Background
Microglia, the resident macrophages of the nervous system, have important roles in immune regulation [
1,
2] and neuronal homeostasis [
3,
4]. Microglia belong to the mononuclear phagocyte system but their special localization in the fragile neuronal environment and their morphological features clearly distinguish them from other peripheral macrophages [
5]. Ramified microglia perform a very active and continous surveillance function with their long protrusions [
6,
7]. They receive permanent tonic inhibitory inputs from neurons to prevent microglial neurotoxicity [
8,
9]. Loss of microglia-neuron cross-talk [
10], local danger signals such as extracellular ATP [
11], or neurotransmitter gradients [
12] rapidly lead to a functional transformation of ramified microglia with a variety of effector functions.
Microglia activation is a protective mechanism regulating tissue repair and recovery in the early phase of neurodegeneration [
4]. However, excessive or sustained activation of microglia often contributes to acute and chronic neuro-inflammatory responses in the brain and the retina [
2]. Activated microglia in the vicinity of degenerating neurons have been identified in a broad spectrum of neurodegenerative disorders including Alzheimer's disease [
13], Parkinson's disease [
14], amyotrophic lateral sclerosis [
15], multiple sclerosis [
16], and inherited photoreceptor dystrophies [
17,
18].
Macrophage heterogeneity and plasticity is very large and the set of marker combinations and sub-populations is essentially infinite [
19]. To define a simplified conceptual framework, classification into polarized functional categories, called M1 and M2 macrophages has been proposed [
20,
21]. M1 or "classically activated" macrophages produce high levels of oxidative metabolites and pro-inflammatory cytokines but also cause damage to healthy tissue as side effect [
22]. M2 or "alternatively activated" macrophages promote tissue remodeling and generally suppress destructive immune reactions. Informations on microglial subsets in the nervous system are relatively scarce compared to other tissue macrophages. Nevertheless, recent findings from
in vitro cultures of the murine microglial cell line MMGT12 [
23] and hippocampal microglia from the PS1xAPP Alzheimer's mouse model [
24] implicate that microglia have the ability to differentiate into M1 and M2 polarized phenotypes. A co-existence of neurotoxic M1 microglia and regenerative M2 microglia has been recently documented in the injured mouse spinal cord [
25]. Microarray-based quantitation of M1 and M2 markers as well as functional tests on axonal regrowth after injury demonstrated that a transient anti-inflammatory and neuroprotective M2 response was rapidly overwhelmed by a neurotoxic M1 microglial response [
25]. A similar but age-dependent switch from alternative to classical activation was shown in PS1xAPP Alzheimer's mice [
24], indicating a common phenomenon in neurodegenerative disorders. Compounds that induce the switch of microglia from inflammatory M1 type to anti-inflammatory M2 type could therefore be a potential therapeutic agent to attenuate neuronal inflammation and boost neuronal recovery [
26].
Several anti-inflammatory drugs have been shown to diminish neuroinflammation, but only a few direct functional effects on microglial activity have been elucidated [
27]. Among the naturally occuring immuno-modulators, the flavonoid luteolin (3',4',5,7-tetrahydroxyflavone), abundant in parsley, green pepper, celery, perilla leaf, and chamomile tea, exerts prominent anti-inflammatory and anti-oxidant activities [
28]. Luteolin suppressed pro-inflammatory cytokine production in macrophages by blocking nuclear factor kappa B (NFkB) and activator protein 1 (AP1) signaling pathways [
29] and inhibited the production of nitric oxide [
30] and pro-inflammatory eicosanoids [
31]. Luteolin also diminshed the release of Tnf and superoxide anions in LPS or interferon-γ treated microglial cell cultures [
32,
33] and reduced the LPS-induced Il6 production in brain microglia
in vivo [
34].
Although the inhibitory function of luteolin on NFkB and a few selected cytokines is well documented in macrophages, a genome-wide search for further molecular targets in microglia has not yet been published. Furthermore, the immuno-modulatory effects of luteolin related to the stimulation of distinct functional microglial phenotypes has not been investigated before. Therefore, this study investigated the global transcriptomic effects of luteolin at near physiological concentrations [
35] alone or in combination with LPS in pure BV-2 microglial cultures. We further validated the luteolin-regulated expression of novel pro- and anti-inflammtory microglial transcripts, analyzed microglial morphology, and studied the consequences of microglia-conditioned media for photoreceptor viability.
Methods
Reagents
Luteolin (3',4',5,7-tetrahydroxyflavone) and E. coli 0111:B4 lipopolysaccharide were purchased from Sigma Aldrich (Steinheim, Germany). Luteolin was dissolved in DMSO and added in concentrations that did not exceed 0.05% of the total volume in any of the cell culture experiments.
Animals
C57BL/6 mice were purchased from Charles River Laboratories. Mice were kept in an air-conditioned barrier environment at constant temperature of 20-22°C on a 12-h light-dark schedule, and had free access to food and water. The health of the animals was regularly monitored, and all procedures were approved by the University of Regensburg animal rights committee and complied with the German Law on Animal Protection and the Institute for Laboratory Animal Research Guide for the Care and Use of Laboratory Animals, 1999.
Cell culture
Brain microglia were isolated and cultured as described earlier [
36]. BV-2 microglia-like cells were provided by Professor Ralph Lucius (Clinic of Neurology, Christian Albrechts University, Kiel, Germany). BV-2 cells were cultured in RPMI/5% FCS supplemented with 2 mM L-Glutamine and 195 nM β-mercaptoethanol. Primary brain microglia or BV-2 cells were stimulated with 10 ng/ml or 50 ng/ml LPS and various concentrations of luteolin for 24 h. 661W photoreceptor-like cells were a gift from Prof. Muayyad Al-Ubaidi (University of Illinois, Chicago, IL) and the culture conditions have been described elsewhere [
36].
Phalloidin staining
BV-2 cells were plated overnight on coverslips, fixed with 3.7% paraformaldehyde for 10 min at 37°C, permeabilized with 0.2% Triton X-100 for 5 min, blocked with 5% non-fat milk, 0.2% Triton X-100, and stained with DAPI for 10 min at room temperature (0.1 μg/ml in PBS, 4',6-diamidino-2-phenylindol, Molecular Probes). Filamentous actin was stained by addition of 1.5 μM TRITC-conjugated phalloidin (Sigma). The coverslips were mounted on microscopic glass slides and viewed with a Axioskop 2 fluorescence microscope equipped with an Eclipse digital analyzer (Carl Zeiss).
NO measurement
NO concentrations were determined by measuring the amount of nitrite secreted by BV-2 cells into the culture medium using the Griess reagent system (Promega). 50 μl cell culture supernatant was collected and an equal volume of Griess reagent was added to each well. After incubation for 15 min at room temperature, the absorbance was read at 540 nm on a BMG FluoStar Optima plate reader (Labtech, Offenburg, Germany). The concentration of nitrite for each sample was calculated from a sodium nitrite standard curve.
Apoptosis assay
Apoptotic cell death of 661W cells was determined with the Caspase-Glo® 3/7 Assay (Promega). Cells were lysed and incubated with a luminogenic caspase-3/7 substrate, which contains the tetrapeptide sequence DEVD. Luminescence was then generated by addition of recombinant luciferase and was proportional to the amount of caspase activity present. The luminescent signal was read on a BMG FluoStar Optima plate reader (Labtech, Offenburg, Germany). A blank reaction was used to measure background luminescence associated with the cell culture system and Caspase-Glo® 3/7 Reagent. The value for the blank reaction was subtracted from all experimental values. Negative control reactions were performed to determine the basal caspase activity of 661W cells.
RNA isolation and reverse transcription
Total RNA was extracted from cultured microglia according to the manufacturer's instructions using the RNeasy Protect Mini Kit (Qiagen, Hilden, Germany). Purity and integrity of the RNA was assessed on the Agilent 2100 bioanalyzer with the RNA 6000 Nano LabChip® reagent set (Agilent Technologies, Büblingen, Germany). The RNA was quantified spectrophotometrically and then stored at -80°C. First-strand cDNA synthesis was performed with RevertAid™ H Minus First Strand cDNA Synthesis Kit (Fermentas, St. Leon-Rot, Germany).
DNA microarray analysis
Triplicate microarrays were carried out with three independent RNAs from non-stimulated BV-2 microglia or cultures treated for 24 h with 50 μM luteolin, 50 ng/ml LPS, or 50 μM LPS + 50 ng/ml LPS, respectively. Generation of double-stranded cDNA, preparation and labeling of cRNA, hybridization to Affymetrix 430 2.0 mouse genome arrays, washing, and scanning were performed according to the Affymetrix standard protocol. Minimum information about a microarray experiment (MIAME) criteria were met [
37]. The microarray datasets of this study are publicly available at the National Center for Biotechnology Information Gene Expression Omnibus
http://www.ncbi.nlm.nih.gov/geo/ as series record GSE18740.
The Affymetrix Expression Console Software Version 1.0 was used to create summarized expression values (CHP-files) from 3' expression array feature intensities (CEL-files) using the Robust Multichip Analysis (RMA) algorithm. Integrative analysis of genome-wide expression activities from BV-2 cells was performed with the Gene Expression Dynamics Inspector (GEDI), a Matlab (Mathworks, Natick, MA) freeware program which uses self-organizing maps (SOMs) to translate high-dimensional data into a 2D mosaic [
38]. Each tile of the mosaic represents an individual SOM cluster and is color-coded to represent high or low expression of the cluster's genes, thus identifying the underlying pattern.
Differentially regulated transcrips in 24 h luteolin stimulated versus non-treated and luteolin + LPS versus LPS-treated BV-2 cells, respectively, were retrieved with the Genomatix ChipInspector program (Genomatix Software GmbH, Munich, Germany), applying the Significance Analysis of Microarray (SAM) algorithm using a false-discovery rate of 0.1% and a minimum coverage of 3 independent probes.
Functional annotation of transcripts was performed using the Database for Annotation, Visualization, and Integrated Discovery (DAVID) [
39] and the Bibliosphere pathway edition (Genomatix).
Quantitative real-time RT-PCR
Amplifications of 50 ng cDNA were performed with an ABI7900HT machine (Applied Biosystems) in triplicates in 10 μl reaction mixtures containing 1 × TaqMan Universal PCR Master Mix (Applied Biosystems), 200 nM of primers and 0.25 μl dual-labeled probe (Roche ProbeLibrary). The reaction parameters were as follows: 2-min 50°C hold, 30-min 60°C hold, and 5-min 95°C hold, followed by 45 cycles of 20-s 94°C melt and 1-min 60°C anneal/extension. Measurements were performed in triplicate. Results were analyzed with an ABI sequence detector software version 2.3 using the ΔΔCt method for relative quantitation. Primer sequences and Roche Library Probe numbers are listed in Table
1.
Table 1
Primer pairs and Roche library probes for real time qRT-PCR validation
AA467197 | aaatggtggatcctactcaacc | gttgccctccggactttt | 17 |
Blvrb | tcctcggagttctcagcttt | gcaccgtcacctcataacct | 81 |
C3 | accttacctcggcaagtttct | ttgtagagctgctggtcagg | 76 |
CD36 | ttgaaaagtctcggacattgag | tcagatccgaacacagcgta | 6 |
CD83 | gctctcctatgcagtgtcctg | ggatcgtcagggaataggc | 2 |
Cfb | ctcgaacctgcagatccac | tcaaagtcctgcggtcgt | 1 |
Cst7 | atgtcagcaaagccctggta | ggtcttcctgcatgtagttcg | 67 |
Cxcl10 | gctgccgtcattttctgc | tctcactggcccgtcatc | 3 |
Ddit3 | ccaccacacctgaaagcag | tcctcataccaggcttcca | 33 |
Gbp2 | tgtagaccaaaagttccagacaga | gataaaggcatctcgcttgg | 62 |
Gbp3 | aagattgagctgggctacca | gaaactcttgagaacctcttttgc | 73 |
Gclm | tggagcagctgtatcagtgg | caaaggcagtcaaatctggtg | 18 |
Gusb | gtgggcattgtgctacctg | atttttgtcccggcgaac | 25 |
Hmox1 | ctgctagcctggtgcaaga | ccaacaggaagctgagagtga | 25 |
Hp | ccctgggagctgttgtca | ctttgggcagctgtcatctt | 15 |
Hprt1 | tcctcctcagaccgctttt | cctggttcatcatcgctaatc | 95 |
Ifi44 | ctgattacaaaagaagacatgacagac | aggcaaaaccaaagactcca | 78 |
Ifitm3 | aacatgcccagagaggtgtc | accatcttccgatccctagac | 84 |
Ifitm6 | ccggatcacattacctggtc | catgtcgcccaccatctt | 27 |
IL-6 | gatggatgctaccaaactggat | ccaggtagctatggtactccaga | 6 |
iNos | ctttgccacggacgagac | tcattgtactctgagggctga | 13 |
Irf7 | cttcagcactttcttccgaga | tgtagtgtggtgacccttgc | 25 |
Kdr | cagtggtactggcagctagaag | acaagcatacgggcttgttt | 68 |
Lcn2 | atgtcacctccatcctggtc | cctgtgcatatttcccagagt | 1 |
Lpcat1 | aatgtgaggcgtgtcatgg | ggcagtcctcaaatgtatagtcg | 81 |
Marco | cagagggagagcacttagcag | gccccgacaattcacatt | 20 |
Mpeg1 | cacagtgagcctgcacttaca | gcgctttcccaatagcttta | 69 |
Nupr1-F | gatggaatcctggatgaatatga | gtccgacctttccgacct | 64 |
Rnf145 | catggacttctggcttctcat | aataaaaagtgttcccagaacctg | 67 |
Saa3 | atgctcgggggaactatgat | acagcctctctggcatcg | 26 |
Slpi | gtgaatcctgttcccattcg | cctgagttttgacgcacctc | 69 |
Srxn1 | gctatgccacacagagaccata | gtgggaaagctggtgtcct | 33 |
Trib3 | gctatcgagccctgcact | acatgctggtgggtaggc | 98 |
Statistical analysis
Statistical analysis were performed on ΔΔCt data using analysis of variance with a two-sample Student's t test (P < 0.05) unless otherwise indicated. Quantitative data are expressed as mean ± SEM. The levels of gene expression in treated BV-2 cells are shown relative to control cells.
Discussion
Like other plant-derived flavonoids, luteolin has a variety of biological activities including well-known anti-mutagenic and anti-tumorigenic properties [
57]. Moreover, this flavone possesses direct anti-oxidant activity, which is attributed to structural features of all flavonoids, which favor scavenging of reactive oxygen and nitrogen species [
58]. Although the anti-oxidant and anti-inflammatory activities of luteolin may be also useful in the treatment of many chronic inflammatory diseases including neurodegeneration, only little information is available about luteolin-mediated transcriptional mechanisms or molecular targets in microglia [
59].
We have therefore performed the first genome-wide study of luteolin-mediated transcriptional effects in microglia. To our surprise, luteolin treatment did not only change expression levels of a few transcripts but had a broad and strong impact on the transcriptome of resting and particularly of LPS-activated microglia. The microarray dataset and the qRT-PCR validations revealed several luteolin-regulated pathways. Luteolin caused simultaneous up-regulation of four important anti-oxidant enzymes Srxn1, Blvrb, Gclm, and Hmox1. These data are consistent with earlier findings demonstrating increased Hmox1 transcription in RAW264.7 macrophages after luteolin treatment [
60]. Stimulation with the flavonoid induced binding of the transcription factor NF-E2-related factor 2 (Nrf2) to anti-oxidant response elements (ARE) in the Hmox1 promoter region [
60]. Luteolin is a potent activator of Nrf2 [
61] and the majority of anti-oxidant enzymes contain ARE in their regulatory regions, including Srxn1 [
62]. Moreover, mouse embryonic fibroblasts derived from Nrf2 -/- mice showed significantly lower Blvrb and Gclm mRNA levels upon Diquat induction [
63]. Therefore, we speculate that increased microglial expression of Srxn1, Blvrb, and Gclm is also mediated by activation of Nrf2. This hypothesis is further corroborated by the protective functions of Nrf2 in several microglia-related neurodegenerative disorders [
64].
Luteolin significantly enhanced mRNA synthesis of five other genes involved in different biological pathways. Lpcat1 is a lysophospholipid acyltransferase implicated in anti-inflammatory responses by converting lyso-platelet activation factor (lyso-PAF) to PAF and lyso-phosphatidylcholine (lyso-PC) to PC [
65]. LPC exerts considerable neuro-inflammatory reactivity in the brain and inhibition of LPC signaling in astrocytes and microglia confers neuroprotection [
66]. Lpcat1 is also highly expressed in the retina [
44], indicating that luteolin-induced Lpact1 levels could lead to diminished LPC levels in retinal microglia. Rnf145 was also up-regulated by luteolin but the function of this protein remains to be determined. Cd36 and Kdr (alias Vegfr2) were also significantly induced by luteolin in non-activated as well as activated microglia. The pattern recognition receptor Cd36 signals to the actin cytoskeleton and regulates microglial migration and phagocytosis [
67], whereas Kdr is involved in the chemotactic response of microglia [
46]. We thus speculate that luteolin-mediated expression of both genes could result in increased phagocytic responses of microglia without inducing inflammation.
Several reports have demonstrated that luteolin inhibits pro-inflammatory cytokine expression in various cell types by blocking NFkB (reviewed in [
28]). Our microarray data confirmed these findings and revealed further NFkB target genes including the recently discovered microRNA miR-147 [
48]. Recently, Jang et al. showed that luteolin reduced Il6 production mainly by inhibiting JNK signaling and AP1 activation [
34]. Luteolin did not affect IkB-α degradation or NFkB DNA binding in brain microglia, implicating that luteolin-mediated effects in microglia are not solely dependent on NFkB blockade [
34]. In line with this notion, our luteolin-regulated expression profiles identified several genes with NFkB-independent promoter control. Likewise, luteolin down-regulated complement factor 3, which is regulated by AP1 [
68] and blocked expression of Slpi, which is a target of interferon regulatory factor 1 (IRF1) [
69]. Luteolin also diminished mRNA levels of the pro-inflammatory GTPase Gbp2 and the acute phase protein Haptoglobin, which are both regulated by signal transducers and activators of transcription (STATs) [
70,
71]. These data clearly show that luteolin dampens microglia activation by interfering with several divergent signaling pathways.
The luteolin-regulated differential expression patterns also revealed genes involved in microglial apoptosis and ramification. Microglia are more susceptible than macrophages to apoptosis [
72] and recent evidence indicates that microglial apoptosis and senescence may precede neurodegeneration [
73]. Ddit 3 and Trib3, which were both induced by LPS and suppressed by luteolin, support stress and NO-mediated apoptosis [
50,
51]. We therefore hypothesize that luteolin could promote the survival of activated and stressed microglia in an environment of early neurodegeneration. Our expression data also revealed the unexpected finding that luteolin down-regulated Lcn2 and Marco, two molecules involved in microglial ramification and formation of filopodia. Lee
et al. demonstrated that stable expression of Lcn in BV-2 microglia, the same cell line we used in our experiments, induced a round cell shape with a loss of processes [
52]. In line with this, over-expression of the scavenger receptor Marco in dendritic cells caused rounding of cells and down-regulated antigen uptake [
53]. Thus, we hypothesized that the observed changes in mRNA levels of both genes might also translate into different morphological characters.
The morphological and functional assays fully supported the implications from gene expression profiles and revealed a direct effect of luteolin on the microglial phenotype. Luteolin stimulated the formation of filopodia and caused ramification of BV-2 cells and primary microglia even in the setting of strong LPS activation. Moreover, NO secretion was completely blocked in LPS-activated microglia upon co-incubation with luteolin. We studied the effects of conditioned media from microglia on cultured photoreceptor-like 661W cells and demonstrated that luteolin-treatment effectively protected 661W cells from LPS-induced microglial toxicity. Since NO and other reactive oxygen species are the major radicals secreted from microglia, we speculate that luteolin directly inhibits the secretion of these cytotoxic radicals. Our hypothesis is corroborated by recent data demonstrating that luteolin concentration-dependently attenuated LPS-induced dopaminergic neuron loss by blocking NO secretion from cultured rat microglia [
32].
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
KD, SE, and DK carried out all cell cultures and qRT-PCR experiments. MK, JH, and YW analyzed qRT-PCR and functional data. CM performed microarray hybridizations and raw data analyses. RF analyzed microarray data and critically read the manuscript. TL designed the study, obtained funding, carried out biostatistical analyses of microarrays and wrote the manuscript. All authors read and approved the final manuscript.