Isolation and identification of a bovine viral diarrhea virus from sika deer in china

The significant cytopathic effects (CPE) were observed in MDBK cell infected with virus 24h-48h. The MDBK cells generate obvious cell lesion and net between cells in comparison to the control cells, which is consistent with CPE of BVDV on MDBK cell (Figure 1). The IPX assay showed that the well of positive serum appeared red-brown cytoplasmic staining, which suggested that new isolation virus might be BVDV. The negatively stained virus particles extracted from liver were approximately 40 nm-60 nm in diameter when examined by electron microscope (Figure 2), and displayed a typical BVDV morphology.

The MDBK cell infected with CCSYD were positive by the RT-PCR assays, and the expected sizes of the PCR products, 706 bp for E0 of CCSYD, were observed as clear electrophoretic band (Figure 3). The obtained E0 genes segment by sequencing has been deposited in GeneBank under accession No. FJ55520. Alignment with other 9 strains of BVDV, 7 strains of CSFV and 3 strains of BDV in the world, showed that the homology were 98.6%-84.8%, 76.0%-74.7%, 76.6%-77.0% for nucleotide sequence, respectively (Table 1), which shows that there is no significant deviation of CCSYD E0 with conventional BVDV.

To better understand the relationship of CCSYD to other 9 strain of BVDV, 7 strains of CSFV and 3 strains of BDV variants co-circulating in the word, genetic sequences of Pestivirus from cattle, swine and ovine in GenBank were used to construct phylogenetic trees. Figure 4 clearly showed that E0 genes of the CCSYD belonged to BVDV1b.

Field samples came from skia deer at field of Changchun (China), which might infected with BVDV according to clinical sign such as diarrhea and miscarriage and stillbirth. Skia deer liver was collected from an aborted fetus deer. A total of 1 g of fresh liver tissue was homogenized in 4 ml of phosphate-buffered saline (PBS, PH 7.2) and then repeated freeze thawed 3 times, and centrifuged at 5000 rpm for 30 min. A certain liver extract was then inoculated onto MDBK monolayer cultures, 25 cm flasks with a 1 ml inoculum (1:10 dilution of original samples) and the total volume was 5 ml. The MDBK cultures were observed for 6 days with presence or absences of CPE recorded. The cultures were frozen at 70°C, thawed and supernatants collected after centrifugation with subsequent storage at 70°C. Uninoculated cultures were included as negative controls and inoculated C₂₄V as positive control.

BVDV was detected by indirect immunoperoxidase test (IPX) and electron microscopy technique (EM). For IPX, the test was carried out on 96-well plates using low-passage MDBK cells. Serum (20 μl) was added to each of four wells before the addition of 100 μl of cell suspension. Positive and negative control sera were run on each plate. The test plates were incubated for 4 days in 5% CO₂, 37°C. Plates were fixed and dried, then stained with immunoperoxidase as described by Meyling [20], using a polyclonal bovine anti-BVDV serum (BVD virus positive control serum, China) to detect the virus. The presence of red-brown cytoplasmic staining in any of the wells exposed to the specific anti-BVDV antibody denoted a positive result. For electron microscopy technique (EM), chloroform (1/10 of the volume of the liver extract) was added into the liver extract, and then the liver extract) was added into the liver extract, and then the mixture was incubated for 30 min at 4°C and then centrifuged at 12000 rpm for 30 min. The precipitate was resuspended in 0.005 M moderate phosphate buffered saline (PBS; PH 7.2), and negatively stained with 2% phosphotungstic acid. The specimens were examined with a transmission electron microscope (Hitachi-8100, Japan) at 80 kV.

Total RNA was isolated from infected MDBK cell using TRIzol reagent (Invitrogen China) according to the manufacturer's protocol and as described in the online supplement. In short, 200 μl infected MDBK cell was incubated with 1 ml TRIzol for 5 min at room temperature (RT). Cell debris was removed by centrifugation (12,000 × g at 4°C for 10 min) and 0.4 ml chloroform was added. After vortexing the mix was incubated for 5 min at RT. The phases were separated by centrifugation (12,000 × g at 4°C for 15 min) and the aqueous phase was transferred to a new tube. 0.6 × volume of isopropyl alcohol and a 0.1 × volume of 3 M sodium acetate were added to this aqueous phase and incubated for 10 min at 4°C. The precipitated RNA was pelleted by centrifugation (12,000 × g at 4°C for 15 min) and after the removal of the supernatant the RNA pellet was washed twice with 70% ethanol. After drying, the RNA was resuspended in 30 μl DEPC-treated water. Using mRNA as template, single-stranded cDNAs were generated by Superscript II reverse transcriptase (Invitrogen) according to the manufacturer's directions. The E0 primer sequences were as follows: sense prime: 5'-CCGGATCCACCATGGAAAACATAACACAGTGG-3'; anti-sense prime: 5'- GCCTCGAGTTAAGCGTATGCTCCAAACCACGT -3'. The PCR conditions were 94°C for 3 min, followed by 30 cycles of DNA amplification (45s at 94°C, 1 min at 61°C, and 1 min 30s at 72°C) and 8 min incubation at 72°C. PCR products were separated by electrophoresis at a constant voltage (2 V/cm) in a 1.2% (w/v) agarose gel. The full-length E0 gene subjected to DNA sequencing.

The sequence data were analyzed with computer programs such as DNAMAN and DNASTAR. Phylogenetic analysis was done by the distance-based Neighbor-joining method using software EGA 4.1. (DNAStar Inc.).