Skip to main content
Erschienen in: BMC Cancer 1/2008

Open Access 01.12.2008 | Research article

Loss of heterozygosity at the ATBF1-A locus located in the 16q22 minimal region in breast cancer

verfasst von: Kazuharu Kai, Zhenhuan Zhang, Hiroko Yamashita, Yutaka Yamamoto, Yutaka Miura, Hirotaka Iwase

Erschienen in: BMC Cancer | Ausgabe 1/2008

Abstract

Background

Loss of heterozygosity (LOH) on the long arm of chromosome 16 is one of the most frequent genetic events in solid tumors. Recently, the AT-motif binding factor 1 (ATBF1)-A gene, which has been assigned to chromosome 16q22.3-23.1, was identified as a plausible candidate for tumor suppression in solid tumors due to its functional inhibition of cell proliferation and high mutation rate in prostate cancer. We previously reported that a reduction in ATBF1-A mRNA levels correlated with a worse prognosis in breast cancer. However, the mechanisms regulating the reduction of ATBF1-A mRNA levels (such as mutation, methylation in the promoter region, or deletion spanning the coding region) have not been fully examined. In addition, few studies have analyzed LOH status at the ATBF1-A locus, located in the 16q22 minimal region.

Methods

Profiles of ATBF1-A mRNA levels that we previously reported for 127 cases were used. In this study, breast cancer specimens as well as autologous blood samples were screened for LOH using 6 polymorphic microsatellite markers spanning chromosome band 16q22. For mutational analysis, we selected 12 cases and analyzed selected spots in the ATBF1-A coding region at which mutations have been frequently reported in prostate cancer.

Results

Forty-three cases that yielded clear profiles of LOH status at both D16S3106 and D16S3018 microsatellites, nearest to the location of the ATBF1-A gene, were regarded as informative and were classified into two groups: LOH (22 cases) and retention of heterozygosity (21 cases). Comparative assessment of the ATBF1-A mRNA levels according to LOH status at the ATBF1-A locus demonstrated no relationship between them. In the 12 cases screened for mutational analysis, there were no somatic mutations with amino acid substitution or frameshift; however, two germ line alterations with possible polymorphisms were observed.

Conclusion

These findings imply that ATBF1-A mRNA levels are regulated at the transcriptional stage, but not by genetic mechanisms, deletions (LOH), or mutations.
Hinweise

Electronic supplementary material

The online version of this article (doi:10.​1186/​1471-2407-8-262) contains supplementary material, which is available to authorized users.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

K.K. performed the molecular genetic studies, participated in the LOH analysis and sequence alignment, and drafted the manuscript. Z.Z. performed the sequence alignment and scored the status of immunohistochemical staining. H.Y. was involved in the study design and scored the status of immunohistochemical staining. Y.M. was involved in the study design and assisted in drafting of the manuscript. Y.Y. and H.I. conceived the study, participated in its design and coordination, and assisted in drafting of the manuscript. All authors have read and approved the final manuscript.
Abkürzungen
LOH
loss of heterozygosity
ATBF1-A
AT-motif binding factor 1-A
TSG
tumor suppressor gene
AFP
alpha-fetoprotein
ROH
retention of heterozygosity
ND
not determined
UI
uninformative
SNP
single nucleotide polymorphism
miRNA
microRNA

Background

Previous studies, including ours, have shown that loss of heterozygosity (LOH) on the long arm of chromosome 16 is one of the most frequent genetic events in breast, gastric and prostate cancers, implying the presence of one or more tumor suppressor genes (TSGs) at this location [17]. In breast cancer, the gene encoding E-cadherin at 16q22.1 was identified as a TSG, but only in the histological subgroup of lobular carcinoma [8]. Recently, the AT-motif binding factor 1 (ATBF1)-A gene (GenBank: L32832), which has been assigned to chromosome 16q22.3-23.1 [9], was identified as a reasonable candidate for tumor suppressor activity in solid tumors, based on its functional inhibition of cell proliferation and high rate of mutations in prostate cancer [10].
ATBF1-A was originally identified as a negative transcriptional factor for the alpha-fetoprotein (AFP) gene through binding with the AT-rich motif in the AFP enhancer element I [11, 12]. In gastric cancer, absence of ATBF1-A is a distinct feature of AFP-producing cancer cells, which are characterized by a high malignant potential [7, 13]. Moreover, ATBF1-A negatively regulates the c-Myb oncoprotein [14] and transactivates the cell cycle inhibitor CDKN1A [15]. Therefore, the ATBF1-A gene is considered to be a good TSG candidate in solid tumors.
Previously, we reported that reduced ATBF1-A mRNA levels in tumors correlated with axillary lymph node metastasis and estrogen receptor (ER)-α negative status in breast cancer, and with a worse prognosis [16]. Sun et al. confirmed the presence of reduced ATBF1-A mRNA levels in breast cancer cell lines [17]. However, the reduced ATBF1-A mRNA expression was attributed neither to promoter methylations nor to frequent somatic mutations [17]. Therefore, the authors concluded that ATBF1-A plays a role in breast cancer through transcriptional down-regulation rather than promoter methylation or mutations.
In addition to promoter methylations or mutations, LOH resulting from a deletion spanning one or more genes is one of the mechanisms by which the function of genes is lost. However, there are no papers in which has been reported the associations between LOH at the ATBF1-A locus [10] in the 16q22 minimal region and AFBF1-A mRNA levels, or between LOH at this locus and the clinicopathological factors in breast cancer. We performed LOH analysis at the 16q22 minimal region and mutational analysis focusing on specific loci in the ATBF1-A gene, which have been reported previously in prostate cancer[10]. Our analysis shows that ATBF1-A mRNA levels are not regulated by genetic machinery, LOH, or mutations. These findings could support the view that the ATBF1-A gene plays a role in breast cancer through transcriptional down-regulation rather than through LOH and mutations.

Methods

Patients and samples

Specimens of primary breast carcinomas were obtained by surgical excision from 127 female patients who received treatment at the Department of Breast and Endocrine Surgery, Nagoya City University Hospital, Nagoya, Japan, between 1993 and 2000. All the patients in the present study had ATBF1-A mRNA profiles, as reported previously [16]. Informed consent was obtained from all the patients before surgery. The ethics committee of Nagoya City University Graduate School of Medicine, Nagoya, approved the study protocol. Of the 127 tumors obtained from these patients, 109 were infiltrating ductal carcinomas and 14 were special type carcinomas, including 8 infiltrating lobular carcinomas. The remaining 4 patients had noninvasive carcinomas. The median age of the patients was 58 years (range, 34–88 years). The patients' tumors were classified according to the staging system of International Union Against Cancer as follows: 4 cases were classified as stage 0, 29 as stage I, 78 as stage II, 12 as stage III, and 4 as stage IV. Patients were graded histopathologically according to the modified Bloom and Richardson method proposed by Elston and Ellis [18]. Blood samples were also taken from each patient. Genomic DNA from the breast cancer specimens and blood samples were extracted by standard techniques. Breast cancer specimens were verified not to contaminate normal cells at 10% or more of each sample on the hematoxylin and eosin stained slides as previously described[19].

Microsatellite markers and LOH analysis

The breast cancer specimens as well as the autologous blood samples were screened using 6 polymorphic microsatellite markers spanning chromosome band 16q22 containing the ATBF1-A gene. The order of microsatellite loci was assessed as reported by Sun et al[10] and with reference to NCBI [20]. Details of the investigated markers and their chromosomal locations are provided in Table 1. Assays were performed by fluorescent-labeled PCR amplification using fluorescent dye-labeled forward primer and unlabeled reverse primer (Applied Biosystems). PCR was performed in 15-μL reaction volumes containing 120 ng of genomic DNA, 9 μL of ABI Prism True Allele PCR Premix (Applied Biosystems), 5 pmol of fluorescent dye-labeled forward primer, and 5 pmol of unlabeled reverse primer under the following cycling conditions recommended by manufacture's instructions: denaturation at 95°C for 12 min; 10 cycles at 94°C for 15 s, 55°C for 15 s, and 72°C for 30 s; 20 cycles at 89°C for 15 s, 55°C for 15 s, and 72°C for 30 s; and a final extension at 72°C for 10 min. Each 1-μL sample of the resulting PCR products was diluted with 20 μL of H2O, and a 1.0-μL aliquot of each diluted fluorescent-labeled PCR product was combined with 12 μL of formamide and 0.5 μL of GeneScan 500 LIZ size standard (Applied Biosystems). Capillary electrophoresis was then performed using an ABI 310 DNA Analyzer, and the results were analyzed using GeneMapper software (Applied Biosystems). Representative results are shown in Figure 1. Allelic loss at each microsatellite locus was considered to be present in tumor samples' DNA when there was at least a 65% peak reduction at one of a pair peak compared with the corresponding peak of normal DNA.
Table 1
Characteristics of polymorphic loci at the 16q22 minimal region
No.
Locus name
Product size (bp)
Genetic map (bp)
Genetic map (cM)
Microsatellite status
1
D16S3031
258–280
64338900–64339200
85.34
Heterozygous
2
D16S752
101–129
69892700–69892800
87.06
Heterozygous
3
D16S3106
166–206
70745300–70745500
88.18
Heterozygous
4
RH69880
149
71553100–71553200
ND
Homozygous
5
D16S2859
186
71675300–71675400
ND
Homozygous
6
D16S3018
244–270
72730200–72730500
90.65
Heterozygous
7
D16S3049
233–255
77478800–77479100
97.03
Heterozygous
8
D16S504
149
77723500–77723600
101.23
Heterozygous
The genetic maps were cited from NCBI Map Viewer http://​www.​ncbi.​nlm.​nih.​gov/​mapview/​. ND, not described.

Gene alterationanalysis of ATBF1-Agene

With intent to analyze ATBF1-A mutations, we selected all the mutational spots in exon 9 and the most frequent deletion spot in exon 10 reported in prostate cancer because > 80% of the mutations reported in the paper were located in these spots (Table 2) [10]. Genomic DNA was amplified by PCR using the amplifying and sequencing primers for these spots on the ATBF1-A gene, as listed in Table 2. For mutation identification, the samples were subsequently analyzed using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems). The sequencings from 50 to 250 bp, counting from the starting point, were regarded as the region of interest.
Table 2
Paired primers used to amplify the specific sequence of ATBF1-A, including the partial mutation loci previously reported in prostate cancer
    
Primer sequence (5'→3')
 
Exon
Mutation no.
Nucleotide*
Amino acid
Forward
Reverse
Product size (bp)
9
1
(5556–5559) del
Frameshift
AGCAACCGGTCAGCCAGAAC
GGTGGCATCCCTACACTCTCAG
336
 
2
5602C→T
No change
   
 
3
(5891–5896) del
 
CTCCAAGCTCTAACTTACTAAGCCAA
AGTTGCAGCAGGGTCTCAGTT
349
 
4
5897insCAA
Gln1741ins
   
 
5
6350delAG
Frameshift
AGCCAGCACCCCGAAAAGA
CTTGCCGCAGGAGTCACAC
360
 
6
6447delG
Frameshift
   
 
7
7154C→T
R2160W
CACCGGCCCAGCCATCAGT
AACCCGGACTTGTCTGCCATCT
322
 
8
8364A→G
Gln2564Arg
TCAACTCCTCAACAGCTCGCAA
GCTTGCACTGGCCTTTTCCTC
333
 
9
8919C→T
A2749V
CGCAGGCCCACAGGAGA
CAAAGTCTTCAATCCCTTCCACC
321
 
10
9380A→G
S2903G
AACTCTTCTAAGCCCTTCCTCCAT
CACTGTAGTCCACTGTACCTTCATTG
356
 
11
9434G→A
A2921T
CCGAGCTTTTATAGCAAGGAATATG
ACTTGGACTTCTTTTCTTTTGCCC
322
10
12
(10814–10834)del
7 amino acid loss
TCCTTACTTTGTACCAGGCTTTTCTC
TCTTCTGGTTTGGGGGATTCTTTG
345
 
13
(10814–10837)del
8 amino acid loss
   
 
14
(10826–10846)del
7 amino acid loss
   
*ATBF1 mutations previously reported in prostate cancer by Sun et al. [10]

Immunohistochemical staining of ER-α, progesterone receptor, and human epidermal growth factor receptor 2

Immunostaining of ER-α, progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) was performed, as described previously [21]. Primary antibodies included monoclonal mouse antihuman estrogen receptor antibody (1D5; DAKO, Glostrup, Denmark) at 1:100 dilution for ER-α, antihuman PR antibody (PR636; DAKO, Kyoto, Japan) at 1:100 dilution for PR, and rabbit antihuman c-erbB2 oncoprotein antibody (DAKO) at 1:200 dilution for HER2. A Streptavidin-biotin system (SAB-PO kit; Nichirei, Tokyo, Japan) was used for the detection of ER-α, PR, and HER2 according to the manufacturer's instructions. The expression of ER-α and PR was scored by assigning a proportion score and an intensity score according to Allred's procedure [22]. Immunohistochemical scoring of HER2 was accomplished as described previously [21].

Statistical analysis

The nonparametric Mann-Whitney U-test was used for statistical analysis of the association between LOH status at the ATBF1-A locus and ATBF1-A mRNA levels. The χ2 test was used to compare LOH status at the ATBF1-A locus with the clinicopathological characteristics. All values with P < 0.05 were considered statistically significant.

Results

Loss of heterozygosity at chromosome band 16q22

Initially, we performed LOH analysis using microsatellite markers spanning 16q22. Sun et al. narrowed the region of deletion at 16q22 in prostate cancer to 861 kb containing the ATBF1-A gene[10]. We used microsatellite markers either in the narrowed 861-kb region or close to the narrowed region spanning 16q22 (Table 1). However, both microsatellite markers in the narrowed region, RH69880 and D16S2859, were homozygous (uninformative). Thereafter, we performed LOH mapping using 6 other microsatellite markers. Next, to determine the most reasonable set of microsatellite markers reflecting LOH status at the ATBF1-A locus, we tested various kinds of microsatellite marker sets from among the 6 microsatellite markers (data not shown). Ultimately, we defined LOH status at the ATBF1-A locus as follows: LOH was identified when the microsatellite markers at both D16S3106 and D16S3018 showed LOH; retention of heterozygosity (ROH), when both D16S3106 and D16S3018 showed ROH; not determined (ND), when there was discrepancy in LOH status between D16S3106 and D16S3018, because ATBF1-A is located between these markers, LOH status at ATBF1-A is not rigorously determined in this case; and uninformative (UI), when there was constitutional homozygosity or an uninterpretable result for at least one of the two microsatellites. The partial results (all cases except UI) of LOH analysis at the 16q22 minimal region are shown in Figure 2. Constitutional heterozygous (informative) status in both D16S3106 and D16S3018 was observed in 52 cases (44.4%). Of the 52 cases, clear LOH was seen in 22 cases (42.3%), ROH in 21 (40.4%), and ND in 9 (17.3%). Subsequently, we analyzed the relationship between LOH status at the ATBF1-A locus and ATBF1-A mRNA expression levels as well as the clinicopathological factors in a study cohort consisting of these 43 informative cases, classifying them into LOH (n = 22) and ROH (n = 21) groups.

Comparison of ATBF1 mRNA expression according to LOH status at the ATBF1-Alocus

In a previous study, we demonstrated that the ATBF-A mRNA expression level was a significant prognostic marker in breast cancer [16]. However, the factors regulating the transcriptional level of the ATBF1-A gene are still not clear. Using ATBF1-A mRNA data, as reported previously [16], we investigated whether LOH status at the ATBF1-A locus regulates the transcriptional level of the ATBF1-A gene. Figure 3 shows a quantitative assessment of ATBF1-A mRNA expression according to LOH status at the ATBF1-A locus and demonstrates that there was no relationship between them. This finding indicates that another mechanism is involved in regulating the transcriptional level of the ATBF1-A gene.

ATBF1-Anucleotide alterations in breast cancer

We next performed mutational analysis of the ATBF1-A gene to inspect whether ATBF1-A mRNA expression levels could be related with mutations succeeding to the instabilities of their transcripts. We selected all the mutational spots located in exon 9 and the most frequent deletion spot in exon 10 (Table 2), because > 80% of the mutations in the coding region of ATBF1-A gene reported in prostate cancer occurred in these locations. Twelve patients with tumors that did not demonstrate LOH at the ATBF1-A locus but with lower ATBF1-A mRNA expression were chosen as study subjects for mutational analysis. Overall, five sequence alterations, including both mutations and polymorphism, were found in the abovementioned spots in the 12 samples from these patients. Two patients had a somatic (blood sample not matched) 5602C > T mutation in one allele that did not involve amino acid substitution (i.e., synonym mutations). On the other hand, one patient had a 5602C > T blood-sample matched alteration in one allele that was reported on the dbSNP database [23]. We therefore regarded it as a single nucleotide polymorphism (SNP), as reported by Sun et al[17]. Both the remaining samples demonstrated a germ line alteration (blood-sample matched) in one allele. One of them, 8387A > G, caused a substitution of methionine for valine at codon 2572. The other alteration was a deletion (10799–10804) without frameshift. Although both gene alterations were not reported in the NCBI dbSNP and JSNP databases [24], we could not immediately rule out the possibility that these alterations were benign polymorphisms.

Relationship between LOH status of the ATBF1-Alocus and clinicopathological factors

As the reduced ATBF1-A mRNA expression levels correlated with unfavorable characteristics of tumors, ER-α- negative and lymph node metastasis, in our previous study[16], we wondered whether LOH status at ATBF1-A locus were related with clinicopathological factors as well. The results of this analysis are shown in Table 3. LOH at the ATBF1-A locus correlated with positivity of PR (P = 0.013) and negativity of HER2 (P = 0.024) status. Patients with ER-α-positive tumors were more likely to demonstrate LOH at the ATBF1-A locus than those with ER-α-negative tumors; however, the difference was not significant. Furthermore, the patients with LOH at the ATBF1-A locus more often had axillary lymph node involvement than those without LOH (P = 0.084). No relationship was observed between LOH at the ATBF1-A locus and other clinicopathological factors, such as age, tumor size, and histological grade.
Table 3
Correlation between clinicopathological factors and the LOH status at the 16q22 minimal locus
Factor
Loss of heterozygosity
Retention of heterozygosity
Total
P
Total
22 (51.2%)
21 (48.8%)
43 (100%)
 
Age (year)
    
≤ 50
7 (43.8%)
9 (56.2%)
16
NS
> 50
15 (55.6%)
12 (44.4%)
27
 
Tumor size
    
< 2.0
6 (46.2%)
7 (53.8%)
13
NS
≥ 2.0
16 (55.2%)
13 (44.8%)
29
 
Not measurable
0
1
1
 
Lymph node
    
Negative
9 (37.5%)
15 (62.5%)
24
0.084
Positive
11 (64.7%)
6 (45.3%)
17
 
Unknown
2
0
2
 
Histological grade
    
1/2
6 (60.0%)
4 (40.0%)
10
NS
3
14 (50.0%)
14 (50.0%)
28
 
Unknown
2
3
5
 
Estrogen receptor-α
    
Negative
4 (40.0%)
6 (60.0%)
10
NS
Positive
17 (54.8%)
14 (45.2%)
31
 
Unknown
1
1
2
 
Progesterone receptor
    
Negative
2 (18.2%)
9 (81.8%)
11
0.013*
Positive
16 (61.5%)
10 (38.5%)
26
 
Unknown
4
2
6
 
HER2
    
Negative
18 (60.0%)
12 (40.0%)
30
 
Positive
2 (20.0%)
8 (80.0%)
10
0.024*
Unknown
2
1
3
 
Estrogen receptor-α, progesterone receptor, and human epidermal growth factor (HER) 2 were determined histochemically.
*P < 0.05.

Discussion

Using polymorphic microsatellite markers spanning chromosome 16q22, we performed fluorescent-labeled PCR amplification and capillary electrophoresis to investigate LOH status at the 16q22 minimal region in paired specimens of blood and primary breast tumors from 127 patients. We assessed the relationship between LOH status at the ATBF1-A locus and mRNA levels of ATBF1-A, as well as the clinicopathological factors in breast cancer. Quantitative assessment of ATBF1-A mRNA expression according to LOH status at the ATBF1-A locus demonstrated no relationship between these factors. This finding completely consists with the result repoted by Kim et al., studied in hepatocellular carcinoma (HCC)[25]. We therefore concluded that a mechanism other than LOH was involved in regulating the transcriptional level of the ATBF1-A gene in breast cancer as like in HCC.
Accordingly, we screened mutations of the specific loci in the ATBF1-A gene that have previously been reported in prostate cancer [10]. The 12 tumors investigated for mutations had been predicted to have a higher frequency of gene alterations in the ATBF1-A gene, because they demonstrated lower ATBF1-A mRNA levels but showed ROH at the ATBF1-A locus (data not shown). In the mutational analyses, although none of the 12 samples studied showed somatic mutations with substitution of amino acids or frameshift, two germ line gene alterations were recorded. One of these alterations predicted a substitution of methionine for valine at codon 2572. This alteration also reported in gastric cancer as a somatic mutation at one allele, while the other allele had lost[7]. Although the gene alteration was not reported in the NCBI SNP and JSNP databases, pathogenic significance of the gene alteration was also not verified by functional assay. The remaining gene alteration produced a 6-nucleotide deletion without frameshift in glutamic acid rich domain in exon10. Although the 3 – 24 nucleotides deletions are prevalent in various kind of tumors[6, 7, 10, 26], its pathogeny is controversial among those tumors. In prostate cancer, Xu et. reported the deletions in germline and its relevance with the susceptibility to prostate cancer[26]. Contrast to that, in breast cancer, Cleton-Jansen et al. reported no association between these germline deletions and suscetability to breast cancer[6]. This indicate that these germline deletions has different impacts in the suscetabilities to these tumors. As in the present study, the deletion was also germline, they might be benign polymorphisms regarding with the susceptibility to breast cancer.
A larger case-control study compared between cancer patients and healthy individuals and functional analysis in each gene alteration should be performed to reveal their pathogenic significances in tumorigenesis. As, consequently, somatic mutations with substitution of amino acids or frameshift were not seen in these samples, we concluded that ATBF1-A mRNA levels may be regulated at the transcriptional stage, but are not regulated by genetic mechanisms, deletions (LOH), or mutations in breast cancer. Infrequent somatic mutations in ATBF1-A gene have previously been reported, except for prostate cancer. The frequencies were 8.6% in gastric cancer[7], 0% in HCC[25], 0% in breast cancer[6]. In addition, Sun et al. and Kim et al. reported infrequent methylation at ATBF1 gene promoter in breast cancer and HCC, respectively[17, 25]. Based on these reports, we speculate that the methylations at ATBF1-A gene are also not attributed to the downregulation of ATBF1-A transcripts, though we did not performed the methylation analysis.
Recently, posttranscriptional mRNA repression associated with microRNA (miRNA) have been discussed as an alternative mechanism of mRNA modulation at the posttranscriptional level in mammals as well as metazoa [27]. According to the prevailing model, posttranscriptional repression by miRNA is determined by the complementarity to the miRNA of the target mRNA[27]. Therefore, we may speculate that posttranscriptional cleavage of mRNA by miRNA-associated machinery is the molecular mechanism of ATBF1-A mRNA regulation. This may explain why there is a discrepancy between LOH status at ATBF1-A locus and ATBF1-A mRNA levels.
LOH status at the ATBF1-A locus significantly correlated with positivity of PR (P = 0.013) and negativity of HER2 (P = 0.024) status. Similar results were previously reported by Wang [28], who found that 16q23-24 genetic loss significantly correlated with ER-α positivity and HER2 negativity. These biological features, hormonal receptor positivity, and HER2 negativity, are reminiscent of the "luminal-type" tumors described by Perou et al. [29]. Based on the study by Wang [28] and the present study, a target gene at the narrowed locus spanning from 16q22 to 16q24 may determine the biological features of the luminal-type. Recent cytogenetic approaches, such as comparative genomic hybridization[30], may help reveal the new target gene at this locus in such cohorts.

Conclusion

Using polymorphic microsatellite markers spanning chromosome band 16q22, we defined LOH status at the ATBF1-A locus and performed comparative analysis between LOH and ROH groups. However, we did not find a significant correlation between LOH status at the ATBF1-A locus and ATBF1-A mRNA levels. Furthermore, we found no somatic mutations with amino acid substitution in 12 tumor samples from selected patients who were predicted to have a higher frequency of gene alterations, although two germ line alterations with the possibility of polymorphism were noted. We therefore conclude that ATBF1-A mRNA levels may be regulated at the transcriptional stage.

Acknowledgements

We thank Dr. Yoshitaka Fujii, the Department of Surgery II, Nagoya City University Medical School, for his comprehensive advice on the study, Dr. Ando Takuya for technical advice, and Ms. Mariko Nishio for technical support.
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://​creativecommons.​org/​licenses/​by/​2.​0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

K.K. performed the molecular genetic studies, participated in the LOH analysis and sequence alignment, and drafted the manuscript. Z.Z. performed the sequence alignment and scored the status of immunohistochemical staining. H.Y. was involved in the study design and scored the status of immunohistochemical staining. Y.M. was involved in the study design and assisted in drafting of the manuscript. Y.Y. and H.I. conceived the study, participated in its design and coordination, and assisted in drafting of the manuscript. All authors have read and approved the final manuscript.
Anhänge

Authors’ original submitted files for images

Literatur
1.
Zurück zum Zitat Ando Y, Iwase H, Ichihara S, Toyoshima S, Nakamura T, Yamashita H, Toyama T, Omoto Y, Karamatsu S, Mitsuyama S, Fujii Y, Kobayashi S: Loss of heterozygosity and microsatellite instability in ductal carcinoma in situ of the breast. Cancer letters. 2000, 156: 207-214. 10.1016/S0304-3835(00)00467-5.CrossRefPubMed Ando Y, Iwase H, Ichihara S, Toyoshima S, Nakamura T, Yamashita H, Toyama T, Omoto Y, Karamatsu S, Mitsuyama S, Fujii Y, Kobayashi S: Loss of heterozygosity and microsatellite instability in ductal carcinoma in situ of the breast. Cancer letters. 2000, 156: 207-214. 10.1016/S0304-3835(00)00467-5.CrossRefPubMed
2.
Zurück zum Zitat Knuutila S, Aalto Y, Autio K, Bjorkqvist AM, El-Rifai W, Hemmer S, Huhta T, Kettunen E, Kiuru-Kuhlefelt S, Larramendy ML, Lushnikova T, Monni O, Pere H, Tapper J, Tarkkanen M, Varis A, Wasenius VM, Wolf M, Zhu Y: DNA copy number losses in human neoplasms. The American journal of pathology. 1999, 155: 683-694.CrossRefPubMedPubMedCentral Knuutila S, Aalto Y, Autio K, Bjorkqvist AM, El-Rifai W, Hemmer S, Huhta T, Kettunen E, Kiuru-Kuhlefelt S, Larramendy ML, Lushnikova T, Monni O, Pere H, Tapper J, Tarkkanen M, Varis A, Wasenius VM, Wolf M, Zhu Y: DNA copy number losses in human neoplasms. The American journal of pathology. 1999, 155: 683-694.CrossRefPubMedPubMedCentral
3.
Zurück zum Zitat Vos CB, ter Haar NT, Rosenberg C, Peterse JL, Cleton-Jansen AM, Cornelisse CJ, Vijver dan de MJ: Genetic alterations on chromosome 16 and 17 are important features of ductal carcinoma in situ of the breast and are associated with histologic type. British journal of cancer. 1999, 81: 1410-1418. 10.1038/sj.bjc.6693372.CrossRefPubMedPubMedCentral Vos CB, ter Haar NT, Rosenberg C, Peterse JL, Cleton-Jansen AM, Cornelisse CJ, Vijver dan de MJ: Genetic alterations on chromosome 16 and 17 are important features of ductal carcinoma in situ of the breast and are associated with histologic type. British journal of cancer. 1999, 81: 1410-1418. 10.1038/sj.bjc.6693372.CrossRefPubMedPubMedCentral
4.
Zurück zum Zitat Bieche I, Lidereau R: Genetic alterations in breast cancer. Genes, chromosomes & cancer. 1995, 14: 227-251. 10.1002/gcc.2870140402.CrossRef Bieche I, Lidereau R: Genetic alterations in breast cancer. Genes, chromosomes & cancer. 1995, 14: 227-251. 10.1002/gcc.2870140402.CrossRef
5.
Zurück zum Zitat Cleton-Jansen AM, Callen DF, Seshadri R, Goldup S, McCallum B, Crawford J, Powell JA, Settasatian C, van Beerendonk H, Moerland EW, Smit VT, Harris WH, Millis R, Morgan NV, Barnes D, Mathew CG, Cornelisse CJ: Loss of heterozygosity mapping at chromosome arm 16q in 712 breast tumors reveals factors that influence delineation of candidate regions. Cancer Res. 2001, 61: 1171-1177.PubMed Cleton-Jansen AM, Callen DF, Seshadri R, Goldup S, McCallum B, Crawford J, Powell JA, Settasatian C, van Beerendonk H, Moerland EW, Smit VT, Harris WH, Millis R, Morgan NV, Barnes D, Mathew CG, Cornelisse CJ: Loss of heterozygosity mapping at chromosome arm 16q in 712 breast tumors reveals factors that influence delineation of candidate regions. Cancer Res. 2001, 61: 1171-1177.PubMed
6.
Zurück zum Zitat Cleton-Jansen AM, van Eijk R, Lombaerts M, Schmidt MK, Van't Veer LJ, Philippo K, Zimmerman RM, Peterse JL, Smit VT, van Wezel T, Cornelisse CJ: ATBF1 and NQO1 as candidate targets for allelic loss at chromosome arm 16q in breast cancer: absence of somatic ATBF1 mutations and no role for the C609T NQO1 polymorphism. BMC Cancer. 2008, 8: 105-10.1186/1471-2407-8-105.CrossRefPubMedPubMedCentral Cleton-Jansen AM, van Eijk R, Lombaerts M, Schmidt MK, Van't Veer LJ, Philippo K, Zimmerman RM, Peterse JL, Smit VT, van Wezel T, Cornelisse CJ: ATBF1 and NQO1 as candidate targets for allelic loss at chromosome arm 16q in breast cancer: absence of somatic ATBF1 mutations and no role for the C609T NQO1 polymorphism. BMC Cancer. 2008, 8: 105-10.1186/1471-2407-8-105.CrossRefPubMedPubMedCentral
7.
Zurück zum Zitat Cho YG, Song JH, Kim CJ, Lee YS, Kim SY, Nam SW, Lee JY, Park WS: Genetic alterations of the ATBF1 gene in gastric cancer. Clin Cancer Res. 2007, 13: 4355-4359. 10.1158/1078-0432.CCR-07-0619.CrossRefPubMed Cho YG, Song JH, Kim CJ, Lee YS, Kim SY, Nam SW, Lee JY, Park WS: Genetic alterations of the ATBF1 gene in gastric cancer. Clin Cancer Res. 2007, 13: 4355-4359. 10.1158/1078-0432.CCR-07-0619.CrossRefPubMed
8.
Zurück zum Zitat Berx G, Cleton-Jansen AM, Nollet F, de Leeuw WJ, Vijver van de M, Cornelisse C, van Roy F: E-cadherin is a tumour/invasion suppressor gene mutated in human lobular breast cancers. Embo J. 1995, 14: 6107-6115.PubMedPubMedCentral Berx G, Cleton-Jansen AM, Nollet F, de Leeuw WJ, Vijver van de M, Cornelisse C, van Roy F: E-cadherin is a tumour/invasion suppressor gene mutated in human lobular breast cancers. Embo J. 1995, 14: 6107-6115.PubMedPubMedCentral
9.
Zurück zum Zitat Yamada K, Miura Y, Scheidl T, Yoshida MC, Tamaoki T: Assignment of the human ATBF1 transcription factor gene to chromosome 16q22.3-q23.1. Genomics. 1995, 29: 552-553. 10.1006/geno.1995.9967.CrossRefPubMed Yamada K, Miura Y, Scheidl T, Yoshida MC, Tamaoki T: Assignment of the human ATBF1 transcription factor gene to chromosome 16q22.3-q23.1. Genomics. 1995, 29: 552-553. 10.1006/geno.1995.9967.CrossRefPubMed
10.
Zurück zum Zitat Sun X, Frierson HF, Chen C, Li C, Ran Q, Otto KB, Cantarel BL, Vessella RL, Gao AC, Petros J, Miura Y, Simons JW, Dong JT: Frequent somatic mutations of the transcription factor ATBF1 in human prostate cancer. Nat Genet. 2005, 37: 407-412. 10.1038/ng1528.CrossRefPubMed Sun X, Frierson HF, Chen C, Li C, Ran Q, Otto KB, Cantarel BL, Vessella RL, Gao AC, Petros J, Miura Y, Simons JW, Dong JT: Frequent somatic mutations of the transcription factor ATBF1 in human prostate cancer. Nat Genet. 2005, 37: 407-412. 10.1038/ng1528.CrossRefPubMed
11.
Zurück zum Zitat Morinaga T, Yasuda H, Hashimoto T, Higashio K, Tamaoki T: A human alpha-fetoprotein enhancer-binding protein, ATBF1, contains four homeodomains and seventeen zinc fingers. Mol Cell Biol. 1991, 11: 6041-6049.CrossRefPubMedPubMedCentral Morinaga T, Yasuda H, Hashimoto T, Higashio K, Tamaoki T: A human alpha-fetoprotein enhancer-binding protein, ATBF1, contains four homeodomains and seventeen zinc fingers. Mol Cell Biol. 1991, 11: 6041-6049.CrossRefPubMedPubMedCentral
12.
Zurück zum Zitat Yasuda H, Mizuno A, Tamaoki T, Morinaga T: ATBF1, a multiple-homeodomain zinc finger protein, selectively down-regulates AT-rich elements of the human alpha-fetoprotein gene. Mol Cell Biol. 1994, 14: 1395-1401.CrossRefPubMedPubMedCentral Yasuda H, Mizuno A, Tamaoki T, Morinaga T: ATBF1, a multiple-homeodomain zinc finger protein, selectively down-regulates AT-rich elements of the human alpha-fetoprotein gene. Mol Cell Biol. 1994, 14: 1395-1401.CrossRefPubMedPubMedCentral
13.
Zurück zum Zitat Kataoka H, Miura Y, Joh T, Seno K, Tada T, Tamaoki T, Nakabayashi H, Kawaguchi M, Asai K, Kato T, Itoh M: Alpha-fetoprotein producing gastric cancer lacks transcription factor ATBF1. Oncogene. 2001, 20: 869-873. 10.1038/sj.onc.1204160.CrossRefPubMed Kataoka H, Miura Y, Joh T, Seno K, Tada T, Tamaoki T, Nakabayashi H, Kawaguchi M, Asai K, Kato T, Itoh M: Alpha-fetoprotein producing gastric cancer lacks transcription factor ATBF1. Oncogene. 2001, 20: 869-873. 10.1038/sj.onc.1204160.CrossRefPubMed
14.
Zurück zum Zitat Kaspar P, Dvorakova M, Kralova J, Pajer P, Kozmik Z, Dvorak M: Myb-interacting protein, ATBF1, represses transcriptional activity of Myb oncoprotein. J Biol Chem. 1999, 274: 14422-14428. 10.1074/jbc.274.20.14422.CrossRefPubMed Kaspar P, Dvorakova M, Kralova J, Pajer P, Kozmik Z, Dvorak M: Myb-interacting protein, ATBF1, represses transcriptional activity of Myb oncoprotein. J Biol Chem. 1999, 274: 14422-14428. 10.1074/jbc.274.20.14422.CrossRefPubMed
15.
Zurück zum Zitat Kataoka H, Bonnefin P, Vieyra D, Feng X, Hara Y, Miura Y, Joh T, Nakabayashi H, Vaziri H, Harris CC, Riabowol K: ING1 represses transcription by direct DNA binding and through effects on p53. Cancer Res. 2003, 63: 5785-5792.PubMed Kataoka H, Bonnefin P, Vieyra D, Feng X, Hara Y, Miura Y, Joh T, Nakabayashi H, Vaziri H, Harris CC, Riabowol K: ING1 represses transcription by direct DNA binding and through effects on p53. Cancer Res. 2003, 63: 5785-5792.PubMed
16.
Zurück zum Zitat Zhang Z, Yamashita H, Toyama T, Sugiura H, Ando Y, Mita K, Hamaguchi M, Kawaguchi M, Miura Y, Iwase H: ATBF1-a messenger RNA expression is correlated with better prognosis in breast cancer. Clin Cancer Res. 2005, 11: 193-198.PubMed Zhang Z, Yamashita H, Toyama T, Sugiura H, Ando Y, Mita K, Hamaguchi M, Kawaguchi M, Miura Y, Iwase H: ATBF1-a messenger RNA expression is correlated with better prognosis in breast cancer. Clin Cancer Res. 2005, 11: 193-198.PubMed
17.
Zurück zum Zitat Sun X, Zhou Y, Otto KB, Wang M, Chen C, Zhou W, Subramanian K, Vertino PM, Dong JT: Infrequent mutation of ATBF1 in human breast cancer. J Cancer Res Clin Oncol. 2007, 133: 103-105. 10.1007/s00432-006-0148-y.CrossRefPubMed Sun X, Zhou Y, Otto KB, Wang M, Chen C, Zhou W, Subramanian K, Vertino PM, Dong JT: Infrequent mutation of ATBF1 in human breast cancer. J Cancer Res Clin Oncol. 2007, 133: 103-105. 10.1007/s00432-006-0148-y.CrossRefPubMed
18.
Zurück zum Zitat Elston CW, Ellis IO: Pathological prognostic factors in breast cancer. I. The value of histological grade in breast cancer: experience from a large study with long-term follow-up. Histopathology. 1991, 19: 403-410. 10.1111/j.1365-2559.1991.tb00229.x.CrossRefPubMed Elston CW, Ellis IO: Pathological prognostic factors in breast cancer. I. The value of histological grade in breast cancer: experience from a large study with long-term follow-up. Histopathology. 1991, 19: 403-410. 10.1111/j.1365-2559.1991.tb00229.x.CrossRefPubMed
19.
Zurück zum Zitat Yamashita T, Iwase H, Yamashita i, Iwata H, Ito K, Toyama T, Hara Y, Kobayashi S: Low Frequency Loss of Heterozygosity in the BRCA1 Region in Japanese Sporadic Breast Cancer. Breast Cancer. 1996, 3: 167-172.CrossRefPubMed Yamashita T, Iwase H, Yamashita i, Iwata H, Ito K, Toyama T, Hara Y, Kobayashi S: Low Frequency Loss of Heterozygosity in the BRCA1 Region in Japanese Sporadic Breast Cancer. Breast Cancer. 1996, 3: 167-172.CrossRefPubMed
21.
Zurück zum Zitat Zhang Z, Yamashita H, Toyama T, Omoto Y, Sugiura H, Hara Y, Wu X, Kobayashi S, Iwase H: Quantitative determination, by real-time reverse transcription polymerase chain reaction, of aromatase mRNA in invasive ductal carcinoma of the breast. Breast Cancer Res. 2003, 5: R250-256. 10.1186/bcr657.CrossRefPubMedPubMedCentral Zhang Z, Yamashita H, Toyama T, Omoto Y, Sugiura H, Hara Y, Wu X, Kobayashi S, Iwase H: Quantitative determination, by real-time reverse transcription polymerase chain reaction, of aromatase mRNA in invasive ductal carcinoma of the breast. Breast Cancer Res. 2003, 5: R250-256. 10.1186/bcr657.CrossRefPubMedPubMedCentral
22.
Zurück zum Zitat Harvey JM, Clark GM, Osborne CK, Allred DC: Estrogen receptor status by immunohistochemistry is superior to the ligand-binding assay for predicting response to adjuvant endocrine therapy in breast cancer. J Clin Oncol. 1999, 17: 1474-1481.PubMed Harvey JM, Clark GM, Osborne CK, Allred DC: Estrogen receptor status by immunohistochemistry is superior to the ligand-binding assay for predicting response to adjuvant endocrine therapy in breast cancer. J Clin Oncol. 1999, 17: 1474-1481.PubMed
25.
Zurück zum Zitat Kim CJ, Song JH, Cho YG, Cao Z, Lee YS, Nam SW, Lee JY, Park WS: Down-regulation of ATBF1 is a major inactivating mechanism in hepatocellular carcinoma. Histopathology. 2008, 52: 552-559. 10.1111/j.1365-2559.2008.02980.x.CrossRefPubMed Kim CJ, Song JH, Cho YG, Cao Z, Lee YS, Nam SW, Lee JY, Park WS: Down-regulation of ATBF1 is a major inactivating mechanism in hepatocellular carcinoma. Histopathology. 2008, 52: 552-559. 10.1111/j.1365-2559.2008.02980.x.CrossRefPubMed
26.
Zurück zum Zitat Xu J, Sauvageot J, Ewing CM, Sun J, Liu W, Isaacs SD, Wiley KE, Diaz L, Zheng SL, Walsh PC, Isaacs WB: Germline ATBF1 mutations and prostate cancer risk. Prostate. 2006, 66: 1082-1085. 10.1002/pros.20430.CrossRefPubMed Xu J, Sauvageot J, Ewing CM, Sun J, Liu W, Isaacs SD, Wiley KE, Diaz L, Zheng SL, Walsh PC, Isaacs WB: Germline ATBF1 mutations and prostate cancer risk. Prostate. 2006, 66: 1082-1085. 10.1002/pros.20430.CrossRefPubMed
27.
Zurück zum Zitat Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004, 116: 281-297. 10.1016/S0092-8674(04)00045-5.CrossRefPubMed Bartel DP: MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004, 116: 281-297. 10.1016/S0092-8674(04)00045-5.CrossRefPubMed
28.
Zurück zum Zitat Wang ZC, Lin M, Wei LJ, Li C, Miron A, Lodeiro G, Harris L, Ramaswamy S, Tanenbaum DM, Meyerson M, Iglehart JD, Richardson A: Loss of heterozygosity and its correlation with expression profiles in subclasses of invasive breast cancers. Cancer Res. 2004, 64: 64-71. 10.1158/0008-5472.CAN-03-2570.CrossRefPubMed Wang ZC, Lin M, Wei LJ, Li C, Miron A, Lodeiro G, Harris L, Ramaswamy S, Tanenbaum DM, Meyerson M, Iglehart JD, Richardson A: Loss of heterozygosity and its correlation with expression profiles in subclasses of invasive breast cancers. Cancer Res. 2004, 64: 64-71. 10.1158/0008-5472.CAN-03-2570.CrossRefPubMed
29.
Zurück zum Zitat Perou CM, Sorlie T, Eisen MB, Rijn van de M, Jeffrey SS, Rees CA, Pollack JR, Ross DT, Johnsen H, Akslen LA, Fluge O, Pergamenschikov A, Williams C, Zhu SX, Lonning PE, Borresen-Dale AL, Brown PO, Botstein D: Molecular portraits of human breast tumours. Nature. 2000, 406: 747-752. 10.1038/35021093.CrossRefPubMed Perou CM, Sorlie T, Eisen MB, Rijn van de M, Jeffrey SS, Rees CA, Pollack JR, Ross DT, Johnsen H, Akslen LA, Fluge O, Pergamenschikov A, Williams C, Zhu SX, Lonning PE, Borresen-Dale AL, Brown PO, Botstein D: Molecular portraits of human breast tumours. Nature. 2000, 406: 747-752. 10.1038/35021093.CrossRefPubMed
Metadaten
Titel
Loss of heterozygosity at the ATBF1-A locus located in the 16q22 minimal region in breast cancer
verfasst von
Kazuharu Kai
Zhenhuan Zhang
Hiroko Yamashita
Yutaka Yamamoto
Yutaka Miura
Hirotaka Iwase
Publikationsdatum
01.12.2008
Verlag
BioMed Central
Erschienen in
BMC Cancer / Ausgabe 1/2008
Elektronische ISSN: 1471-2407
DOI
https://doi.org/10.1186/1471-2407-8-262

Weitere Artikel der Ausgabe 1/2008

BMC Cancer 1/2008 Zur Ausgabe

Umsetzung der POMGAT-Leitlinie läuft

03.05.2024 DCK 2024 Kongressbericht

Seit November 2023 gibt es evidenzbasierte Empfehlungen zum perioperativen Management bei gastrointestinalen Tumoren (POMGAT) auf S3-Niveau. Vieles wird schon entsprechend der Empfehlungen durchgeführt. Wo es im Alltag noch hapert, zeigt eine Umfrage in einem Klinikverbund.

CUP-Syndrom: Künstliche Intelligenz kann Primärtumor finden

30.04.2024 Künstliche Intelligenz Nachrichten

Krebserkrankungen unbekannten Ursprungs (CUP) sind eine diagnostische Herausforderung. KI-Systeme können Pathologen dabei unterstützen, zytologische Bilder zu interpretieren, um den Primärtumor zu lokalisieren.

Sind Frauen die fähigeren Ärzte?

30.04.2024 Gendermedizin Nachrichten

Patienten, die von Ärztinnen behandelt werden, dürfen offenbar auf bessere Therapieergebnisse hoffen als Patienten von Ärzten. Besonders gilt das offenbar für weibliche Kranke, wie eine Studie zeigt.

Adjuvante Immuntherapie verlängert Leben bei RCC

25.04.2024 Nierenkarzinom Nachrichten

Nun gibt es auch Resultate zum Gesamtüberleben: Eine adjuvante Pembrolizumab-Therapie konnte in einer Phase-3-Studie das Leben von Menschen mit Nierenzellkarzinom deutlich verlängern. Die Sterberate war im Vergleich zu Placebo um 38% geringer.

Update Onkologie

Bestellen Sie unseren Fach-Newsletter und bleiben Sie gut informiert.