggagtcaacggatttggt3'and 5'catgtgggccatgaggtccaccac3') and SYN IIIa (5'agcatctccatccatccacagcc3' and 5'cagagatggaggttctcatgtaagcc3') were each optimized separately in 25 uL PCR reaction (Invitrogen, Carlsbad, CA) to amplify 360, 983 and 958 bp fragments respectively. Each sample was PCR amplified (linear phase was empirically determined to be 25 cycles), and the 25 uL aliquot was run on a 6% PAG, stained with ethidium bromide, photographed and quantitated using an Alpha Innotech Gel Doc System. These RT-PCRs were repeated three times i.e. first with the original cDNA, repeated with the same cDNA and repeated with fresh cDNA (made from the original mRNA).

SYN IIIa mRNA quantitation in 22 brain regions for which the RNA samples were obtained was based on three experiments (original cDNA, repeat of orginal cDNA and fresh cDNA from original RNA) involving semi-quantitative RT-PCR (Figure 2). The expression of SYN IIIa in each case was assessed in relation to two housekeeping genes (GAPD and Actin), that were used as internal controls. The results show that the SYN IIIa was expressed in most brain regions examined. However, the level of expression was different in different regions of the human brain. Relatively higher expression was seen in the cortex (temporal, visual and cingulated), cerebellum and BA5 caudal bank while lower expression was seen in the amygdala, pons, internal capsule and temporal cortex (superior). Further, the expression of this mRNA was very low or absent in putamen, lentiform nucleus, red nucleus, thalamic nucleus, caudate nucleus (body), crus cerebri cerebral and caudate (head and body). The results establish that SYN IIIa expression is variable in the human brain regions. In comparison, the SYN IIIa mRNA was not detected in the blood sample, under the sensitivity of the methodology used.

Figure 1 shows the genomic organization of the human SYN III gene and DNA sequence of a portion of the distal CpG island used for studies on cytosine methylation. This region contains 26 cytosines that are numbered 1 to 26 in a 3' to 5' direction towards the reverse primer. The direct sequencing of the PCR product of sodium bisulfite modified gDNA on ABI sequencer has allowed us to assess the fluorograms as called by the sequencer and further appraised by visual observation. Here, a comparison of sodium bisulfite modified gDNA sequence with the NCBI sequence accession number Z83846 show G, A or T nucleotides at all the expected sites. Theoretically, the methylated cytosines are maintained at their original positions while unmethylated cytosines have been converted to T. Also, all cytosines in CpG dinucleotides are unaffected by the sodium bisulfite and cytosines in CpN (where N is not guanine) were completely converted. Note, the unmethylated cytosines in the sequence being investigated serve as controls that the sodium bisulfite pretreatment is working appropriately. Overall, the results suggest that only cytosines in the CpG dinucleotides are subject to methylation in this region of the genome. A close examination of the fluorograms revealed that one of the 3 CpG (cytosine 8) was partially methylated in all DNA samples that included regions of brain and the blood. This partial methylation was read as an N by the sequencer or showed a C as well as T (or G and trace of A on the complementary strand) peaks to different degrees. Table 1 summarizes the methylation specificity of the cytosines at the CpG dinucleotides in the 31 brain specific regions. The degree of cytosine methylation at these CpG dinucleotides was estimated to range from ~50 to 80% (Figure 3). What is also apparent is that the degree of methylation of CpG dinucleotides in this genomic region is specific to different regions of the brain. Given that the brains regions examined were derived from a single individual, the results may or may not be representative for all brains.

Methylation patterns in the proximal CpG island of SYN IIIa of DNA from blood samples from patients with schizophrenia and normal controls were similar to those generated from human brain as cytosine methylation was restricted only to the CpG sites, only. The methylation pattern at cytosine 8 in 20 patients and 31 controls (Table 2, Figure 4) was comparable but not identical. Here the methylation of the cytosine 8 was similar in the blood and brain but unlike the brain, cytosine 20 in blood samples was either partially (~50–80%) or completely methylated. The distribution of the cytosine 20 partial (22 controls and 18 schizophrenia patients) vs complete (9 controls and 2 schizophrenia patients) methylation was not different (Table 2, χ² = 3.14, p = 0.08) in this sample from Southwestern Ontario. Further the methylation results on the monozygotic co-twins discordant for schizophrenia was not different. Additional familial results also suggested that the pattern of methylation for cytosine 8 and 20 is compatible with familial inheritance. Interestingly, the sequence of this genomic region is conserved in non-human primates and its methylation in the two non-human primates (cynomologous monkey and baboon) is similar to the human blood (Figure 5).

The results included in this report support previous reports citing SYN III and in particular SYN IIIa expression in adult brain [2, 3]. Further, it establishes that the SYN IIIa expression in the brain is region and tissue-type specific. The question of how this variability is achieved is of interest, which must be assessed in relevant cell-types. Determinants of differential SYN III expression may influence or determine a normal expression of this gene. Any abnormality in such determinants particularly CpG methylation in SYN III's CpG island may cause SYN IIIa associated abnormalities.

The SYN III cytosines examined show that cytosine methylation is restricted to CpG dinucleotides only. This pattern is seen in all tissues and cell-types analyzed (i.e. 31 brain regions, genomic DNA from human blood and blood DNA from two nonhuman primates). Such results argue that the observed pattern of methylation is an inherent and conserved feature of this region of the human genome. Within this region, cytosine 8 is partially methylated while cytosine 20 is either partially or fully methylated in human brain (Table 1), human blood (Table 2) and blood samples from nonhuman primates. Of interest is the observation on partial methylation. In addition, the results argue that in absence of prohibitive brain tissues, readily available blood DNA may serve as a source for such studies. Similar methylation in human and non-human primate blood DNA in this sequence conserved region may suggest that this methylation is evolutionarily relevant and could be biologically significant.

Also, the individual specific partial/full methylation at the cytosine 20 site across individuals may imply epigenetic polymorphism in the population. In this context the nature and source of this variability remains hypothetical and may represent an aspect of parent of origin effect. The relevance of this polymorphism in human brains could not be assessed as the 31 brain regions assessed were derived from a single individual. More important, since methylated and unmethylated cytosine 20 was observed in DNA from patients with schizophrenia as well as the controls and this distribution was not significantly different between the two groups, it was ruled out as being involved in schizophrenia. This conclusion is also supported by the results on monozygotic twin pair discordant for schizophrenia (Figure 5). These and other results included further argue that this epigenetic polymorphism is a genetic property of this DNA sequence that is selected and maintained across generations and during phylogeny. Interestingly, the twin pair studied in this research was 51 years of age. The identical methylation at these sites in twin pairs may suggest that this site is not subject to aging effects [44]. In conclusion, the results included in this report offer support for variation in the level of CpG methylation in this part of the SYN IIIa gene promoter, however it is not involve in the development of schizophrenia or the variable expression of this gene in the brain regions. Future experiments are required to explain tissue specific SYN III mRNA expression differences.