Background
Methods
Establishment of diabetic model
Intracoronary stenting and IVUS imaging
Image analysis
Histological assessment
Determination of inflammatory factors
Target gene | Forward primer (5'-3') | Reverse primer(5'-3') |
TNF-α | ggctgtacctcatctactcc | cagcaaagtccagatagtcg |
IL-1β | gatgaggagtatgagagcga | gacaggcttatgttctgcttg |
IL-6 | gtgagaagtatgagaagtgtga | gcaggatgagaatgatctttg |
GAPDH | acgaccatggagaaggctg | tcgtacgaggaaatgagct |
Statistical analysis
Results
Procedural characteristics
Diabetic group (n = 15) | Control group (n = 15) | |
---|---|---|
LAD | 14 | 13 |
LCX | 3 | 4 |
RCA | 13 | 13 |
Reference vessel diameter (mm) | 2.59 ± 0.32 | 2.71 ± 0.27 |
Stent deploy pressure(atm) | 13.4 ± 3.0 | 14.5 ± 3.7 |
Final MLD(mm) | 3.04 ± 0.30 | 3.18 ± 0.22 |
Stent to vessel ratio | 1.11 ± 0.12 | 1.18 ± 0.05 |
Angiographic and IVUS features
Diabetic group (n = 15) | Control group (n = 15) | |
---|---|---|
In-stent MLD(mm) | 2.45 ± 0.32* | 2.82 ± 0.21 |
In-segment MLD(mm) | 2.43 ± 0.29* | 2.79 ± 0.27 |
In-stent DS(%) | 40.4 ± 24.0* | 20.2 ± 17.7 |
In-segment DS(%) | 43.1 ± 23.9* | 21.3 ± 15.7 |
In-stent LL(mm) | 0.33 ± 0.19* | 0.10 ± 0.09 |
In-segment LL(mm) | 0.31 ± 0.18* | 0.10 ± 0.15 |
In-stent restenosis > 50% (number of stent) | 6 | 2 |
Neointimal volume(mm3) | 21.9 ± 18.7** | 3.87 ± 2.89 |
%IH | 26.7 ± 19.2** | 7.3 ± 6.1 |
Histological findings
Diabetic group (n = 15) | Control group (n = 15) | |
---|---|---|
IS | 1.68 ± 0.19 | 1.73 ± 0.13 |
Lumen area(mm2) | 4.47 ± 2.56* | 5.85 ± 2.07 |
Area within IEL(mm2) | 6.19 ± 0.93 | 6.23 ± 1.01 |
Neointimal area(mm2) | 1.59 ± 0.76 * | 0.41 ± 0.18 |
MIT(mm) | 1.24 ± 0.76* | 0.59 ± 0.28 |