Background
Despite vaccination programs, outbreaks of infectious pancreatic necrosis disease (IPN) are frequent in farmed salmon fry and post-smolts. Mortality rates observed in outbreaks vary considerably and have in part been ascribed to the inherited differences in susceptibility of the host [
1‐
3]. Environmental stress [
4‐
7] and the viral strains [
8] also influence mortality. Atlantic salmon surviving an IPNV infection may become asymptomatic carriers of the virus for long periods [
9,
10]. The production of virus may increase under stress, and carriers can shed the virus and infect surrounding fish [
11].
The IPN virus (IPNV) is a bi-segmented double-stranded RNA (dsRNA) virus in the family
Birnaviridae encoding 5 viral proteins. Segment B encodes the RNA-dependent RNA polymerase VP1. Segment A encodes a polyprotein which is cotranslationally cleaved by the viral encoded serine-lysine protease (VP4) releasing the proteins pVP2 and VP3 [
12,
13]. pVP2 is further processed by host cell proteases to form the mature outer capsid protein VP2 [
14], which is the most abundant virus protein and contains the antigenic regions responsible for induction of neutralizing antibodies in the host [
15]. VP3 is the inner structural protein, which bound to dsRNA constitutes the ribonucleoprotein core structure [
16]. Additionally VP3 is shown to bind VP1 and to self-associate strongly, indicating that it is a matrix protein [
17]. An alternative open reading frame (ORF) on Segment A encodes the small, arginine-rich, non-structural protein VP5. The biological function of IPNV VP5 remains to be determined.
The molecular basis of IPNV virulence and its interplay with host antiviral mechanisms are not fully understood. Sano and co-workers [
18] were the first to suggest that the virulence of IPNV is associated with Segment A. Several studies using nucleotide sequence analyses have confirmed this and have shown that the VP2 residues 217 and 221 are the major determinant of virulence of IPNV serotype Sp strains. In addition, position 247 was seen as highly variable [
19]. Highly virulent isolates possess residues Thr
217 and Ala
221; moderate- to low-virulence strains have Pro
217 and Ala
221, while the strains containing Thr
221 are almost avirulent, irrespective of the residue at position 217. IPNV isolates also differ in properties related to replication rate and the ability to cause persistent infections. These characteristics can be attributed to the same amino acids as those determining the virulence [
8]. Although some of the factors behind these mechanisms are known there are still many questions to be answered.
During viral infections the initial response of the immune system is the induction of type I interferons (IFN), which mediate antiviral and immunomodulatory activity. In Atlantic salmon three different subtypes of type I IFN have been identified: IFN-a, b and c [
20]. IFN-a1 and c are both expressed in head kidney and are induced by poly I:C [
20]. IFN-a1 has been shown to provide protection against IPNV in salmonid cells [
21,
22]. The generation of anti-viral responses during infections requires a rapid viral sensing by pattern recognition receptors (PRRs). Toll-like receptors (TLRs) on the cell-surface or within endosomes recognize single-stranded RNA (ssRNA) and dsRNA [
23], while the helicases RIG-I and MDA5 recognize ssRNA and dsRNA in the cytosol [
24]. Additionally, dsRNA are recognized by PKR [
25]. A number of PRRs have been identified in Atlantic salmon including RIG-I [
26], MDA5 (GenBank: EG820831), PKR (GenBank: EF523422), TLR3 [
20], TLR8 [
27], TLR9 [
28] and TLR22 (GenBank: CAJ80696[
29] and FM206383). The latter is a dsRNA-specific PRR found exclusively in lower vertebrates [
30]. Several studies have shown strong activation of immune genes upon challenge with highly virulent IPNV isolates [
31,
32], and type I IFNs and the IFN-inducible Mx gene were among the most highly up-regulated genes. However, it remains to find, which PRRs are required for the induction of a systemic type I IFN response during IPNV infections.
Little is known about the relationship between the host responses and the virulence of different IPNV isolates. The latter can be associated with either down-regulation or excessive stimulation of innate immunity. Studies of IPNV infected cell-lines [
33,
34] have shown inhibition of IFN signaling. In the current work we have assessed immune gene expression changes during an experimental challenge of salmon post-smolts with both a virulent and an avirulent IPNV field strain. In addition to quantitative real-time RT PCR (qPCR) analyses of selected genes we used cDNA microarray, which expanded the repertoire of genes.
The two IPNV isolates used in this study were originally collected from field outbreaks of IPN with 32% and 5% reported mortality, respectively. Initial characterization of the isolates in our lab showed that they both contained the high virulent motif Thr
217 Ala
221 Thr
247 in VP2 defined by Santi et al [
19]. A previous bath challenge performed by our group included these isolates, and indicated that they differed substantially in virulence levels reflecting the field mortalities (unpublished). Sequencing of VP2 after this challenge confirmed the Thr
217 Ala
221 motif in both isolates. However, propagation of the isolates in cell-cultures before the challenge experiment reported here changed the isolate with the initial low mortality to contain a Thr
217 Thr
221 Thr
247 motif (low virulent motif). Santi et al [
19] suggested that the Ala-to-Thr substitution at position 221 in VP2 is a molecular determinant for the establishment of a persistent IPNV infection. Thus, we have analyzed the IPNV VP2 nucleotide composition in virus recovered from fish head kidney during the infection. Comparing sequences to the input strains could provide information about the rate and character of virus changes
in vivo.
Discussion
IPNV isolates have been reported to vary considerably in their virulence and pathogenicity for Atlantic salmon [
18,
19]. Previous studies have indicated that a combination of IPNV virulence and host pathogen interactions determines the outcome of IPNV infections. Occurrence of multiple strains indicates rapid changes of the virus but little is known about the rate and character of mutations. It also remains undefined if susceptibility of salmon to IPNV could be associated with low or excessive immune responses. In this study two Norwegian field isolates of IPNV with marked difference in mortality were applied for experimental infection of Atlantic salmon. For the first time the sequence changes and immune responses to low and high virulence strain were compared within a single challenge test.
Previous studies have identified the outer capsid protein VP2 as the main determinant of IPNV virulence as it comprises all the neutralizing epitopes and cell attachment sites that determine host or cell specificity [
15]. The amino acid signature associated with virulence of different strains is also identified within the VP2 region [
8,
19,
39]. The sequences of the two isolates in this study were determined before and after the challenge. Initially NFH-Ar had Thr
217-Ala
221-Thr
247 while NFH-El had Thr
217-Thr
221-Thr
247, implying high and low virulence of NFH-Ar and NFH-El respectively (Figure
3A). Thus the results from this study are in accordance with previously reports of the virulence motifs within VP2 [
19]. Rapid changes were seen during passage in cell culture and also during infection in the fish. After the challenge both isolates acquired Pro
217-Ala
221-Ala
247 motif in VP2 associated with the moderate to low virulence [
19]. Sequence analyses revealed a remarkably high rate of non-synonymous substitutions in the HVR containing the virulence motif. Commonly, high Ka/Ks ratios point to the divergent selection meaning that sequence changes increase the rate of reproduction. However in this study we observed accumulation of mutations that correlated with a reduction in virus proliferation, thus being favorable for the fish. End of mortality in NFH-Ar group coincided with the loss of the high virulence motif. To explain this finding, virus modification as the host's defense mechanisms can be hypothesized. Virus editing is a rapidly expanding research area. At present, the best studied actors are adenosine deaminases (ADARs) that target regions of dsRNA, converting adenosine (A) to inosine (I) resulting in an A to guanosine (G) change after second strand synthesis [
40]. ADARs target mRNAs, transposable elements and RNA viruses' genomes. In mammals, several families of viruses show A to G mutations thought to be caused by ADARs [
41]. The induction of ADAR in the NFH-Ar infected fish observed in the microarray in this study might indicate a possible role for ADAR in editing IPNV. Most of the changes observed in our study, disregarding whether synonymous or non-synonymous, were from A to G or from T to C (or
vice versa) associated with deamination (results not shown). However, whether the mutations in IPNV detected in this study are caused by salmon ADARs is an interesting question that needs to be addressed in future studies.
The two virus isolates used in this study showed greater discrepancies in the VP5 region than previously described isolates. The change of VP5 into a shorter protein in the NFH-Ar infected fish might imply a more benign virus since the longer 15.2 kDa VP5 protein was shown to have a potential antagonistic effect on the IFN response by inhibiting IFN-induced expression from the Mx promoter [
34] and might thereby benefit the viral replication. However, the domains responsible for this function have not been mapped and can still be present in the shorter 12.1 kDa version. An early stop-codon located in NFH-El leaves this isolate with a severely truncated form of VP5, only 28 amino acids long, and to our knowledge such a mutation has not been reported in other surveys of IPNV field isolates. It has been suggested that VP5 has an anti-apoptotic function, which is probably not essential for the virulence or persistence of the virus [
42,
43]. Functional significance of the observed changes in VP5 remained unclear. The amino acid sequences of VP1 ORF were identical between the two isolates throughout the study and VP4 were subject to very few mutations.
The mortality rates associated with the structural differences described above may be linked to the ability of virus to invade and replicate within the host cells and/or the scale and character of immune responses. Association between mortality and the virus titers was obvious (Figure
1). NFH-El characterized with low replication was avirulent while NFH-Ar infection was fatal at high rate of proliferation at 13 d p.i. To assess the immune responses, we used expression profiling with microarray and qPCR analyses of genes with well-established roles (IFNs, Mx and PRRs) and both approaches produced similar results. The expression levels of VRGs were apparently mirroring the viral titers and expression levels of the IPNV VP2. At 13 d p.i. VRG were induced in salmon infected with NFH-Ar but not with NFH-El consistently with the difference of virus titers. Up-regulation of VRG in NFH-E1 infected fish at 29 d p.i. was in line with the slight increase of virus titer and did not affect mortality. It is likely that the slower replication and concomitant slower spread of the NFH-El strain may allow time for a systemic induction of the host anti-viral system, including adaptive responses.
The IFN system is believed to have a crucial role in the first line of defense against virus infections, and
in vitro studies have demonstrated that IPNV replication in cell cultures is efficiently inhibited by salmon IFN-a1 [
21,
22]. Additionally, injection of synthetic IFN-inducers like CpG and poly I:C induce protection against IPNV in Atlantic salmon [
44]. In this study IFN-a1 was induced by both viral strains and major up-regulation was seen in the IFN-a1 dependent gene Mx. IFN-c, was not induced and even slightly down-regulated at 29 d p.i. for NFH-Ar. IFN-c is suggested to have a separate regulation from a and b and can be produced by a different cell population than IFN-a1 [
20]. IFN-b was not detected in this study or showed consistently low expression levels (data not shown). Despite the suggested role of type I IFN in restraining virus production, results in our lab has demonstrated that IFN-a1 does not completely inhibit IPNV growth but causes a delay in viral protein synthesis [
34]. Furthermore, our data suggest that IPNV-encoded proteins may be involved in weakening of IFN signaling [
34]. As a result high levels of viral proteins may impair the activity of IFN-induced genes, thus the higher replication rate of NFH-Ar compared to NFH-El may cause a more potent IFN-antagonizing effect of the NFH-Ar strain. However when interpreting the results from live pathogen challenges, it is important to keep in mind the complexity of such studies, where it is not straight forward whether an observed response is a strategy employed by the virus for its own benefit or a response by the host to control the virus.
Although innate immunity by itself represents a powerful system to combat viral invaders, many infections can only be cleared in combination with adaptive immunity. In this regard type I IFNs are known to promote the adaptive arm including both T cell mediated cellular responses and antibody production [
45,
46]. It is likely that the reduction of virus titers by 29 d p.i. could be associated with the onset of adaptive immune responses. Unlike the genes implicated in the innate immunity, sIgM showed no expression changes at 13 d p.i. and was slightly induced at 29 d p.i.
Results of this study added knowledge to the understanding of the immune responses after IPNV infections. Expression of a panel of PRRs was assessed including several recently identified genes. TLR8, 9 RIG-I and MDA5 showed up-regulation and followed the same trend as other immune genes. Earlier we observed a modest increase of TLR8 and 9 expression during stimulation and infection [
27,
28]. TLR22 is reported to recognize dsRNA in pufferfish and when over-expressed it induces type I IFN expression upon IPNV infection, which suggests a possible role for TLR22 in protection against IPNV [
30]. However, TLR22 was not induced by IPNV in this study. Unexpectedly, PKR, an IFN-inducible gene, was down-regulated at all time points except 13 d p.i. (Figure
4A). This was in contrast to Mx, another IFN-inducible gene and IFN-a1, which were up-regulated. Functional studies of salmon PKR have to our knowledge not been reported, however flounder PKR was up-regulated both
in vitro and
in vivo by a negative single stranded RNA virus (SMRV), which also induced Mx expression
in vitro[
47]. PRRs, PKR and MyD88 were down-regulated at 6 d p.i. in both study groups. This could be explained by migration of leukocytes expressing the PRRs from the head-kidney into the bloodstream at early time-points of the infection.
IFN-γ was together with Mx the most highly induced immune gene in this study, and high levels of IFN-γ has been reported in other IPNV challenge experiments [
31]. IFN-γ is regarded as a typical Th1 cytokine which bridges the innate and adaptive immune responses. Fish IFN-γ share several functional properties with mammalian IFN-γ including macrophage activation [
48‐
50] and rainbow trout IFN-γ is shown to signal through STAT1 [
50,
51]. Recently, we have observed antiviral activity against IPNV by IFN-γ, although the effect was not as pronounced as described for IFN-a1 [
52]. Like in mammals, fish IFN-γ plays diverse roles in different facets of the immune system, and the increased levels of IFN-γ upon IPNV challenge detected here suggest anti-IPNV activity.
Methods
Virus isolates
Two IPNV isolates, referred to as NFH-Ar and NFH-El, collected from field outbreaks of IPN in 2004 were used in this study. Veterinarians had diagnosed IPN based on clinical observations and by use of an agglutination assay (Phadebact coating kit, Boule Diagnostics AB). The NFH-Ar isolate, obtained from an IPN outbreak in Frøya, Norway in 2004, was reported to give 32% mortality, while the NFH-El, obtained from an IPN outbreak in Alta, Norway in 2004, was reported to give 5% mortality. Head kidney samples collected during these outbreaks were sent to our lab and tissue homogenates were made and inoculated on CHSE-214 cells for propagation and sequencing. For NFH-Ar a second, and for NFH-El a third cell-culture passage of the virus strain was used in the present experiment. The input strains were sequenced before challenge.
IPNV challenge of Atlantic salmon
The challenge was carried out at Tromsø Aquaculture Research Station (Tromsø, Norway). Non-vaccinated Atlantic salmon,
Salmo salar L., strain Aquagen IPNV sensitive (Aquagen, Kyrksæterøra, Norway), with an average size of 51 g, was used for the challenge two days after transfer to seawater. Bath challenge was performed as described by Johansen and Sommer [
53] using an infectious dose of TCID
50/ml = 5 × 10
5 of the field isolates NFH-Ar and NFH-El. Two parallel tanks supplied with 200 L of 10°C seawater were used for each isolate. Each tank contained 70 fish and a separate tank was used for 70 uninfected control fish. The fish were fed daily on commercial feed. The experiment was terminated 30 days after challenge.
Sampling
Mortality was monitored throughout the experiment by counting dead fish. An IPNV rapid agglutination kit (Phadebact coating kit, Boule Diagnostics AB) was used on head kidney samples from dead fish to verify IPN as the cause of death. Percent cumulative mortality in infected fish was calculated compared to control fish using GraphPad Prism 4.0 tool for statistical analyses. Sampling was performed on surviving fish. Pancreatic tissue and head kidney were aseptically removed from 4 fish in each tank at 6, 13 and 29 d p.i. Pancreatic tissue was stored in L-15 medium on ice until frozen at -80°C, whereas head kidney samples were stored in RNAlater® (Ambion) at -80°C.
Quantification of IPNV by titration
Pancreatic tissue was homogenized using an Ultra Thurrax T25 basic crusher (IKA-WERKE). Homogenized tissue was diluted to 5% in Eagle's minimum essential medium (EMEM) (Gibco) supplemented with 100 μg/ml streptomycin, 60 μg/ml penicillin, 2 mM L-glutamine and 1% non-essential amino acids, before centrifuged at 15000 × g for 5 min at 4°C. Homogenates were inoculated onto CHSE-214 cells in 96 wells plates at a starting concentration of 0.5% (w/v). Individual viral titers were determined by end-point titration using 10-fold dilutions and 2 replicates and calculated by the TCID
50 method [
54].
RNA isolation and cDNA synthesis
For analyses of cellular and viral gene expression total RNA from head kidney sampled from 8 challenged and 4 control fish at each time point, was isolated using a combination of Trizol and PureLink RNA Kit (Invitrogen). RNA quality was assessed on an agarose gel and the quantity determined by NanoDrop 2000 spectrophotometry (Thermo Scientific). No RNA degradation was observed. After isolation, the RNA was DNase treated applying TURBO DNase (Ambion). cDNA was synthesized in a 25 μl reaction from 200 ng DNase treated total RNA primed with random hexamers (TaqMan Reverse Transcription Reagents kit, Applied Biosystems). The manufacturer's protocol was followed. For isolation of viral RNA after passage in cell culture QIAamp Viral RNA Mini Kit (Qiagen) was used according to the manufacturer's instructions.
Sequencing of virus isolates
Each virus isolate was sequenced from virus derived material under the following conditions; origin (virus homogenates from head kidney pooled from 2 fish in field outbreak passaged 1× in cell culture), input (virus homogenates from head kidney pooled from 2 fish in field outbreak passaged 2-3× in cell culture), during infection(head kidney from day 13 (NFH-Ar) or day 29 (NFH-El) infected fish, 8 pooled individuals from each group). Primers specific for each of the genes encoding the five IPNV proteins were used to amplify the individual genes (from head kidney cDNA pooled from 8 fish or cDNA obtained from head kidney virus homogenates from 2 fish passaged in cell culture) in a PCR reaction using Pfu Turbo Hotstart DNA polymerase (Stratagene). The PCR-products were sequenced in both directions using the same primers and BigDye3.1 chemistry and a 3100 gene analyzer. The sequences were aligned with BioEdit 7.0.5 [
55] and DnaSP V5 [
56] was used for evaluation of mutation rates and search for HVR.
Microarray analyses
Microarray analyses were performed at 13 d p.i. on head kidney samples of salmon infected with isolates NFH-Ar and NFH-El (5 individuals from each group, one microarray per individual). The salmonid fish microarray (SFA 2.0 or immunochip, Geo Omnibus GPL6154) contains 1800 unique clones printed each in 6 spot replicates. Pooled samples of uninfected salmon (equal amounts of RNA, n = 4) were used as a common reference. Test and reference RNA (10 μg) were labeled with the fluorescent dyes Cy5-dUTP and Cy3-dUTP respectively (Amersham Pharmacia), which were incorporated in cDNA using the SuperScript™ Indirect cDNA Labeling System (Invitrogen). Synthesis of cDNA was performed at 46°C for 3 hours in a 23 μl reaction volume, following RNA degradation with 2.5 M NaOH at 37°C for 15 min and alkaline neutralization with 2 M Hepes. Labeled cDNA was combined and purified with Microcon YM30 (Millipore). Microarray slides were pre-treated with 1% BSA fraction V, 5× SSC and 0.1% SDS for 30 min at 50°C and then washed with 2× SSC (3 min) followed by 0.2× SSC (3 min) at room temperature and hybridized over-night at 60°C in a cocktail containing 1.3× Denhardt's, 3× SSC, 0.3% SDS, 0.67 μg/μl polyadenylate and 1.4 μg/μl yeast tRNA. After hybridization slides were washed at room temperature in 0.5 × SSC and 0.1% SDS (15 min), 0.5 × SSC and 0.01% SDS (15 min), 0.06 × SSC (2 min) and 0.06 × SSC (1 min). Scanning was performed with GenePix 4100A and images were processed with GenePix 6.0 (Molecular Devices). The spots were filtered by criterionI (I-B)B/(S+S ≥ 0.6, where I and B are the mean signal and background intensities and SI S
B
are the standard deviations. Low quality spots were excluded from analyses and genes with less than 3 high quality spots on a slide were discarded. After subtraction of median background from median signal intensities, the expression ratios (ER) were calculated. Lowess normalization was performed first for the whole slide and next for twelve rows and four columns per slide. Statistical analyses were performed in two stages. First, technical accuracy was assessed by difference of log2-ER from zero in six spot replicates and genes with significant changes (Student's t-test, p < 0.05) in at least 3 of 5 individuals per group were selected. Next, analysis of biological replicates was carried out and differential expression was assessed by the mean fold change (> 1.5) and difference from control (one sample t-test, p < 0.05).
Quantitative real-time RT PCR (qPCR) analyses
PCR primers used with Sybr Green assay were designed using Vector NTI (Invitrogen) and synthesized by Invitrogen (table
3). The amplicon lengths set to be between 50 and 200 bases were checked on 1.5% agarose gel. TaqMan assays employing a hydrolysis probe were designed using Assays-by-design (Applied Biosystems) and synthesized by Applied Biosystems. PCR efficiency was calculated from tenfold serial dilutions of cDNA for each assay in triplicates. qPCR assays were conducted using 2× SYBR
® Green Master Mix (Roche Diagnostics) in an optimized 12 μl reaction volume, using 1:10 diluted cDNA, with primer concentrations of 0.4-0.6 μM. PCR was performed in duplicate in 96-well optical plates on Light Cycler 480 (Roche Diagnostics) under the following conditions: 95°C for 5 min (pre-incubation), 95°C for 5 sec, 60°C for 15 sec, 72°C for 15 sec (amplification), 95°C for 5 sec, and 65°C for 1 min (melting curve). Forty cycles were performed. Assays employing a hydrolysis probe was conducted in a 20 μl reaction using 2.5 μl 1:10 fold diluted cDNA as template and 2× TaqMan Fast Universal PCR Master mix (Applied Biosystems). The expression of mRNA was measured in an ABI Prism 7500 FAST Cycler (Applied Biosystems) and the amplification profile was: 95°C for 20 sec followed by 40 cycles of 95°C for 3 sec and 60°C for 30 sec. PCR analyses of the SybrGreen assays for RIG-I, MDA5 and PKR at 13 and 29 d p.i. was also performed at the ABI Prism 7500 FAST Cycler. Relative expression of mRNA was evaluated by ΔΔCT, adjusted for PCR efficiency and normalized against the elongation factor (EF1AB). IPNV VP2 was undetected in control samples and at 6 d p.i., in order to calculate the ΔΔCT values the average of the NFH-El infected fish sampled at 29 d p.i was used as calibrator. Results were analyzed with ANOVA followed with Newman - Keuls test (p < 0.05). (See Table
1 for primers and probes used in the qPCR assays).
Table 3
Primers and probes used for qPCR analyses
EF1aB
| TaqMan | Forward Reverse Probe | TGCCCCTCCAGGATGTCTAC CACGGCCCACAGGTACTG AAATCGGCGGTATTGG | 2.0 | BG933897 |
IFN-c
| TaqMan | Forward Reverse Probe | TGGGCAGTGTGGATACAAGTG CTGCAATGTTCCCAAAGTACGTATT CTGTCCTGATGAGATAAT | 2.0 | EU735545 EU735547-50 |
IFN-a1
| TaqMan | Forward Reverse Probe | CCTTTCCCTGCTGGACCA TGTCTGTAAAGGGATGTTGGGAAAA CTTTGTGATATCTCCTCCCATC | 1.94 | AY2169594 AY2169595 |
IFN-γ
| TaqMan | Forward Reverse Probe | AAGGGCTGTGATGTGTTTCTG TGTACTGAGCGGCATTACTCC TTGATGGGCTGGATGACTTTAGGA | 2.0 | AY795563 |
Mx1/2 e/e
| TaqMan | Forward Reverse Probe | GATGCTGCACCTCAAGTCCTATTA CGGATCACCATGGGAATCTGA CAGGATATCCAGTCAACGTT | 2.0 | U66475 U66476 |
MyD88
| TaqMan | Forward Reverse Probe | GACAAAGTTTGCCCTCAGTCTCT CCGTCAGGAACCTCAGGATACT CTGGTGCCCGGAGCAA | 1.84 | EF672332 |
TLR8
| TaqMan | Forward Reverse Probe | ACCAAAACCACTAATGACATCATCTTCA TGGTGATGCCATCAGGTATGTTT CTCAGTCGACGCTCCTC | 1.7 | FJ467615 |
TLR9
| TaqMan | Forward Reverse Probe | TCTATGGCTGGGATGTCTGGTA CAGTTGTGAGTAGCCCTTGTGT CAGCACCTGGAAGCAG | 1.81 | EF672331 |
TLR22
| TaqMan | Forward Reverse Probe | ATTTATCCCGGAATCCATGTATCACG CCACAGTAGGCGATGTCTAACA CCTCAAGATAAGGAAGAACAT | 1.98 | AM233509 |
VP2 (IPNV)
| TaqMan | Forward Reverse Probe | GCCAAGATGACCCAGTCCAT TGACAGCTTGACCCTGGTGAT CCGACCGAGAACAT | 2.0 | AJ877117 |
Beta 2 microglobulin
| SybrGreen | Forward Reverse | TCGTTGTACTTGTGCTCATTTACAGC CAGGGTATTCTTATCTCCAAAGTTGC | 1,6 | BX076608 |
Galectin-3 binding protein
| SybrGreen | Forward Reverse | CCAGACCAACAGTGTTCACTTCAGC ACGTGAAAGACATACCTGCCCTCAC | 1,84 | BX079375 |
Galectin-9
| SybrGreen | Forward Reverse | GTCCTGTCTATTGCCTTCTCCAACC GGTTTCGTTGACCACTGTGTGGA | 1,76 | CU071943 |
MHC-IHC
| SybrGreen | Forward Reverse | CTGCATTGAGTGGCTGAAGA GGTGATCTTGTCCGTCTTTC | 1,72 | CU070775 |
Pre-B cell ef
| SybrGreen | Forward Reverse | GACTTCAATTTCCTGCTGGCTA CTGCTTGTAATGTGTGACCT | 1.77 | CA376673 |
RIG-I
| SybrGreen | Forward Reverse | GACGGTCAGCAGGGTGTACT CCCGTGTCCTAACGAACAGT | 1.97 | DY714827 |
MDA5
| SybrGreen | Forward Reverse | CAGAGGTGGGGTTCAATGAT AGCTCGCTCCACTTGTTGAT | 1.92 | FN396357 |
PKR
| SybrGreen | Forward Reverse | TTCCTGCATGGACTTGACTG GTGAGGAACCGGTGTTCTGT | 1.87 | BT046111 |
SRK2
| SybrGreen | Forward Reverse | TAGACATGGCACCATGGACCCTC GGGTTCTTCAGTGCAGACAGCCA | 1.81 | CA349577 |
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
AS performed most of the sequencing, assisted with the challenge experiment and quantification of virus, in addition he drafted the manuscript together with IS. qPCR analyses were performed by IS and GT. ME and BNF performed the challenge experiment and some of the sequencing and virus quantification. The microarray analyzes were done by SMJ and GT. AK contributed to this work with gene expression and sequence data and drafting the manuscript. JBJ designed the experiments, analyzed data and contributed to finalizing the manuscript. All authors read and approved the final manuscript.