Methylation of WTH3, a possible drug resistant gene, inhibits p53 regulated expression

MCF7/AdrR and MCF7/WT were grown at 37°C with 5% CO₂ in DMEM medium with 10% FCS, 100 μg/ml streptomycin and 100 U/ml penicillin. HEK293 (human primary embryonic kidney cells, ATCC.) and Hela cells were grown at 37°C with 5% CO₂ in RPMI 1640 culture medium with 10% FCS, 100 μg/ml streptomycin and 100 U/ml penicillin. To determine the influence of DNA methylation on p53 activity as it pertains to endogenous WTH3 gene expression, MCF7/AdrR cells were treated with 5-aza at 50 μM (this high concentration used was due to that the MCF7/Adr cell line was extremely drug resistant, whose IC50 was 975 nM, while MCF7/WT's IC50 was 1.25 nM[10]) for 24 and 72 hours, while Hela cells were treated with 5-aza at 5 μM for 24 hours.

Detailed information about generating the full length WTH3 promoter in pGL3 to obtain the pGL/WTH3P construct and its deletion mutant with activity in pGL3 to generate the pGL/WTH3d3 construct were previously described [9, 15]. Wild type p53 in pcDNA/P53 and the mutated p53 gene in pcDNA/P53R249S, which did not contain trans-element-activity, were gifts from Dr. Moll M. Ute.

The WTH3 shRNA oligos, GATCCGTCAGGCAATAATTGGCATTGATTCAAGAGATCAATGCCAATTATTGCCTGACTTTTTTACGCGTG (sense) and AATTCACGCGTAAAAAAGTCAGGCAATAATTGGCATTGATCTCTTGAATCAATGCCAATTATTGCCTGACG (anti-sense) ending with BamH I and EcoR I restriction enzyme ends, were cloned into the pSIEN-RetroQ vector to obtain pSIEN-RetroQWTH3 according to the Clontech Knockout RNAi User Manual (PT3739-1). The infection procedure was performed based on the Clontech Retroviral Gene Transfer and Expression User Manual (PT3132-1). Briefly, pSIEN-RetroQWTH3 or pSIEN-RetroQ (negative control) along with the envelope vector, pAmpho were co-transfected into the GP2-293 packaging cell line via the phosphate calcium method. Viral supernatant was collected and centrifuged at 500 × g for 10 min to remove the cellular debris. The supernatant was then used to infect HEK293 cells. The cells with integrated WTH3 shRNA sequences were selected by adding 0.5 μg/ml puromycin into the medium for 2 weeks. The limiting dilution procedure was performed as previously described [9] to obtain individual HEK293 clones that were either integrated with pSIEN-RetroQWTH3 or pSIEN-RetroQ.

Total RNAs were isolated from cell lines treated with 5-aza, transfectants and the corresponding negative controls by the High Pure RNA Isolation Kit (Roche). SQRT-PCR was performed using the Titan One Tube RT-PCR system based on the manufacturer's protocol (Roche). The sense and anti-sense primers for WTH3, MDR1 and GAPDH were previously described [9]. The sense and anti-sense primers for WTH3 were 5'-GATGGAACAATCGGGCTTCG-3' and 5'-GCTGCTACACGTCGAAAGAGC-3'. The sense and anti-sense primers for MDR1 were 5'-CCTATCATTGCAATAGCAGG-3' and 5'-GTTCAAACTTCTGCTCCTGA-3'. The length of the WTH3 and MDR1 PCR product was 341 and 167 bps, respectively. The SQRT-PCR assay for each gene of interest was performed more than three times. The PCR and quantification of PCR products were performed as noted [9, 10, 15, 23].

MTT assays were carried out as described [9, 10]. Briefly, 2 × 10³ cells/well were seeded in a 96-well plate and grown overnight. The cells were treated with serial concentrations of Dox (0 to 1 μg). In 6 days, the cells were then stained with 3- [4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT). IC50 (IC50 values represent Dox concentrations that cause 50% cell death) was quantitatively measured at 595 nm by the program software, EZ-ED50 Version 1.1 (Perrella Scientific Inc,) in a micro-plate spectrophotometer (Benchmark Plus, BIO-RAD).

To methylate the CpG sites in pGL/WTH3P and pGL/WTH3d3 plasmids, 2 μg of each construct was incubated with 12 U CpG methylase Sss I and 640 μM of S-adenosylmethionine (SAM) (New England Biolab) at 37°C for 3 hr. The temperature was then increased to 65°C for 20 min to terminate the reactions. The methylated plasmids, pGL/WTH3P^m and pGL/WTH3Pd3^m, were purified with the Qiaquick PCR Purification Kit (Qiagen). The success of Sss I methylation was verified by methylation sensitive restrictive enzymes, Hha I and Hpa II.

To determine whether the methylated WTH3 promoter influenced p53 transcriptional activity, pGL/WTH3P^m versus pGL/WTH3P and pGL/WTH3Pd3^m versus pGL/WTH3Pd3 were co-transfected with pcDNA/P53, pcDNA/P53R249S (negative control) or pcDNA/3.1 (negative control) into HEK293 cells. In brief, 0.2 μg of each construct were transfected along with 0.1 μg of pCMV/β-galactosidase when the cells (seeded onto 24-well plates) reached 50–70% confluence. After 24 hrs, luciferase and β-galactosidase activity was measured using the Luciferase Assay System and Beta-Glo™Assay System (Promega) according to the manufacturer's instruction. Luciferase activities of transfectants were compared after normalizing their β-galactosidase activities and protein concentrations.

Earlier studies suggested that WTH3 was involved in MDR development[9, 23]. To further confirm this possibility, we decided to knockdown the WTH3 gene in HEK293 cells to see if reduced gene expression could increase the host cells' resistance to an anti-cancer drug, such as Dox. To do so, we employed the Clontech Knockout RNAi system to integrate a DNA sequence, which specifically interfered with the endogenous WTH3 transcripts, into the host cells' genome (see Materials and Methods for details). After antibiotic selection, RNAs were extracted from the cells infected with pSIEN-RetroQWTH3 or pSIEN-RetroQ (negative control), and quantified by SQRT-PCR. The results obtained from the three individual measurements showed that WTH3 transcripts in the cells infected with pSIEN-RetroQWTH3 (293/WTH3RNAi-P) were about 2 times lower than that in the control cells containing the empty vector (Fig. 1A, 1B). Therefore, the WTH3 gene was successfully knockdown in the HEK293 cell population. We then selected several individual cell clones via limiting dilution procedures. Consequently, we obtained 7 clones whose WTH3 expression was significantly lower due to the knockdown and 6 clones whose genome was integrated with the empty vector, but did not change WTH3 expression levels (Fig. 1A, 1B). The populations and three cloned cell lines, 293/WTH3RNAi-2, -3, -6, which were randomly picked, were used to perform MTT assays to obtain IC50s (the concentration of a drug that causes 50% cell death) to Dox. The results were an average of three individual experiments for each group. The IC50 value of the 293/WTH3RNAi-P cells was about 39 nM, while that of the control was about 13 nM. Clearly, the reduction of WTH3 gene expression made the host 3 times more resistance to Dox than its control, 293-V (Fig. 2A, 2B). Next, IC50s of the three cloned lines, 293/WTH3RNAi-2, -3 and -6 were also evaluated. The IC50 values to Dox were 44, 93, and 52 nM for 293/WTH3RNAi-2, -3 and -6, respectively, which were approximately 3.4, 7 and 4 times more resistance than the 293-V control (Fig. 2A, 2B, Table 1). Moreover, due to past findings that suggested a reverse correlation between WTH3 and MDR1 gene expression levels [23], we examined MDR1 gene expression levels in those cells by SQRT-PCR. As we expected, the results showed that the MDR1 gene was re-activated in the 293/WTH3RNAi-P, 293/WTH3RNAi-2, -3 and -6 cells, while MDR1 transcripts were undetectable in the corresponding control cells (Fig. 3A, 3B).

Prior studies demonstrated that the CpG island found in the WTH3 gene promoter was targeted by DNA methylation in MCF7/AdrR cells [15, 23]. It was also discovered that this island contained p53M, which was directly bound by the p53 protein, a trans-element for activating WTH3 gene expression [24]. Based on these facts we speculated that DNA methylation could play an antagonistic role influencing the p53 transcription factor. To test this hypothesis, we transfected the pcDNA/P53 or pcDNA3.1 (negative control) construct into MCF7/AdrR cells (whose CpG island in the WTH3 promoter was methylated and p53 defective due to a mini-deletion) [32], and then treated the transfectants with 5-aza to see if the p53 transgene preferentially activated the WTH3 gene expression, but not in the untreated cells. After 24 and 72 hours of treatment, endogenous WTH3 transcript levels were evaluated by SQRT-PCR. We found that the p53 transgene's positive effect on the WTH3 gene expression of the cells treated with 5-aza was about 2 times stronger than that in the control cells who either contained the transgene or the empty vector, but were not treated with 5-aza (Fig. 4A, 4B). This suggested that DNA methylation could negatively affect p53 transactivity. In addition, as we expected, the 5-aza treat alone increased WTH3 transcript. Considering that Hela cells express a relatively low level of WTH3 and a relatively high IC50 value to Dox (data not shown), we introduced p53 transgene into those cells or treated them with 5-aza. It was observed that the p53 transgene and 5-aza positively affected the WTH3 expression of the cells compared to the untreated cells (Fig. 4C, 4D). These results further indicated that epigenetic modification and p53 regulated the WTH3 gene. To verify if DNA methylation could negatively affect p53 transactivity, the in vitro DNA methylation approach was employed to modify full length and deleted WTH3 promoters to analyzed p53's influence.

To methylate full length and deleted WTH3 promoters, pGL/WTH3P and pGL/WTH3d3 were incubated with Sss I methylases and SAM. The resulting construct, pGL/WTH3P^m and pGL/WTH3d3^m, their non-methylated controls, as well pCMV/β-galactosidase (transfection efficiency control) were then introduced into HEK293 cells. As we assumed, luciferase activities driven by both methylated promoters were 5 times lower than the corresponding controls (Fig. 5). Clearly, DNA methylation inhibited the promoters' function. We then co-transfected pGL/WTH3P^m versus pGL/WTH3P and pGL/WTH3d3^m versus pGL/WTH3d3 with pcDNA/P53, or pcDNA/P53R249S (negative control), or pcDNA3.1 (negative control) into HEK293 cells to see if DNA methylation could antagonize p53 transactivity. The results showed that the p53 transgene only activated the non-methylated WTH3P and WTH3d3 promoters but had no effect on their methylated counterparts (Fig. 5). However, mutated p53, p53R249S, was unable to influence non-methylated WTH3P and WTH3d3 promoters. These findings indicated that there was interplay between DNA methylation and the p53 transcription factor regarding WTH3 gene expression regulation.